.&F &$ (Cholera).7 ( > Z > + >.- W + &$ 8,) + ] ^/

Size: px
Start display at page:

Download ".&F &$ (Cholera).7 ( > Z > + >.- W + &$ 8,) + ] ^/"

Transcription

1 %,*+ : '(, #$%!" 45 # hly A /! -. sed2020@yahoo.com:! -, : 7( 86, : 3-9: : ;< ' %& #$ : >'" = ;< ', % #$ ()* : 3':?6;< ) +,-.. /0. 1))*, : ;5 = ;< DE/HA/C : F;!G" DE/C/A : I ( &'!$ % &$ "#! : JK 6?.9! &$ 7 &7 8* 2!)1!$ (/0.-!)* + &,) + $?@@.! &)*$>!7 <') 9 +=/9! $2 $ 2 ; 8 / hly A 81 : < F #!$ ) 4 ) : 9 8 BC 79 /D * A 4H ;)4 </./- )> & (- +2 )$.1 $!9 8 4* 4 G$.&F>.&F> #!$ 9 + $ hly A 2 81 (PCR)!)* &'! N O) 4.) / %M NON Agglutination (NAG) %?M > L-$ + $ 4 %IJ : L! + + $ %IJ +!Q ) 8) &$,Q ($!, (,/ (4, FP$ + + $!-!- ) &U hly A 81 O) 4 + $ %?@@ (/0.) 3' ($- + %TM (, + %SJ R4, -.) 2 #F 7)* %T 8) >* 2 L- /F + $ %VT +!Q 8 / + 8 /- + ($- Y$ ( Z9 + 4!5!' N!GW - +X ( : /;M + \ 7 &=/ ! hly A 81!!$ >! [= 4 9! 7/H 8 &7!C).&F &$ hly A 81!-!)* &' : /< -M. (Cholera).7 ( > Z > + >.- W + &$ 8,) \a P$ 8!G/ 3>. 9! 4! (.&$!X# R1F. (./! 9! C I ph V &$ = : + ] ^/ 8* 4 +) > _` 8 /- + 9! +$) )=.&$ 9!$/9

2 -K 7( 86 / +F> #!$ &$ 9 R$ + 8 R s $ g F +) ) +) ).&$ R') ph = `/S!# +) PH q* ta + +WF &$ S + 8 $ ) 84 89!i 4 ^H 9 &7 TCBS!W"= ta MI ºc Robert M. and ) )> & +!$/ ^H.(Joseph M ) 4* 4 G$ MI ºc &$ w $H1 $ 8 $ R)!9 &' 4, &Q >* 2 G$!1 $!$ (/0 B (,!H + 8 $H,) - > / 3$!)* 4 &F> 3;) 35 _J 8 $/- >* j + + Bidinost C. and Saka ) 9!$/9.(H.A. 2004!)* &$,Q!$ :!-!)* &$,Q!$ o Disk diffusion )$ j 4 G$!- )$! ( + t$ - 9 +W - method 4 G$ >* 8 / ta 7 N4* Arakawa E. and ) &F> 3;) /F. Z) &Ox.,!$ (.(Murase T (C: M@ mg)/g : 9 G$!-!)* (Te :M@ mg) ($- (E :?T mg) (, R4, - (OXY :M@ mg) ($-!, 7-!)* BBL )4$ &9 4 (SXT:_T mg) :?Tmg) (4, FP$ (GM :?@ mg) (,/ &9 4 (Dox :M@ mg) ($!, (Cip./9! Difco )4$ : 3 )1 [C$ ( B : hly A 81!!$ o 8)9 j t$ -!4 DNA [C$ 4 4! - H ( q.&f> W (Boiling) 9 Z,'-.$ L- + Z,)> > L-$ M + 2)!)1!)* 8=$ O) 4.&$ > %N) / I 8 /- &$ 8,) bc d- c 82 8* +;) + 9!)H Ansaruzzaman ) &$ "#! c2 g9.(m. and Bhuiyan NA. 2004!Q > + &$ 9 hg$ R7$!)7>). 9! c &$ J - M 84!i /)!$* 8 8 ; & + &$.)* ;)* + 8,)dF 8,H j2> ( 4 2) Pourshafie M.R. and Grimont F. ) >!.$ L- hly A 81.(2002!>F?.$ g ) + G- ( k ( + 9! hly A!)1 8=$ llbp 2 ;)!P- /F O) 4 L- ( lf m Murray ) 9! (/G$ > 8 = %T >*.( P.R W "=!$ ]'a- (!-!)* &'!1 $!nnnn9 2 (, - 81 O) $./F> # +X PCRj + hly A : < F?@@ +X : p/p-$ 4$ o 79 7D &97 2 4!$ + +) ) W (4 89 ) 87-) 8 BC +) ) R$ Y$ +) ) qc)!n) ND.&F>!C) &$ 9 r 8$79 4 +X 84 ]i/ 3-8 D ) +X 84 AX' +9) g 9 8, X

3 / hlya N! -. N$ 4 G$ nnnn nnnn,?@ <g/ml (C- &7 > 3;) Gel Duccumentation F DNA X# 4) 9 G$ (Gene Ruler Plus)?@@ bp!!p- /F 4* Q!nnn- (nnnn/0 (&nnnu nnnn9) &U Rnnnn/. 4 PCR G$ V.cholerae O 1 ElTOR ATCC (? 9) > : L! BC 79 7D 4 9 * A + $?@@ 4 + $ M@ $ M_ : 9 m ) ) 4 + $?_ $ _S 4 O) 4 + $ %?@@.1!$ O) 8) &U </ 4, $ R) &Q m-- + w $H1 7) 4* O) 4 ) 2) + $ %?@@ (/0 /9 &U ) %TJ %M!G/ 4* Z2)* B (,!H + &' O) 4 2 L- /F ; O) 4.)> j2> + $ 4 %T 7/- &U L- /F %VT 2) >* %IJ 2) p/p-$ O) 4.) 8)!G/ 2.) NAG %_M / %M > L-$ + $ M@ 4 2) 4 > + $ %?@@ ) 87-? } )) ) / %?@ > %V@!$ + $.(_ 89!$ + $ _S 4 (/0 ( 4.) > L-$ %_T NAG + $ %`T J >*!G/ 2 + $ 4 %T.)> j2> NAG + $? > + $ : m-- +!-!)* &'!$ O)4 + + $ 4 %_I %TM %S_ %SM %IJ ($-!, (, R4, - Tib Molbiol Synthesyntheselabor &9 jg$ (Singh D.V. and Matte G.R. 2001) : > GAG CCG GCA TTC ATC ATC TGA AT 5 - CTC AGC GGG CTA ATA CGG TTT A (PCR) 4H ;)4 </ t9 : PCR : > 3;) 4 Q Z;Q </ y C PCR </ 3;) &7 ml z/h + 8 T@!7).9 +C r ' : </ 3;) &7 PCR {2 4 4) Z;Q!- {2 </ F?@ dntp y C Taq Polymerase IH II H MgC12 D.D.W N DNA Z;Q () MV/_?!7) &Ox? mm each?/_t U/50 <l T@ pm T@ pm?/t pm o o PCR </ 3;) &7 8 y C 4 ^H bc 2 +) $ - = + $ + 4).9 # $ _T &7 &$ > r +.9! J`@ bp PCR R "a +'# _ VJ ºc Initial Denaturation +'#? VJ ºc Denaturation +'#? S@ ºc Annealing +'#? I_ ºc Extention ($ _T)+'#?@ I_ ºc Final Extention G$ 5 "a!$ : PCR R "a!$/9 o %?/T (Gibco) 4>* R1 4 Fnnnn R nnnn* p).&f> 3;)

4 -K 7( 86 / N!-G- BC 7)$79 (/0 A + 8/0 8 / + hly A.) hly A 81!1 $ &$ > r 2) BC! &)*$> ;! $ 2 $ !# &= ;!W ) -! (, - ( 9) (, - Nagamune K. and Yamamoto ) 9! R7$!$ t$ - 8* A$ bc- % (K !$ (!H + 8 -!! N!)1 ''a-.1 H ''a- &7.9! j4 ( t- * &$ +) )!$?VVV R$ -?VV? 7$ ( + (-5 *!H 4 +' 4 ~ > bc?vvm ! (.$)!# 7 >4 tdh tcp CT 9 +=/9 ^)5 F 4 (2 81 +!Q k /!) ƒ9- zot ƒ9-9!! $ 89 +w +!/2 $ Colombo M. and Mastrandrea S. )?VVV R$ +!''a- (/0 + + *!),)!Xa +) )!.(1997?@@ )) 4! $ 2 $ 8*?S 9 3;) / 8) hly A 81 7)*!N +!- W.(John Albert M. and Nurul A. 1997) ) &$ r #!1 $!$ +X %_M > + $ 4 %IJ!$ + $?@@ 4 +!$.) / L-$ + $ 4 %M NAG _S 4 * /-?VVM R$ +!1 $ R$.&$ > 8* + $ _J * &$ + $ T@ 4 * /- + N!$ 2)?VVJ 2) 89.) 8) &' /G ($- + +!Q ) 3' (, + + $ %`J 4 (/0./9 &$,Q ~ N.-!)* J ) 8) >* T!, R4, - + +)>/D &' +2. /9 (, ($- ($- +) ) N /) x 9 G$.-!)*!- + ~ 89.(M ) ) Y,Q (,! j hly A 81!!$,) 8) hly A 2 81!N PCR (2 L- /F + $ %VT +!Q /9!G/ L- /F 7)* %T ) 8) >* ta.(? 9) : P 3;) 8 ( + +X (?@@!1 H!$ 9 4 ) : BC $ &'!1 $!$ + &F> 3;) (.9 3;) 2) 7)*!)1 +X!-!)* 2 L- /F ( bc +X + $ %?@@ >* ta + $ %VT R7$ ; O) 4 2)!N /, hly A 81 y- N) ) -! +, ( /9! &U! Robert M. ) 9 81 ( &)*$> ;?VV` R$ +!''a-.(and Joseph M _S &F> 3;) +) ) _S 9 j2> &U hly A 81!$ +) ) 2 L- /F 8* +) ) J +!Q Singh D.V. and Matte G.R. ) )) 8) >*.(2001

5 / hlya N! -. (.&$ H!)7 j,> ( + &' + +)>/D &'.&$ %H 8$ ) ~ &' ($- ($-!, R4, - ) /G (,!N 89 +!Q k 9! 4!)* +' + (, 2;!$ +) ).) Y,Q ~ 7- : N;M A/ 9 ]'a- ( + X) hly A!)1! -.&$ > 8 2) BC.. x. + $. x. + $ hly A A;- R7$ ; O 1 bc- ) -! 8* A$!$/9. 9! (, !)4 "C Kurazono H. and ) ) )!$ + $ hly A 81.(Pal A ) +! R7$ +!) + y q,a q +,)1 -H 4! 9. 9! L-$ O) 4 mx + $ 9 3;) ]'a- U +)/0 &$ 9 bc > > j2> > 8 /- mx L-$ 2)!$* a # &' N 4 G-.&$.&$!4 > j2> > 7)*!- + $.(Dalasgarad A. and Forslund A. 1999) (H1?VVV R$ +!$ (/0 SS SI 4 &F> W &$ > j2> /. 7/- > L-$.(Mitra R. and Figuerua P. 2000)!)* + +)>/D &' +X ( ($-!, ($- /G 7- # + 9! (, R4, -!-92> 2) BC ''a-.&$!4 a +!-!)* +)>/D &' ;!/ ($- (,) (, /G Nagamune K. and ) &$ 9 +w R4, -.(Yamamoto K. 1997?VVJ -?VV? 7$ ( + +X +)>/D!-!)* &' 9 3;) 5 N)* R4, - ($- /G + Z7 4!, +D + 9 (, ( R$ J!i!H 6 H Alm R. and )9!-!)* +)>/D &'.(Manning P !''a- 2)?VVJ R$ ($- + 7)*!N &F> 3;)!?_ (4, FP$ + +!Q 3' R4, - O) 4.(Irma N. and Chung J.1988) ) Y,Q &7!C) 9 3;)!$ &' N 8* 4 ^H (4, FP$ R +Q 8 + &$!Q (.9! ($!, (,/!C) 8 / + ($- +9%> R$ M@!i 84 + &$ +F! 8 &7

6 -K 7( 86 /

7 / hlya N! -. '(' " # $ %&! 1 <2 1 hly A.8 #9: '0( / &*+,'-( #.( ) EH'C%' F G" '- E FG D'C A 8 B =9 8'/ ='>8?@ 1' M'(( 1. (V. cholerae O1 ElTor, ATCC: 14033) #0 I@ (K DNA %4C) 9@ I@ A 1 P R EFG D'C A 1 P Q E A 1 P 5E!EE7ENEOE5E!EE ES9@ I@ 1 P O E#0 I@ A 1 P Q EH'C%' F G" A 1 P ES ' bpS 6

8 -K 7( 86 / References: Alm R. and Manning P. (1988) Extracellular protein of V.cholerae, Mol. Microbiol. 2(4): Ansaruzzaman M. and Bhuiyan N.A. (2004) Cholera in Mozambique, Variant of Vibrio cholerae, Emerging Infectious Diseases. 10(11). Arakawa E. and Murase T. (2000) Pulsed Field Gel Electrophoresis Based Molecular Comparison of V.cholerae O1 Isolated from Domestic and Imported Cases of Cholera in Japan, Journal of Clinical Microbiology. 38(1): Bidinost C. and Saka H.A. (2004) Virulence factors of non-o1 non-o139 V.Cholerae isolated in Cordoba, Argentina, Revista Argentina de Microbiologia. 36: Colombo M. and Mastrandrea S. (1997) Tracking of clinical and environmental V.cholerae O1 strains by combined analysis and ERIC PCR.FEMS., Immunology and Medical Microbiology. 19: Dalasgaard A. and Forslund A. (1999) A high proportion of V.cholerae strains isolated from children with diarrhea in Bangkok, Thailand are multiple antibiotic resistant and belong to heterogenous non- O1, non-o139, O-Serotypes, Epidemiol. Infec. 122: Irma N. and Chung J. (1988) Genotypes associated with virulence inenvironmental Isolates of Vibrio cholerae, Applex and Environ Microbiology. 67(6): John Albert M. and Nurul A. (1997) Phenotypic and Genotypic changes in Vibrio cholerae O139 Bengal, Journal of Clinical Microbiology. 35(10): Kurazono H. and Pal A. (1995) Distribution of genes encoding cholera toxin, zonula occuldens toxin accessory cholera toxin, and El Tor hemolysin in Vibrio cholerae of diverse origins, Microbial pathogenesis. 18: Mitra R. and Figuerua P. (2000) Cell Vacuolation a Mainfestation of the El Tor hemolysin of Vibrio cholerae, Infect and Immune. 68(4): Murray P.R. (2003) Medical Microbiology Bacteriology Vol. 1, 8 th Edition ASM Press, Washington DC. Nagamune K. and Yamamoto K. (1995) Cloning and Sequencing of a novel hemolysin gene of Vibrio cholerae, FEMS Microbiology Letters. 128: Nagamune K. and Yamamoto K. (1997) Intramolecular chaperone activity of the pro-region of Vibrio cholerae El Tor cytolysin, JBC. 272(2): Pourshafie MR. and Grimoont F. (2002) A molecular and phenotypic study of Vibrio cholerae in Iran, Med. Microbiol. 51: Robert M. and Joseph M. (2004) Vibrio. Bacteriological Analytical Manual Online. Chapter9. Singh DV. And Matte GR. (2001) Molecular Analysis of Vibrio cholerae O1, O139, non-o1 and non-o139 strains, AEM. 67(2):

SSR ( ) Vol. 48 No ( Microsatellite marker) ( Simple sequence repeat,ssr),

SSR ( ) Vol. 48 No ( Microsatellite marker) ( Simple sequence repeat,ssr), 48 3 () Vol. 48 No. 3 2009 5 Journal of Xiamen University (Nat ural Science) May 2009 SSR,,,, 3 (, 361005) : SSR. 21 516,410. 60 %96. 7 %. (),(Between2groups linkage method),.,, 11 (),. 12,. (, ), : 0.

More information

SUPPORTING INFORMATION FOR. SEquence-Enabled Reassembly of β-lactamase (SEER-LAC): a Sensitive Method for the Detection of Double-Stranded DNA

SUPPORTING INFORMATION FOR. SEquence-Enabled Reassembly of β-lactamase (SEER-LAC): a Sensitive Method for the Detection of Double-Stranded DNA SUPPORTING INFORMATION FOR SEquence-Enabled Reassembly of β-lactamase (SEER-LAC): a Sensitive Method for the Detection of Double-Stranded DNA Aik T. Ooi, Cliff I. Stains, Indraneel Ghosh *, David J. Segal

More information

CRISPR-SeroSeq: A Developing Technique for Salmonella Subtyping

CRISPR-SeroSeq: A Developing Technique for Salmonella Subtyping Department of Biological Sciences Seminar Blog Seminar Date: 3/23/18 Speaker: Dr. Nikki Shariat, Gettysburg College Title: Probing Salmonella population diversity using CRISPRs CRISPR-SeroSeq: A Developing

More information

Distribution of virulence genes in Salmonella serovars isolated from man & animals

Distribution of virulence genes in Salmonella serovars isolated from man & animals Indian J Med Res 117, February 2003, pp 66-70 Distribution of virulence genes in Salmonella serovars isolated from man & animals H.V. Murugkar*, H. Rahman* & P.K. Dutta Department of Microbiology, College

More information

Practical Bioinformatics

Practical Bioinformatics 5/2/2017 Dictionaries d i c t i o n a r y = { A : T, T : A, G : C, C : G } d i c t i o n a r y [ G ] d i c t i o n a r y [ N ] = N d i c t i o n a r y. h a s k e y ( C ) Dictionaries g e n e t i c C o

More information

World Journal of Pharmaceutical Research SJIF Impact Factor 8.074

World Journal of Pharmaceutical Research SJIF Impact Factor 8.074 SJIF Impact Factor 8.074 Volume 7, Issue 5, 966-973. Research Article ISSN 2277 7105 MOLECULAR DETECTION OF ENTEROTOXIGENIC ISOLATES OF SALMONELLA TYPHIMURIUM, SHIGELLA FLEXNERI AND STAPHYLOCOCCUS AUREUS

More information

SUPPLEMENTARY DATA - 1 -

SUPPLEMENTARY DATA - 1 - - 1 - SUPPLEMENTARY DATA Construction of B. subtilis rnpb complementation plasmids For complementation, the B. subtilis rnpb wild-type gene (rnpbwt) under control of its native rnpb promoter and terminator

More information

Supplemental data. Pommerrenig et al. (2011). Plant Cell /tpc

Supplemental data. Pommerrenig et al. (2011). Plant Cell /tpc Supplemental Figure 1. Prediction of phloem-specific MTK1 expression in Arabidopsis shoots and roots. The images and the corresponding numbers showing absolute (A) or relative expression levels (B) of

More information

Characterization of Pathogenic Genes through Condensed Matrix Method, Case Study through Bacterial Zeta Toxin

Characterization of Pathogenic Genes through Condensed Matrix Method, Case Study through Bacterial Zeta Toxin International Journal of Genetic Engineering and Biotechnology. ISSN 0974-3073 Volume 2, Number 1 (2011), pp. 109-114 International Research Publication House http://www.irphouse.com Characterization of

More information

Clay Carter. Department of Biology. QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture.

Clay Carter. Department of Biology. QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture. QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture. Clay Carter Department of Biology QuickTime and a TIFF (LZW) decompressor are needed to see this picture. Ornamental tobacco

More information

Role as adhesin of muramidase released protein of Streptococcus s uis type 2

Role as adhesin of muramidase released protein of Streptococcus s uis type 2 2002, 25 (4) : 6771 Journal of Nanjing Agricultural University 2 1,2 1 3, (11, 210095 ; 21, 730070) : 2 (SS2) (MRP) : 11 HA9801 (MRP + ) SH006444 (MRP - ) HEp 2, MRP + MRP + ( P < 0105) 21 56 1 h ; DNase

More information

Supporting Information

Supporting Information Supporting Information T. Pellegrino 1,2,3,#, R. A. Sperling 1,#, A. P. Alivisatos 2, W. J. Parak 1,2,* 1 Center for Nanoscience, Ludwig Maximilians Universität München, München, Germany 2 Department of

More information

Table S1. Primers and PCR conditions used in this paper Primers Sequence (5 3 ) Thermal conditions Reference Rhizobacteria 27F 1492R

Table S1. Primers and PCR conditions used in this paper Primers Sequence (5 3 ) Thermal conditions Reference Rhizobacteria 27F 1492R Table S1. Primers and PCR conditions used in this paper Primers Sequence (5 3 ) Thermal conditions Reference Rhizobacteria 27F 1492R AAC MGG ATT AGA TAC CCK G GGY TAC CTT GTT ACG ACT T Detection of Candidatus

More information

Curriculum Vitae. Farzaneh Firoozeh Assistant Professor of Microbiology

Curriculum Vitae. Farzaneh Firoozeh Assistant Professor of Microbiology Curriculum Vitae Farzaneh Firoozeh Assistant Professor of Microbiology PERSONAL First name: Farzaneh Family name: Firoozeh Nationality: Iranian Marital status: Married OFFICE ADDRESS Department of Microbiology

More information

Supporting Information for. Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)-

Supporting Information for. Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)- Supporting Information for Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)- Dependence and Its Ability to Chelate Multiple Nutrient Transition Metal Ions Rose C. Hadley,

More information

Curriculum Links. AQA GCE Biology. AS level

Curriculum Links. AQA GCE Biology. AS level Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2

More information

Building a Multifunctional Aptamer-Based DNA Nanoassembly for Targeted Cancer Therapy

Building a Multifunctional Aptamer-Based DNA Nanoassembly for Targeted Cancer Therapy Supporting Information Building a Multifunctional Aptamer-Based DNA Nanoassembly for Targeted Cancer Therapy Cuichen Wu,, Da Han,, Tao Chen,, Lu Peng, Guizhi Zhu,, Mingxu You,, Liping Qiu,, Kwame Sefah,

More information

A genomic insight into evolution and virulence of Corynebacterium diphtheriae

A genomic insight into evolution and virulence of Corynebacterium diphtheriae A genomic insight into evolution and virulence of Corynebacterium diphtheriae Vartul Sangal, Ph.D. Northumbria University, Newcastle vartul.sangal@northumbria.ac.uk @VartulSangal Newcastle University 8

More information

PCR-based Restriction Fragment Length Polymorphism for Subtyping of Salmonella from Chicken Isolates

PCR-based Restriction Fragment Length Polymorphism for Subtyping of Salmonella from Chicken Isolates Kasetsart J. (Nat. Sci.) 44 : 79-83 (2010) PCR-based Restriction Fragment Length Polymorphism for Subtyping of Salmonella from Chicken Isolates Han Yu Jong 1, Pak Thae Su 1, Pannatee Sanpong 2, Worawidh

More information

Microbial DNA qpcr Multi-Assay Kit Clostridium perfringens Pathogenicity

Microbial DNA qpcr Multi-Assay Kit Clostridium perfringens Pathogenicity Microbial DNA qpcr Multi-Assay Kit Clostridium perfringens Pathogenicity Cat. no. 330043 BBID-1507ZR-3 For real-time PCR-based, application-specific microbial identification or profiling The Clostridium

More information

Number of strains/strain Accession Serogroup Country/Province(s)(n) Source ctxb*

Number of strains/strain Accession Serogroup Country/Province(s)(n) Source ctxb* Table S1. Strains used in this study Year of isolation Number of strains/strain Accession Serogroup Country/Province(s)(n) Source ctxb* This study 2001 1 - Non-O1/O139 Guangdong(1) Water - 2002 1 - Non-O1/O139

More information

2# / "-: ;<( 1= +

2# / -: ;<( 1= + (1) 8 1385 23-16 : 1('( )* +,-&.,/0 1(!"#$ %# & '& 2#3-4-5 6/ 780 9-5"-: ;, H/I M#? 85/4/13:E

More information

Introduction to microbiology

Introduction to microbiology Sulaimani University College of Pharmacy Microbiology Introduction to microbiology Dr. Abdullah Ahmed Hama PhD. Molecular Medical Parasitology abdullah.hama@spu.edu.iq 1 Definition Microbiology: is the

More information

evoglow - express N kit distributed by Cat.#: FP product information broad host range vectors - gram negative bacteria

evoglow - express N kit distributed by Cat.#: FP product information broad host range vectors - gram negative bacteria evoglow - express N kit broad host range vectors - gram negative bacteria product information distributed by Cat.#: FP-21020 Content: Product Overview... 3 evoglow express N -kit... 3 The evoglow -Fluorescent

More information

Geothermal locations at the Icelandic coast as a habitat for Vibrio cholerae. Eva Benediktsdóttir and Herdís E. Hermundardóttir

Geothermal locations at the Icelandic coast as a habitat for Vibrio cholerae. Eva Benediktsdóttir and Herdís E. Hermundardóttir Geothermal locations at the Icelandic coast as a habitat for Vibrio cholerae Eva Benediktsdóttir and Herdís E. Hermundardóttir 1 Overview V. cholerae strains in Iceland diversity and virulence factors

More information

SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS. Prokaryotes and Eukaryotes. DNA and RNA

SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS. Prokaryotes and Eukaryotes. DNA and RNA SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS 1 Prokaryotes and Eukaryotes 2 DNA and RNA 3 4 Double helix structure Codons Codons are triplets of bases from the RNA sequence. Each triplet defines an amino-acid.

More information

3 S. Heidelberg ESBL Extended spectrum lactamase

3 S. Heidelberg ESBL Extended spectrum lactamase Vol. 25 No. 123 almonella Heidelberg 1 almonella enterica serovar Heidelberg 1 3. Heidelberg EBL Extended spectrum lactamase CTX M 2 EBL. Heidelberg almonella enterica serovar Heidelberg 1 3. Heidelberg

More information

e-publication (Yes/No) Molecular Microbiology Wiley, United States of America

e-publication (Yes/No) Molecular Microbiology Wiley, United States of America FORMAT FOR SUBJECTWISE IDENTIFYING JOURNALS BY THE UNIVERSITIES AND APPROVAL OF THE UGC {Under Clause 6.05 (1) of the University Grants Commission (Minimum Qualifications for appointment of Teacher and

More information

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008 MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.

More information

Regulatory Sequence Analysis. Sequence models (Bernoulli and Markov models)

Regulatory Sequence Analysis. Sequence models (Bernoulli and Markov models) Regulatory Sequence Analysis Sequence models (Bernoulli and Markov models) 1 Why do we need random models? Any pattern discovery relies on an underlying model to estimate the random expectation. This model

More information

High throughput near infrared screening discovers DNA-templated silver clusters with peak fluorescence beyond 950 nm

High throughput near infrared screening discovers DNA-templated silver clusters with peak fluorescence beyond 950 nm Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2018 High throughput near infrared screening discovers DNA-templated silver clusters with peak fluorescence

More information

Announcements. It is critical that you are keeping up. Ask or see me if you need help. Lecture slides updated and homework solutions posted.

Announcements. It is critical that you are keeping up. Ask or see me if you need help. Lecture slides updated and homework solutions posted. Announcements Dec. 18 Hour Exam 1 C-109 Start time 6PM Coverage is Chapter 12 and 13. 10-multiple choice 3-fairly short problems 3-longer problem solving 100 point Exam Lecture slides updated and homework

More information

AND BRUCE A. MCCLANE 1 *

AND BRUCE A. MCCLANE 1 * JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 2001, p. 883 888 Vol. 39, No. 3 0095-1137/01/$04.00 0 DOI: 10.1128/JCM.39.3.883 888.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Genotyping

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Zn 2+ -binding sites in USP18. (a) The two molecules of USP18 present in the asymmetric unit are shown. Chain A is shown in blue, chain B in green. Bound Zn 2+ ions are shown as

More information

Characterization of Clostridium perfringens isolated from mammals and birds from Guwahati city, India

Characterization of Clostridium perfringens isolated from mammals and birds from Guwahati city, India The Journal of Venomous Animals and Toxins including Tropical Diseases ISSN 1678-9199 2012 volume 18 issue 1 pages 83-87 Original Paper Characterization of Clostridium perfringens isolated from mammals

More information

Element Cube Project (x2)

Element Cube Project (x2) Element Cube Project (x2) Background: As a class, we will construct a three dimensional periodic table by each student selecting two elements in which you will need to create an element cube. Helpful Links

More information

2 Salmonella Typhimurium

2 Salmonella Typhimurium 96 2006 Salmonella Typhimurium 2 1) 1) 2) 1) 2) 18 1 10 18 4 27 2 Salmonella Typhimurium 1 7 2 7 (ciprofloxacin (CPFX) MIC 16 mg/ml) S. Typhimurium 2 fosfomycin (FOM) 1 PCR gyra parc RAPD-PCR DNA S. Typhimurium

More information

Introduction to Microbiology. CLS 212: Medical Microbiology Miss Zeina Alkudmani

Introduction to Microbiology. CLS 212: Medical Microbiology Miss Zeina Alkudmani Introduction to Microbiology CLS 212: Medical Microbiology Miss Zeina Alkudmani Microbiology Micro- means very small (that needs a microscope to see). Microbiology is the study of very small living organisms.

More information

Advanced topics in bioinformatics

Advanced topics in bioinformatics Feinberg Graduate School of the Weizmann Institute of Science Advanced topics in bioinformatics Shmuel Pietrokovski & Eitan Rubin Spring 2003 Course WWW site: http://bioinformatics.weizmann.ac.il/courses/atib

More information

evoglow - express N kit Cat. No.: product information broad host range vectors - gram negative bacteria

evoglow - express N kit Cat. No.: product information broad host range vectors - gram negative bacteria evoglow - express N kit broad host range vectors - gram negative bacteria product information Cat. No.: 2.1.020 evocatal GmbH 2 Content: Product Overview... 4 evoglow express N kit... 4 The evoglow Fluorescent

More information

Comparative Genomics Final Results

Comparative Genomics Final Results Comparative Genomics Final Results April 20, 2016 Juan Castro, Aroon Chande, Cheng Chen, Evan Clayton, Hector Espitia, Alli Gombolay, Walker Gussler, Ken Lee, Tyrone Lee, Hari Prasanna, Carlos Ruiz, Niveda

More information

Advanced Placement. Chemistry. Integrated Rates

Advanced Placement. Chemistry. Integrated Rates Advanced Placement Chemistry Integrated Rates 204 47.90 9.22 78.49 (26) 50.94 92.9 80.95 (262) 52.00 93.94 83.85 (263) 54.938 (98) 86.2 (262) 55.85 0. 90.2 (265) 58.93 02.9 92.2 (266) H Li Na K Rb Cs Fr

More information

Sample Problem. (b) Mass % H 2 SO 4 = kg H 2 SO 4 /1.046 kg total = 7.04%

Sample Problem. (b) Mass % H 2 SO 4 = kg H 2 SO 4 /1.046 kg total = 7.04% A Sample 0.750 M solution Problem of H 2 SO 4 in water has a density of 1.046 g/ml at 20ºC. What is the concentration in (a) mole fraction, (b) mass percent, (c) molality (MM = 98.086 g/mol)? (a) Since

More information

Rapid Determination of Lymphogranuloma Venereum Serovars of Chlamydia. trachomatis by quantitative High-Resolution Melt Analysis (HRMA)

Rapid Determination of Lymphogranuloma Venereum Serovars of Chlamydia. trachomatis by quantitative High-Resolution Melt Analysis (HRMA) JCM Accepts, published online ahead of print on 29 August 2012 J. Clin. Microbiol. doi:10.1128/jcm.01670-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Rapid Determination

More information

Survey of plasmid profiles of Shigella species isolated in Malaysia during

Survey of plasmid profiles of Shigella species isolated in Malaysia during World Journal of Microbiology & Biotechnology (2005) 21: 271 278 Ó Springer 2005 DOI 10.1007/s11274-004-3631-0 Survey of plasmid profiles of Shigella species isolated in Malaysia during 1994 2000 C.H.

More information

Circle the letters only. NO ANSWERS in the Columns!

Circle the letters only. NO ANSWERS in the Columns! Chemistry 1304.001 Name (please print) Exam 5 (100 points) April 18, 2018 On my honor, I have neither given nor received unauthorized aid on this exam. Signed Date Circle the letters only. NO ANSWERS in

More information

The Bacterial Causes of Camel-calf (Camelus dromedarius) Diarrhea in Eastern Sudan.

The Bacterial Causes of Camel-calf (Camelus dromedarius) Diarrhea in Eastern Sudan. Proceedings of the Third Annual Meeting for Animal Production Under Arid Conditions, Vol. 2: 132-137 1998United Arab Emirates University. The Bacterial Causes of Camel-calf (Camelus dromedarius) Diarrhea

More information

35H MPa Hydraulic Cylinder 3.5 MPa Hydraulic Cylinder 35H-3

35H MPa Hydraulic Cylinder 3.5 MPa Hydraulic Cylinder 35H-3 - - - - ff ff - - - - - - B B BB f f f f f f f 6 96 f f f f f f f 6 f LF LZ f 6 MM f 9 P D RR DD M6 M6 M6 M. M. M. M. M. SL. E 6 6 9 ZB Z EE RC/ RC/ RC/ RC/ RC/ ZM 6 F FP 6 K KK M. M. M. M. M M M M f f

More information

Supplementary Information

Supplementary Information Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Directed self-assembly of genomic sequences into monomeric and polymeric branched DNA structures

More information

Molecular epidemiology of HBV in The Netherlands Hein J. Boot

Molecular epidemiology of HBV in The Netherlands Hein J. Boot Hein J. Boot 1 Why is HBV molecular typing important? Effectiveness of targeted vaccination programs Identification of new transmission routes Fast detection of central (medical) infection source Spread

More information

Measuring the size and shape of macromolecules. Hydrodynamics: study of the objects in water How do the move? Translation Rotation

Measuring the size and shape of macromolecules. Hydrodynamics: study of the objects in water How do the move? Translation Rotation Measuring the size and shape of macromolecules Hydrodynamics: study of the objects in water How do the move? Translation Rotation 1) Movement with no external forcefree diffusion 2) Movement under the

More information

Empowers Families Unites Communities Builds Capacity. An In. Read and Rise. Cultivates Literacy

Empowers Families Unites Communities Builds Capacity. An In. Read and Rise. Cultivates Literacy 8 Emw Fm U Cmm B Cc g A I Y h P R c L DY : U T S E CAS g L b U N ff H I h H c D Sch R R Cv Lc CASE STUDY A Ig P h Y Lc R Th N Ub Lg H ff wh H I Sch Dc (HISD) c Schc R R, fcg cfc hw gg mw fm f h ch c h

More information

M $ 4 65\ K;$ 5, 65\ M $ C! 4 /2 K;$ M $ /+5\ 8$ A5 =+0,7 ;* C! 4.4/ =! K;$,7 $,+7; ;J zy U;K z< mj ]!.,,+7;

M $ 4 65\ K;$ 5, 65\ M $ C! 4 /2 K;$ M $ /+5\ 8$ A5 =+0,7 ;* C! 4.4/ =! K;$,7 $,+7; ;J zy U;K z< mj ]!.,,+7; V 3U. T, SK I 1393/08/21 :,F! 1393/10/29 ::!n> 2 1 /M + - /E+4q; Z R :'!3Qi M $,7 8$ 4,!AK 4 4/ * /;K "FA ƒf\,7 /;G2 @;J\ M $ 4 65\ K;$ 5, 65\ M $ C! 4 /2 K;$ M $ /+5\ 8$ A5 =+0,7 ;* C! 4.4/ =! K;$,7 $,+7;

More information

APPENDIX IV Data Tables

APPENDIX IV Data Tables APPENDIX IV Data Tables Table A1 National institutions supplying data 57 Table A2 Total population data, by country, 1999-2004 58 Table A3 Percentage age distribution of population, by country, 1999 2004

More information

Subtype distribution of Haemophilus influenzae isolates from North India

Subtype distribution of Haemophilus influenzae isolates from North India J. Med. Microbiol. Vol. 51 (2002), 399 404 # 2002 Society for General Microbiology ISSN 0022-2615 MOLECULAR EPIDEMIOLOGY Subtype distribution of Haemophilus influenzae isolates from North India A. SHARMA,

More information

The Fimbria Gene Cluster of Nonencapsulated Haemophilus influenzae

The Fimbria Gene Cluster of Nonencapsulated Haemophilus influenzae INFECTION AND IMMUNITY, Feb. 1998, p. 406 417 Vol. 66, No. 2 0019-9567/98/$04.00 0 Copyright 1998, American Society for Microbiology The Fimbria Gene Cluster of Nonencapsulated Haemophilus influenzae FORIEN

More information

Kharkov National Medical University. Head of Microbiology, Virology and Immunology Department Minukhin Valeriy Vladimirivich

Kharkov National Medical University. Head of Microbiology, Virology and Immunology Department Minukhin Valeriy Vladimirivich Kharkov National Medical University Head of Microbiology, Virology and Immunology Department Minukhin Valeriy Vladimirivich Tkachenko Victoria 1, 5, 11, 14, 19, 21, 30 Kovalenko Natalia 2, 12, 25, 29 Siritsa

More information

MEDLINE Clinical Laboratory Sciences Journals

MEDLINE Clinical Laboratory Sciences Journals Source Type Publication Name ISSN Peer-Reviewed Academic Journal Acta Biochimica et Biophysica Sinica 1672-9145 Y Academic Journal Acta Physiologica 1748-1708 Y Academic Journal Aging Cell 1474-9718 Y

More information

Circle the letters only. NO ANSWERS in the Columns! (3 points each)

Circle the letters only. NO ANSWERS in the Columns! (3 points each) Chemistry 1304.001 Name (please print) Exam 4 (100 points) April 12, 2017 On my honor, I have neither given nor received unauthorized aid on this exam. Signed Date Circle the letters only. NO ANSWERS in

More information

CHEM 107 (Spring-2005) Exam 3 (100 pts)

CHEM 107 (Spring-2005) Exam 3 (100 pts) CHEM 107 (Spring-2005) Exam 3 (100 pts) Name: ------------------------------------------------------------------------, Clid # ------------------------------ LAST NAME, First (Circle the alphabet segment

More information

FOR RUMINANTS. kemin.com/guthealth

FOR RUMINANTS. kemin.com/guthealth FOR RUMINANTS kemin.com/guthealth What is CLOSTAT? CLOSTAT contains a proprietary, patented strain of Bacillus subtilis PB6. PB6 is a unique, naturally occurring, spore-forming microorganism. Kemin has

More information

Salmonella enteritidis Identification and Isolation

Salmonella enteritidis Identification and Isolation Department of Microbiology, Qom Branch, Islamic Azad University. Qom, Iran Start Here Advisor Dr.Mohsen Zargar Consulting Advisor Dr.Taghi Salehi Zahraei Presented by Zeinab Yazdanpanah 1 Outcome Enterobacteriaceae

More information

Salmonella Serotyping

Salmonella Serotyping Salmonella Serotyping Patricia Fields National Salmonella Reference Lab CDC 10 th Annual PulseNet Update Meeting April 5, 2006 What is Salmonella serotyping? The first-generation subtyping method Established

More information

Chain-like assembly of gold nanoparticles on artificial DNA templates via Click Chemistry

Chain-like assembly of gold nanoparticles on artificial DNA templates via Click Chemistry Electronic Supporting Information: Chain-like assembly of gold nanoparticles on artificial DNA templates via Click Chemistry Monika Fischler, Alla Sologubenko, Joachim Mayer, Guido Clever, Glenn Burley,

More information

Lecture IV A. Shannon s theory of noisy channels and molecular codes

Lecture IV A. Shannon s theory of noisy channels and molecular codes Lecture IV A Shannon s theory of noisy channels and molecular codes Noisy molecular codes: Rate-Distortion theory S Mapping M Channel/Code = mapping between two molecular spaces. Two functionals determine

More information

Chem Exam 1. September 26, Dr. Susan E. Bates. Name 9:00 OR 10:00

Chem Exam 1. September 26, Dr. Susan E. Bates. Name 9:00 OR 10:00 Chem 1711 Exam 1 September 26, 2013 Dr. Susan E. Bates Name 9:00 OR 10:00 N A = 6.022 x 10 23 mol 1 I A II A III B IV B V B VI B VII B VIII I B II B III A IV A V A VI A VII A inert gases 1 H 1.008 3 Li

More information

TM1 TM2 TM3 TM4 TM5 TM6 TM bp

TM1 TM2 TM3 TM4 TM5 TM6 TM bp a 467 bp 1 482 2 93 3 321 4 7 281 6 21 7 66 8 176 19 12 13 212 113 16 8 b ATG TCA GGA CAT GTA ATG GAG GAA TGT GTA GTT CAC GGT ACG TTA GCG GCA GTA TTG CGT TTA ATG GGC GTA GTG M S G H V M E E C V V H G T

More information

KIR gene polymorphism study in the Uygur population in Xinjiang, China

KIR gene polymorphism study in the Uygur population in Xinjiang, China KIR gene polymorphism study in the Uygur population in Xinjiang, China G.-Y. Lin and Y.-B. Wang No. 474 Hospital of Chinese PLA, Urumqi, China Corresponding author: G.-Y. Lin E-mail: lgy474@yeah.net Genet.

More information

Studies on virulence characters of Salmonella Typhimurium isolated from animal and human. Khalilia A. El-Taib

Studies on virulence characters of Salmonella Typhimurium isolated from animal and human. Khalilia A. El-Taib Studies on virulence characters of Salmonella Typhimurium isolated from animal and human. Khalilia A. El-Taib Microbiology Unit, Suez Canal university Hospitals, Egypt dr. khalilia11@yahoo.com Abstract:

More information

Introduction to the SNP/ND concept - Phylogeny on WGS data

Introduction to the SNP/ND concept - Phylogeny on WGS data Introduction to the SNP/ND concept - Phylogeny on WGS data Johanne Ahrenfeldt PhD student Overview What is Phylogeny and what can it be used for Single Nucleotide Polymorphism (SNP) methods CSI Phylogeny

More information

Electronic supplementary material

Electronic supplementary material Applied Microbiology and Biotechnology Electronic supplementary material A family of AA9 lytic polysaccharide monooxygenases in Aspergillus nidulans is differentially regulated by multiple substrates and

More information

What are viruses? Marine Viruses I & II. OCN 626 Marine Microplankton Ecology. Characteristics, Abundance, and Diversity

What are viruses? Marine Viruses I & II. OCN 626 Marine Microplankton Ecology. Characteristics, Abundance, and Diversity OCN 626 Marine Microplankton Ecology Marine Viruses I & II Characteristics, Abundance, and Diversity What Are Viruses? What are they made of? How do they replicate? Are they alive? What are viruses? Infectious

More information

Detection of Enterotoxic Bacillus cereus Producing Hemolytic and Non Hemolytic Enterotoxins by PCR Test

Detection of Enterotoxic Bacillus cereus Producing Hemolytic and Non Hemolytic Enterotoxins by PCR Test Polish Journal of Microbiology 2006, Vol. 55, No 2, 113 118 Detection of Enterotoxic Bacillus cereus Producing Hemolytic and Non Hemolytic Enterotoxins by PCR Test EL BIETA O TUSZAK-WALCZAK *, PIOTR WALCZAK

More information

Natural Genetic Resistance to Infection

Natural Genetic Resistance to Infection Natural Genetic Resistance to Infection The Discovery of Natural Determinants of Susceptibility to Infection in Cattle, especially Tarentaise Steve A Carlson, DVM PhD Tim A Day, PhD PSR Genetics, LLC Scott

More information

Crick s early Hypothesis Revisited

Crick s early Hypothesis Revisited Crick s early Hypothesis Revisited Or The Existence of a Universal Coding Frame Ryan Rossi, Jean-Louis Lassez and Axel Bernal UPenn Center for Bioinformatics BIOINFORMATICS The application of computer

More information

Flow Cytometry In Microbiology: Technology And Applications READ ONLINE

Flow Cytometry In Microbiology: Technology And Applications READ ONLINE Flow Cytometry In Microbiology: Technology And Applications READ ONLINE If searching for a book Flow Cytometry in Microbiology: Technology and Applications in pdf format, in that case you come on to the

More information

Pathways and Controls of N 2 O Production in Nitritation Anammox Biomass

Pathways and Controls of N 2 O Production in Nitritation Anammox Biomass Supporting Information for Pathways and Controls of N 2 O Production in Nitritation Anammox Biomass Chun Ma, Marlene Mark Jensen, Barth F. Smets, Bo Thamdrup, Department of Biology, University of Southern

More information

By Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food Supervised by Henrik Hasman, PhD

By Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food Supervised by Henrik Hasman, PhD By Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food elibi@food.dtu.dk Supervised by Henrik Hasman, PhD 1. Introduction to plasmid biology 2. Plasmid encoded resistance to β- lactams (basic theories)

More information

Microbial Taxonomy and the Evolution of Diversity

Microbial Taxonomy and the Evolution of Diversity 19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy

More information

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG

More information

The Open Microbiology Journal

The Open Microbiology Journal Send Orders for Reprints to reprints@benthamscience.ae The Open Microbiology Journal, 2017, 11, i-vi The Open Microbiology Journal Supplementary Material Content list available at: www.benthamopen.com/tomicroj/

More information

Ledyard Public Schools Science Curriculum. Biology. Level-2. Instructional Council Approval June 1, 2005

Ledyard Public Schools Science Curriculum. Biology. Level-2. Instructional Council Approval June 1, 2005 Ledyard Public Schools Science Curriculum Biology Level-2 1422 Instructional Council Approval June 1, 2005 Suggested Time: Approximately 9 weeks Essential Question Cells & Cell Processes 1. What compounds

More information

Supplemental Table 1. Primers used for cloning and PCR amplification in this study

Supplemental Table 1. Primers used for cloning and PCR amplification in this study Supplemental Table 1. Primers used for cloning and PCR amplification in this study Target Gene Primer sequence NATA1 (At2g393) forward GGG GAC AAG TTT GTA CAA AAA AGC AGG CTT CAT GGC GCC TCC AAC CGC AGC

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.8/NCHEM. Conditionally Fluorescent Molecular Probes for Detecting Single Base Changes in Double-stranded DNA Sherry Xi Chen, David Yu Zhang, Georg Seelig. Analytic framework and probe design.. Design

More information

(C) Pavel Sedach and Prep101 1

(C) Pavel Sedach and Prep101 1 (C) Pavel Sedach and Prep101 1 (C) Pavel Sedach and Prep101 1 (C) Pavel Sedach and Prep101 2 (C) Pavel Sedach and Prep101 2 (C) Pavel Sedach and Prep101 3 (C) Pavel Sedach and Prep101 3 (C) Pavel Sedach

More information

(please print) (1) (18) H IIA IIIA IVA VA VIA VIIA He (2) (13) (14) (15) (16) (17)

(please print) (1) (18) H IIA IIIA IVA VA VIA VIIA He (2) (13) (14) (15) (16) (17) CHEM 10113, Quiz 3 September 28, 2011 Name (please print) All equations must be balanced and show phases for full credit. Significant figures count, show charges as appropriate, and please box your answers!

More information

FINAL EXAM April 26, 2004

FINAL EXAM April 26, 2004 CM 1045 (11:15 am Lecture) Dr. Light FINAL EXAM April 26, 2004 Name (please print) Check your recitation section: Sec. 21 5:30-6:20 pm (Popovic) Sec. 24 3:30-4:20 pm (Giunta) Sec. 22 6:30-7:20 pm (Popovic)

More information

Whitney Grummon. She kick started a fire in my soul Teaching me a tool to cleanse my mind That ll last a life time. That s how I will remember

Whitney Grummon. She kick started a fire in my soul Teaching me a tool to cleanse my mind That ll last a life time. That s how I will remember W Gmm S kk f m T m m m T f m T I mmb N m p f p f f G L A f b k, b k v M k b p:, bb m, m f m, v. A b m, f mm mm f v b G p. S m m z pp pv pm f, k mk, f v M. I m, I m, fm k p x. S f 45 m m CMS, I p mf,. B

More information

APPENDIX II. Laboratory Techniques in AEM. Microbial Ecology & Metabolism Principles of Toxicology. Microbial Physiology and Genetics II

APPENDIX II. Laboratory Techniques in AEM. Microbial Ecology & Metabolism Principles of Toxicology. Microbial Physiology and Genetics II APPENDIX II Applied and Environmental Microbiology (Non-Thesis) A. Discipline Specific Requirement Biol 6484 Laboratory Techniques in AEM B. Additional Course Requirements (8 hours) Biol 6438 Biol 6458

More information

Features of Salmonella serovars among food handlers in Kyushu, Japan

Features of Salmonella serovars among food handlers in Kyushu, Japan NEW MICROBIOLOGICA, 30, 155-159, 2007 Features of Salmonella serovars among food handlers in Kyushu, Japan Koichi Murakami 1, Tatsuo Ishihara 2, Kazumi Horikawa 1, Takahiro Oda 3 1 Division of Pathology

More information

Ch 3. Bacteria and Archaea

Ch 3. Bacteria and Archaea Ch 3 Bacteria and Archaea SLOs for Culturing of Microorganisms Compare and contrast the overall cell structure of prokaryotes and eukaryotes. List structures all bacteria possess. Describe three basic

More information

Last 4 Digits of USC ID:

Last 4 Digits of USC ID: Chemistry 05 B Practice Exam Dr. Jessica Parr First Letter of last Name PLEASE PRINT YOUR NAME IN BLOCK LETTERS Name: Last 4 Digits of USC ID: Lab TA s Name: Question Points Score Grader 8 2 4 3 9 4 0

More information

Effect of Mid-Ocean Exchange of Ballast Water on Bacterial Community in Ballast Tanks

Effect of Mid-Ocean Exchange of Ballast Water on Bacterial Community in Ballast Tanks Effect of Mid-Ocean Exchange of Ballast Water on Bacterial Community in Ballast Tanks 58,098 GT Length(O.A.) 239.80m Length(PP) 230.00m Breadth 43.00m Depth 20.50m Akiko Tomaru 1, Yasuwo Fukuyo 1, Masanobu

More information

CLASS TEST GRADE 11. PHYSICAL SCIENCES: CHEMISTRY Test 4: Matter and materials 1

CLASS TEST GRADE 11. PHYSICAL SCIENCES: CHEMISTRY Test 4: Matter and materials 1 CLASS TEST GRADE PHYSICAL SCIENCES: CHEMISTRY Test 4: Matter and materials MARKS: 45 TIME: hour INSTRUCTIONS AND INFORMATION. Answer ALL the questions. 2. You may use non-programmable calculators. 3. You

More information

NSCI Basic Properties of Life and The Biochemistry of Life on Earth

NSCI Basic Properties of Life and The Biochemistry of Life on Earth NSCI 314 LIFE IN THE COSMOS 4 Basic Properties of Life and The Biochemistry of Life on Earth Dr. Karen Kolehmainen Department of Physics CSUSB http://physics.csusb.edu/~karen/ WHAT IS LIFE? HARD TO DEFINE,

More information

THE IDENTIFICATION OF TWO UNKNOWN BACTERIA AFUA WILLIAMS BIO 3302 TEST TUBE 3 PROF. N. HAQUE 5/14/18

THE IDENTIFICATION OF TWO UNKNOWN BACTERIA AFUA WILLIAMS BIO 3302 TEST TUBE 3 PROF. N. HAQUE 5/14/18 THE IDENTIFICATION OF TWO UNKNOWN BACTERIA AFUA WILLIAMS BIO 3302 TEST TUBE 3 PROF. N. HAQUE Introduction: The identification of bacteria is important in order for us to differentiate one microorganism

More information

Detection of Tobacco mosaic virus in Petunia and Tobacco By Light Microscopy Using a Simplified Inclusion Body Staining Technique

Detection of Tobacco mosaic virus in Petunia and Tobacco By Light Microscopy Using a Simplified Inclusion Body Staining Technique International Journal of Agricultural Technology 2017 Vol. 13(2): 163-168 Available online http://www.ijat-aatsea.com ISSN 2630-0192 (Online) Detection of Tobacco mosaic virus in Petunia and Tobacco By

More information

Genotypic Characterization of Salmonella enteritidis Phage Types by Plasmid Analysis, Ribotyping, and Pulsed-Field Gel Electrophoresis

Genotypic Characterization of Salmonella enteritidis Phage Types by Plasmid Analysis, Ribotyping, and Pulsed-Field Gel Electrophoresis JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 1998, p. 2314 2321 Vol. 36, No. 8 0095-1137/98/$04.00 0 Copyright 1998, American Society for Microbiology. All Rights Reserved. Genotypic Characterization of Salmonella

More information

Number-controlled spatial arrangement of gold nanoparticles with

Number-controlled spatial arrangement of gold nanoparticles with Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Number-controlled spatial arrangement of gold nanoparticles with DNA dendrimers Ping Chen,*

More information

8. Relax and do well.

8. Relax and do well. CHEM 1314.03 Exam I John I. Gelder September 25, 1997 Name TA's Name Lab Section Please sign your name below to give permission to post, by the last 4 digits of your student I.D. number, your course scores

More information