.&F &$ (Cholera).7 ( > Z > + >.- W + &$ 8,) + ] ^/
|
|
- Bertram Houston
- 5 years ago
- Views:
Transcription
1 %,*+ : '(, #$%!" 45 # hly A /! -. sed2020@yahoo.com:! -, : 7( 86, : 3-9: : ;< ' %& #$ : >'" = ;< ', % #$ ()* : 3':?6;< ) +,-.. /0. 1))*, : ;5 = ;< DE/HA/C : F;!G" DE/C/A : I ( &'!$ % &$ "#! : JK 6?.9! &$ 7 &7 8* 2!)1!$ (/0.-!)* + &,) + $?@@.! &)*$>!7 <') 9 +=/9! $2 $ 2 ; 8 / hly A 81 : < F #!$ ) 4 ) : 9 8 BC 79 /D * A 4H ;)4 </./- )> & (- +2 )$.1 $!9 8 4* 4 G$.&F>.&F> #!$ 9 + $ hly A 2 81 (PCR)!)* &'! N O) 4.) / %M NON Agglutination (NAG) %?M > L-$ + $ 4 %IJ : L! + + $ %IJ +!Q ) 8) &$,Q ($!, (,/ (4, FP$ + + $!-!- ) &U hly A 81 O) 4 + $ %?@@ (/0.) 3' ($- + %TM (, + %SJ R4, -.) 2 #F 7)* %T 8) >* 2 L- /F + $ %VT +!Q 8 / + 8 /- + ($- Y$ ( Z9 + 4!5!' N!GW - +X ( : /;M + \ 7 &=/ ! hly A 81!!$ >! [= 4 9! 7/H 8 &7!C).&F &$ hly A 81!-!)* &' : /< -M. (Cholera).7 ( > Z > + >.- W + &$ 8,) \a P$ 8!G/ 3>. 9! 4! (.&$!X# R1F. (./! 9! C I ph V &$ = : + ] ^/ 8* 4 +) > _` 8 /- + 9! +$) )=.&$ 9!$/9
2 -K 7( 86 / +F> #!$ &$ 9 R$ + 8 R s $ g F +) ) +) ).&$ R') ph = `/S!# +) PH q* ta + +WF &$ S + 8 $ ) 84 89!i 4 ^H 9 &7 TCBS!W"= ta MI ºc Robert M. and ) )> & +!$/ ^H.(Joseph M ) 4* 4 G$ MI ºc &$ w $H1 $ 8 $ R)!9 &' 4, &Q >* 2 G$!1 $!$ (/0 B (,!H + 8 $H,) - > / 3$!)* 4 &F> 3;) 35 _J 8 $/- >* j + + Bidinost C. and Saka ) 9!$/9.(H.A. 2004!)* &$,Q!$ :!-!)* &$,Q!$ o Disk diffusion )$ j 4 G$!- )$! ( + t$ - 9 +W - method 4 G$ >* 8 / ta 7 N4* Arakawa E. and ) &F> 3;) /F. Z) &Ox.,!$ (.(Murase T (C: M@ mg)/g : 9 G$!-!)* (Te :M@ mg) ($- (E :?T mg) (, R4, - (OXY :M@ mg) ($-!, 7-!)* BBL )4$ &9 4 (SXT:_T mg) :?Tmg) (4, FP$ (GM :?@ mg) (,/ &9 4 (Dox :M@ mg) ($!, (Cip./9! Difco )4$ : 3 )1 [C$ ( B : hly A 81!!$ o 8)9 j t$ -!4 DNA [C$ 4 4! - H ( q.&f> W (Boiling) 9 Z,'-.$ L- + Z,)> > L-$ M + 2)!)1!)* 8=$ O) 4.&$ > %N) / I 8 /- &$ 8,) bc d- c 82 8* +;) + 9!)H Ansaruzzaman ) &$ "#! c2 g9.(m. and Bhuiyan NA. 2004!Q > + &$ 9 hg$ R7$!)7>). 9! c &$ J - M 84!i /)!$* 8 8 ; & + &$.)* ;)* + 8,)dF 8,H j2> ( 4 2) Pourshafie M.R. and Grimont F. ) >!.$ L- hly A 81.(2002!>F?.$ g ) + G- ( k ( + 9! hly A!)1 8=$ llbp 2 ;)!P- /F O) 4 L- ( lf m Murray ) 9! (/G$ > 8 = %T >*.( P.R W "=!$ ]'a- (!-!)* &'!1 $!nnnn9 2 (, - 81 O) $./F> # +X PCRj + hly A : < F?@@ +X : p/p-$ 4$ o 79 7D &97 2 4!$ + +) ) W (4 89 ) 87-) 8 BC +) ) R$ Y$ +) ) qc)!n) ND.&F>!C) &$ 9 r 8$79 4 +X 84 ]i/ 3-8 D ) +X 84 AX' +9) g 9 8, X
3 / hlya N! -. N$ 4 G$ nnnn nnnn,?@ <g/ml (C- &7 > 3;) Gel Duccumentation F DNA X# 4) 9 G$ (Gene Ruler Plus)?@@ bp!!p- /F 4* Q!nnn- (nnnn/0 (&nnnu nnnn9) &U Rnnnn/. 4 PCR G$ V.cholerae O 1 ElTOR ATCC (? 9) > : L! BC 79 7D 4 9 * A + $?@@ 4 + $ M@ $ M_ : 9 m ) ) 4 + $?_ $ _S 4 O) 4 + $ %?@@.1!$ O) 8) &U </ 4, $ R) &Q m-- + w $H1 7) 4* O) 4 ) 2) + $ %?@@ (/0 /9 &U ) %TJ %M!G/ 4* Z2)* B (,!H + &' O) 4 2 L- /F ; O) 4.)> j2> + $ 4 %T 7/- &U L- /F %VT 2) >* %IJ 2) p/p-$ O) 4.) 8)!G/ 2.) NAG %_M / %M > L-$ + $ M@ 4 2) 4 > + $ %?@@ ) 87-? } )) ) / %?@ > %V@!$ + $.(_ 89!$ + $ _S 4 (/0 ( 4.) > L-$ %_T NAG + $ %`T J >*!G/ 2 + $ 4 %T.)> j2> NAG + $? > + $ : m-- +!-!)* &'!$ O)4 + + $ 4 %_I %TM %S_ %SM %IJ ($-!, (, R4, - Tib Molbiol Synthesyntheselabor &9 jg$ (Singh D.V. and Matte G.R. 2001) : > GAG CCG GCA TTC ATC ATC TGA AT 5 - CTC AGC GGG CTA ATA CGG TTT A (PCR) 4H ;)4 </ t9 : PCR : > 3;) 4 Q Z;Q </ y C PCR </ 3;) &7 ml z/h + 8 T@!7).9 +C r ' : </ 3;) &7 PCR {2 4 4) Z;Q!- {2 </ F?@ dntp y C Taq Polymerase IH II H MgC12 D.D.W N DNA Z;Q () MV/_?!7) &Ox? mm each?/_t U/50 <l T@ pm T@ pm?/t pm o o PCR </ 3;) &7 8 y C 4 ^H bc 2 +) $ - = + $ + 4).9 # $ _T &7 &$ > r +.9! J`@ bp PCR R "a +'# _ VJ ºc Initial Denaturation +'#? VJ ºc Denaturation +'#? S@ ºc Annealing +'#? I_ ºc Extention ($ _T)+'#?@ I_ ºc Final Extention G$ 5 "a!$ : PCR R "a!$/9 o %?/T (Gibco) 4>* R1 4 Fnnnn R nnnn* p).&f> 3;)
4 -K 7( 86 / N!-G- BC 7)$79 (/0 A + 8/0 8 / + hly A.) hly A 81!1 $ &$ > r 2) BC! &)*$> ;! $ 2 $ !# &= ;!W ) -! (, - ( 9) (, - Nagamune K. and Yamamoto ) 9! R7$!$ t$ - 8* A$ bc- % (K !$ (!H + 8 -!! N!)1 ''a-.1 H ''a- &7.9! j4 ( t- * &$ +) )!$?VVV R$ -?VV? 7$ ( + (-5 *!H 4 +' 4 ~ > bc?vvm ! (.$)!# 7 >4 tdh tcp CT 9 +=/9 ^)5 F 4 (2 81 +!Q k /!) ƒ9- zot ƒ9-9!! $ 89 +w +!/2 $ Colombo M. and Mastrandrea S. )?VVV R$ +!''a- (/0 + + *!),)!Xa +) )!.(1997?@@ )) 4! $ 2 $ 8*?S 9 3;) / 8) hly A 81 7)*!N +!- W.(John Albert M. and Nurul A. 1997) ) &$ r #!1 $!$ +X %_M > + $ 4 %IJ!$ + $?@@ 4 +!$.) / L-$ + $ 4 %M NAG _S 4 * /-?VVM R$ +!1 $ R$.&$ > 8* + $ _J * &$ + $ T@ 4 * /- + N!$ 2)?VVJ 2) 89.) 8) &' /G ($- + +!Q ) 3' (, + + $ %`J 4 (/0./9 &$,Q ~ N.-!)* J ) 8) >* T!, R4, - + +)>/D &' +2. /9 (, ($- ($- +) ) N /) x 9 G$.-!)*!- + ~ 89.(M ) ) Y,Q (,! j hly A 81!!$,) 8) hly A 2 81!N PCR (2 L- /F + $ %VT +!Q /9!G/ L- /F 7)* %T ) 8) >* ta.(? 9) : P 3;) 8 ( + +X (?@@!1 H!$ 9 4 ) : BC $ &'!1 $!$ + &F> 3;) (.9 3;) 2) 7)*!)1 +X!-!)* 2 L- /F ( bc +X + $ %?@@ >* ta + $ %VT R7$ ; O) 4 2)!N /, hly A 81 y- N) ) -! +, ( /9! &U! Robert M. ) 9 81 ( &)*$> ;?VV` R$ +!''a-.(and Joseph M _S &F> 3;) +) ) _S 9 j2> &U hly A 81!$ +) ) 2 L- /F 8* +) ) J +!Q Singh D.V. and Matte G.R. ) )) 8) >*.(2001
5 / hlya N! -. (.&$ H!)7 j,> ( + &' + +)>/D &'.&$ %H 8$ ) ~ &' ($- ($-!, R4, - ) /G (,!N 89 +!Q k 9! 4!)* +' + (, 2;!$ +) ).) Y,Q ~ 7- : N;M A/ 9 ]'a- ( + X) hly A!)1! -.&$ > 8 2) BC.. x. + $. x. + $ hly A A;- R7$ ; O 1 bc- ) -! 8* A$!$/9. 9! (, !)4 "C Kurazono H. and ) ) )!$ + $ hly A 81.(Pal A ) +! R7$ +!) + y q,a q +,)1 -H 4! 9. 9! L-$ O) 4 mx + $ 9 3;) ]'a- U +)/0 &$ 9 bc > > j2> > 8 /- mx L-$ 2)!$* a # &' N 4 G-.&$.&$!4 > j2> > 7)*!- + $.(Dalasgarad A. and Forslund A. 1999) (H1?VVV R$ +!$ (/0 SS SI 4 &F> W &$ > j2> /. 7/- > L-$.(Mitra R. and Figuerua P. 2000)!)* + +)>/D &' +X ( ($-!, ($- /G 7- # + 9! (, R4, -!-92> 2) BC ''a-.&$!4 a +!-!)* +)>/D &' ;!/ ($- (,) (, /G Nagamune K. and ) &$ 9 +w R4, -.(Yamamoto K. 1997?VVJ -?VV? 7$ ( + +X +)>/D!-!)* &' 9 3;) 5 N)* R4, - ($- /G + Z7 4!, +D + 9 (, ( R$ J!i!H 6 H Alm R. and )9!-!)* +)>/D &'.(Manning P !''a- 2)?VVJ R$ ($- + 7)*!N &F> 3;)!?_ (4, FP$ + +!Q 3' R4, - O) 4.(Irma N. and Chung J.1988) ) Y,Q &7!C) 9 3;)!$ &' N 8* 4 ^H (4, FP$ R +Q 8 + &$!Q (.9! ($!, (,/!C) 8 / + ($- +9%> R$ M@!i 84 + &$ +F! 8 &7
6 -K 7( 86 /
7 / hlya N! -. '(' " # $ %&! 1 <2 1 hly A.8 #9: '0( / &*+,'-( #.( ) EH'C%' F G" '- E FG D'C A 8 B =9 8'/ ='>8?@ 1' M'(( 1. (V. cholerae O1 ElTor, ATCC: 14033) #0 I@ (K DNA %4C) 9@ I@ A 1 P R EFG D'C A 1 P Q E A 1 P 5E!EE7ENEOE5E!EE ES9@ I@ 1 P O E#0 I@ A 1 P Q EH'C%' F G" A 1 P ES ' bpS 6
8 -K 7( 86 / References: Alm R. and Manning P. (1988) Extracellular protein of V.cholerae, Mol. Microbiol. 2(4): Ansaruzzaman M. and Bhuiyan N.A. (2004) Cholera in Mozambique, Variant of Vibrio cholerae, Emerging Infectious Diseases. 10(11). Arakawa E. and Murase T. (2000) Pulsed Field Gel Electrophoresis Based Molecular Comparison of V.cholerae O1 Isolated from Domestic and Imported Cases of Cholera in Japan, Journal of Clinical Microbiology. 38(1): Bidinost C. and Saka H.A. (2004) Virulence factors of non-o1 non-o139 V.Cholerae isolated in Cordoba, Argentina, Revista Argentina de Microbiologia. 36: Colombo M. and Mastrandrea S. (1997) Tracking of clinical and environmental V.cholerae O1 strains by combined analysis and ERIC PCR.FEMS., Immunology and Medical Microbiology. 19: Dalasgaard A. and Forslund A. (1999) A high proportion of V.cholerae strains isolated from children with diarrhea in Bangkok, Thailand are multiple antibiotic resistant and belong to heterogenous non- O1, non-o139, O-Serotypes, Epidemiol. Infec. 122: Irma N. and Chung J. (1988) Genotypes associated with virulence inenvironmental Isolates of Vibrio cholerae, Applex and Environ Microbiology. 67(6): John Albert M. and Nurul A. (1997) Phenotypic and Genotypic changes in Vibrio cholerae O139 Bengal, Journal of Clinical Microbiology. 35(10): Kurazono H. and Pal A. (1995) Distribution of genes encoding cholera toxin, zonula occuldens toxin accessory cholera toxin, and El Tor hemolysin in Vibrio cholerae of diverse origins, Microbial pathogenesis. 18: Mitra R. and Figuerua P. (2000) Cell Vacuolation a Mainfestation of the El Tor hemolysin of Vibrio cholerae, Infect and Immune. 68(4): Murray P.R. (2003) Medical Microbiology Bacteriology Vol. 1, 8 th Edition ASM Press, Washington DC. Nagamune K. and Yamamoto K. (1995) Cloning and Sequencing of a novel hemolysin gene of Vibrio cholerae, FEMS Microbiology Letters. 128: Nagamune K. and Yamamoto K. (1997) Intramolecular chaperone activity of the pro-region of Vibrio cholerae El Tor cytolysin, JBC. 272(2): Pourshafie MR. and Grimoont F. (2002) A molecular and phenotypic study of Vibrio cholerae in Iran, Med. Microbiol. 51: Robert M. and Joseph M. (2004) Vibrio. Bacteriological Analytical Manual Online. Chapter9. Singh DV. And Matte GR. (2001) Molecular Analysis of Vibrio cholerae O1, O139, non-o1 and non-o139 strains, AEM. 67(2):
SSR ( ) Vol. 48 No ( Microsatellite marker) ( Simple sequence repeat,ssr),
48 3 () Vol. 48 No. 3 2009 5 Journal of Xiamen University (Nat ural Science) May 2009 SSR,,,, 3 (, 361005) : SSR. 21 516,410. 60 %96. 7 %. (),(Between2groups linkage method),.,, 11 (),. 12,. (, ), : 0.
More informationSUPPORTING INFORMATION FOR. SEquence-Enabled Reassembly of β-lactamase (SEER-LAC): a Sensitive Method for the Detection of Double-Stranded DNA
SUPPORTING INFORMATION FOR SEquence-Enabled Reassembly of β-lactamase (SEER-LAC): a Sensitive Method for the Detection of Double-Stranded DNA Aik T. Ooi, Cliff I. Stains, Indraneel Ghosh *, David J. Segal
More informationCRISPR-SeroSeq: A Developing Technique for Salmonella Subtyping
Department of Biological Sciences Seminar Blog Seminar Date: 3/23/18 Speaker: Dr. Nikki Shariat, Gettysburg College Title: Probing Salmonella population diversity using CRISPRs CRISPR-SeroSeq: A Developing
More informationDistribution of virulence genes in Salmonella serovars isolated from man & animals
Indian J Med Res 117, February 2003, pp 66-70 Distribution of virulence genes in Salmonella serovars isolated from man & animals H.V. Murugkar*, H. Rahman* & P.K. Dutta Department of Microbiology, College
More informationPractical Bioinformatics
5/2/2017 Dictionaries d i c t i o n a r y = { A : T, T : A, G : C, C : G } d i c t i o n a r y [ G ] d i c t i o n a r y [ N ] = N d i c t i o n a r y. h a s k e y ( C ) Dictionaries g e n e t i c C o
More informationWorld Journal of Pharmaceutical Research SJIF Impact Factor 8.074
SJIF Impact Factor 8.074 Volume 7, Issue 5, 966-973. Research Article ISSN 2277 7105 MOLECULAR DETECTION OF ENTEROTOXIGENIC ISOLATES OF SALMONELLA TYPHIMURIUM, SHIGELLA FLEXNERI AND STAPHYLOCOCCUS AUREUS
More informationSUPPLEMENTARY DATA - 1 -
- 1 - SUPPLEMENTARY DATA Construction of B. subtilis rnpb complementation plasmids For complementation, the B. subtilis rnpb wild-type gene (rnpbwt) under control of its native rnpb promoter and terminator
More informationSupplemental data. Pommerrenig et al. (2011). Plant Cell /tpc
Supplemental Figure 1. Prediction of phloem-specific MTK1 expression in Arabidopsis shoots and roots. The images and the corresponding numbers showing absolute (A) or relative expression levels (B) of
More informationCharacterization of Pathogenic Genes through Condensed Matrix Method, Case Study through Bacterial Zeta Toxin
International Journal of Genetic Engineering and Biotechnology. ISSN 0974-3073 Volume 2, Number 1 (2011), pp. 109-114 International Research Publication House http://www.irphouse.com Characterization of
More informationClay Carter. Department of Biology. QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture.
QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture. Clay Carter Department of Biology QuickTime and a TIFF (LZW) decompressor are needed to see this picture. Ornamental tobacco
More informationRole as adhesin of muramidase released protein of Streptococcus s uis type 2
2002, 25 (4) : 6771 Journal of Nanjing Agricultural University 2 1,2 1 3, (11, 210095 ; 21, 730070) : 2 (SS2) (MRP) : 11 HA9801 (MRP + ) SH006444 (MRP - ) HEp 2, MRP + MRP + ( P < 0105) 21 56 1 h ; DNase
More informationSupporting Information
Supporting Information T. Pellegrino 1,2,3,#, R. A. Sperling 1,#, A. P. Alivisatos 2, W. J. Parak 1,2,* 1 Center for Nanoscience, Ludwig Maximilians Universität München, München, Germany 2 Department of
More informationTable S1. Primers and PCR conditions used in this paper Primers Sequence (5 3 ) Thermal conditions Reference Rhizobacteria 27F 1492R
Table S1. Primers and PCR conditions used in this paper Primers Sequence (5 3 ) Thermal conditions Reference Rhizobacteria 27F 1492R AAC MGG ATT AGA TAC CCK G GGY TAC CTT GTT ACG ACT T Detection of Candidatus
More informationCurriculum Vitae. Farzaneh Firoozeh Assistant Professor of Microbiology
Curriculum Vitae Farzaneh Firoozeh Assistant Professor of Microbiology PERSONAL First name: Farzaneh Family name: Firoozeh Nationality: Iranian Marital status: Married OFFICE ADDRESS Department of Microbiology
More informationSupporting Information for. Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)-
Supporting Information for Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)- Dependence and Its Ability to Chelate Multiple Nutrient Transition Metal Ions Rose C. Hadley,
More informationCurriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
More informationBuilding a Multifunctional Aptamer-Based DNA Nanoassembly for Targeted Cancer Therapy
Supporting Information Building a Multifunctional Aptamer-Based DNA Nanoassembly for Targeted Cancer Therapy Cuichen Wu,, Da Han,, Tao Chen,, Lu Peng, Guizhi Zhu,, Mingxu You,, Liping Qiu,, Kwame Sefah,
More informationA genomic insight into evolution and virulence of Corynebacterium diphtheriae
A genomic insight into evolution and virulence of Corynebacterium diphtheriae Vartul Sangal, Ph.D. Northumbria University, Newcastle vartul.sangal@northumbria.ac.uk @VartulSangal Newcastle University 8
More informationPCR-based Restriction Fragment Length Polymorphism for Subtyping of Salmonella from Chicken Isolates
Kasetsart J. (Nat. Sci.) 44 : 79-83 (2010) PCR-based Restriction Fragment Length Polymorphism for Subtyping of Salmonella from Chicken Isolates Han Yu Jong 1, Pak Thae Su 1, Pannatee Sanpong 2, Worawidh
More informationMicrobial DNA qpcr Multi-Assay Kit Clostridium perfringens Pathogenicity
Microbial DNA qpcr Multi-Assay Kit Clostridium perfringens Pathogenicity Cat. no. 330043 BBID-1507ZR-3 For real-time PCR-based, application-specific microbial identification or profiling The Clostridium
More informationNumber of strains/strain Accession Serogroup Country/Province(s)(n) Source ctxb*
Table S1. Strains used in this study Year of isolation Number of strains/strain Accession Serogroup Country/Province(s)(n) Source ctxb* This study 2001 1 - Non-O1/O139 Guangdong(1) Water - 2002 1 - Non-O1/O139
More information2# / "-: ;<( 1= +
(1) 8 1385 23-16 : 1('( )* +,-&.,/0 1(!"#$ %# & '& 2#3-4-5 6/ 780 9-5"-: ;, H/I M#? 85/4/13:E
More informationIntroduction to microbiology
Sulaimani University College of Pharmacy Microbiology Introduction to microbiology Dr. Abdullah Ahmed Hama PhD. Molecular Medical Parasitology abdullah.hama@spu.edu.iq 1 Definition Microbiology: is the
More informationevoglow - express N kit distributed by Cat.#: FP product information broad host range vectors - gram negative bacteria
evoglow - express N kit broad host range vectors - gram negative bacteria product information distributed by Cat.#: FP-21020 Content: Product Overview... 3 evoglow express N -kit... 3 The evoglow -Fluorescent
More informationGeothermal locations at the Icelandic coast as a habitat for Vibrio cholerae. Eva Benediktsdóttir and Herdís E. Hermundardóttir
Geothermal locations at the Icelandic coast as a habitat for Vibrio cholerae Eva Benediktsdóttir and Herdís E. Hermundardóttir 1 Overview V. cholerae strains in Iceland diversity and virulence factors
More informationSEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS. Prokaryotes and Eukaryotes. DNA and RNA
SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS 1 Prokaryotes and Eukaryotes 2 DNA and RNA 3 4 Double helix structure Codons Codons are triplets of bases from the RNA sequence. Each triplet defines an amino-acid.
More information3 S. Heidelberg ESBL Extended spectrum lactamase
Vol. 25 No. 123 almonella Heidelberg 1 almonella enterica serovar Heidelberg 1 3. Heidelberg EBL Extended spectrum lactamase CTX M 2 EBL. Heidelberg almonella enterica serovar Heidelberg 1 3. Heidelberg
More informatione-publication (Yes/No) Molecular Microbiology Wiley, United States of America
FORMAT FOR SUBJECTWISE IDENTIFYING JOURNALS BY THE UNIVERSITIES AND APPROVAL OF THE UGC {Under Clause 6.05 (1) of the University Grants Commission (Minimum Qualifications for appointment of Teacher and
More information6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008
MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationRegulatory Sequence Analysis. Sequence models (Bernoulli and Markov models)
Regulatory Sequence Analysis Sequence models (Bernoulli and Markov models) 1 Why do we need random models? Any pattern discovery relies on an underlying model to estimate the random expectation. This model
More informationHigh throughput near infrared screening discovers DNA-templated silver clusters with peak fluorescence beyond 950 nm
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2018 High throughput near infrared screening discovers DNA-templated silver clusters with peak fluorescence
More informationAnnouncements. It is critical that you are keeping up. Ask or see me if you need help. Lecture slides updated and homework solutions posted.
Announcements Dec. 18 Hour Exam 1 C-109 Start time 6PM Coverage is Chapter 12 and 13. 10-multiple choice 3-fairly short problems 3-longer problem solving 100 point Exam Lecture slides updated and homework
More informationAND BRUCE A. MCCLANE 1 *
JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 2001, p. 883 888 Vol. 39, No. 3 0095-1137/01/$04.00 0 DOI: 10.1128/JCM.39.3.883 888.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Genotyping
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Zn 2+ -binding sites in USP18. (a) The two molecules of USP18 present in the asymmetric unit are shown. Chain A is shown in blue, chain B in green. Bound Zn 2+ ions are shown as
More informationCharacterization of Clostridium perfringens isolated from mammals and birds from Guwahati city, India
The Journal of Venomous Animals and Toxins including Tropical Diseases ISSN 1678-9199 2012 volume 18 issue 1 pages 83-87 Original Paper Characterization of Clostridium perfringens isolated from mammals
More informationElement Cube Project (x2)
Element Cube Project (x2) Background: As a class, we will construct a three dimensional periodic table by each student selecting two elements in which you will need to create an element cube. Helpful Links
More information2 Salmonella Typhimurium
96 2006 Salmonella Typhimurium 2 1) 1) 2) 1) 2) 18 1 10 18 4 27 2 Salmonella Typhimurium 1 7 2 7 (ciprofloxacin (CPFX) MIC 16 mg/ml) S. Typhimurium 2 fosfomycin (FOM) 1 PCR gyra parc RAPD-PCR DNA S. Typhimurium
More informationIntroduction to Microbiology. CLS 212: Medical Microbiology Miss Zeina Alkudmani
Introduction to Microbiology CLS 212: Medical Microbiology Miss Zeina Alkudmani Microbiology Micro- means very small (that needs a microscope to see). Microbiology is the study of very small living organisms.
More informationAdvanced topics in bioinformatics
Feinberg Graduate School of the Weizmann Institute of Science Advanced topics in bioinformatics Shmuel Pietrokovski & Eitan Rubin Spring 2003 Course WWW site: http://bioinformatics.weizmann.ac.il/courses/atib
More informationevoglow - express N kit Cat. No.: product information broad host range vectors - gram negative bacteria
evoglow - express N kit broad host range vectors - gram negative bacteria product information Cat. No.: 2.1.020 evocatal GmbH 2 Content: Product Overview... 4 evoglow express N kit... 4 The evoglow Fluorescent
More informationComparative Genomics Final Results
Comparative Genomics Final Results April 20, 2016 Juan Castro, Aroon Chande, Cheng Chen, Evan Clayton, Hector Espitia, Alli Gombolay, Walker Gussler, Ken Lee, Tyrone Lee, Hari Prasanna, Carlos Ruiz, Niveda
More informationAdvanced Placement. Chemistry. Integrated Rates
Advanced Placement Chemistry Integrated Rates 204 47.90 9.22 78.49 (26) 50.94 92.9 80.95 (262) 52.00 93.94 83.85 (263) 54.938 (98) 86.2 (262) 55.85 0. 90.2 (265) 58.93 02.9 92.2 (266) H Li Na K Rb Cs Fr
More informationSample Problem. (b) Mass % H 2 SO 4 = kg H 2 SO 4 /1.046 kg total = 7.04%
A Sample 0.750 M solution Problem of H 2 SO 4 in water has a density of 1.046 g/ml at 20ºC. What is the concentration in (a) mole fraction, (b) mass percent, (c) molality (MM = 98.086 g/mol)? (a) Since
More informationRapid Determination of Lymphogranuloma Venereum Serovars of Chlamydia. trachomatis by quantitative High-Resolution Melt Analysis (HRMA)
JCM Accepts, published online ahead of print on 29 August 2012 J. Clin. Microbiol. doi:10.1128/jcm.01670-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Rapid Determination
More informationSurvey of plasmid profiles of Shigella species isolated in Malaysia during
World Journal of Microbiology & Biotechnology (2005) 21: 271 278 Ó Springer 2005 DOI 10.1007/s11274-004-3631-0 Survey of plasmid profiles of Shigella species isolated in Malaysia during 1994 2000 C.H.
More informationCircle the letters only. NO ANSWERS in the Columns!
Chemistry 1304.001 Name (please print) Exam 5 (100 points) April 18, 2018 On my honor, I have neither given nor received unauthorized aid on this exam. Signed Date Circle the letters only. NO ANSWERS in
More informationThe Bacterial Causes of Camel-calf (Camelus dromedarius) Diarrhea in Eastern Sudan.
Proceedings of the Third Annual Meeting for Animal Production Under Arid Conditions, Vol. 2: 132-137 1998United Arab Emirates University. The Bacterial Causes of Camel-calf (Camelus dromedarius) Diarrhea
More information35H MPa Hydraulic Cylinder 3.5 MPa Hydraulic Cylinder 35H-3
- - - - ff ff - - - - - - B B BB f f f f f f f 6 96 f f f f f f f 6 f LF LZ f 6 MM f 9 P D RR DD M6 M6 M6 M. M. M. M. M. SL. E 6 6 9 ZB Z EE RC/ RC/ RC/ RC/ RC/ ZM 6 F FP 6 K KK M. M. M. M. M M M M f f
More informationSupplementary Information
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Directed self-assembly of genomic sequences into monomeric and polymeric branched DNA structures
More informationMolecular epidemiology of HBV in The Netherlands Hein J. Boot
Hein J. Boot 1 Why is HBV molecular typing important? Effectiveness of targeted vaccination programs Identification of new transmission routes Fast detection of central (medical) infection source Spread
More informationMeasuring the size and shape of macromolecules. Hydrodynamics: study of the objects in water How do the move? Translation Rotation
Measuring the size and shape of macromolecules Hydrodynamics: study of the objects in water How do the move? Translation Rotation 1) Movement with no external forcefree diffusion 2) Movement under the
More informationEmpowers Families Unites Communities Builds Capacity. An In. Read and Rise. Cultivates Literacy
8 Emw Fm U Cmm B Cc g A I Y h P R c L DY : U T S E CAS g L b U N ff H I h H c D Sch R R Cv Lc CASE STUDY A Ig P h Y Lc R Th N Ub Lg H ff wh H I Sch Dc (HISD) c Schc R R, fcg cfc hw gg mw fm f h ch c h
More informationM $ 4 65\ K;$ 5, 65\ M $ C! 4 /2 K;$ M $ /+5\ 8$ A5 =+0,7 ;* C! 4.4/ =! K;$,7 $,+7; ;J zy U;K z< mj ]!.,,+7;
V 3U. T, SK I 1393/08/21 :,F! 1393/10/29 ::!n> 2 1 /M + - /E+4q; Z R :'!3Qi M $,7 8$ 4,!AK 4 4/ * /;K "FA ƒf\,7 /;G2 @;J\ M $ 4 65\ K;$ 5, 65\ M $ C! 4 /2 K;$ M $ /+5\ 8$ A5 =+0,7 ;* C! 4.4/ =! K;$,7 $,+7;
More informationAPPENDIX IV Data Tables
APPENDIX IV Data Tables Table A1 National institutions supplying data 57 Table A2 Total population data, by country, 1999-2004 58 Table A3 Percentage age distribution of population, by country, 1999 2004
More informationSubtype distribution of Haemophilus influenzae isolates from North India
J. Med. Microbiol. Vol. 51 (2002), 399 404 # 2002 Society for General Microbiology ISSN 0022-2615 MOLECULAR EPIDEMIOLOGY Subtype distribution of Haemophilus influenzae isolates from North India A. SHARMA,
More informationThe Fimbria Gene Cluster of Nonencapsulated Haemophilus influenzae
INFECTION AND IMMUNITY, Feb. 1998, p. 406 417 Vol. 66, No. 2 0019-9567/98/$04.00 0 Copyright 1998, American Society for Microbiology The Fimbria Gene Cluster of Nonencapsulated Haemophilus influenzae FORIEN
More informationKharkov National Medical University. Head of Microbiology, Virology and Immunology Department Minukhin Valeriy Vladimirivich
Kharkov National Medical University Head of Microbiology, Virology and Immunology Department Minukhin Valeriy Vladimirivich Tkachenko Victoria 1, 5, 11, 14, 19, 21, 30 Kovalenko Natalia 2, 12, 25, 29 Siritsa
More informationMEDLINE Clinical Laboratory Sciences Journals
Source Type Publication Name ISSN Peer-Reviewed Academic Journal Acta Biochimica et Biophysica Sinica 1672-9145 Y Academic Journal Acta Physiologica 1748-1708 Y Academic Journal Aging Cell 1474-9718 Y
More informationCircle the letters only. NO ANSWERS in the Columns! (3 points each)
Chemistry 1304.001 Name (please print) Exam 4 (100 points) April 12, 2017 On my honor, I have neither given nor received unauthorized aid on this exam. Signed Date Circle the letters only. NO ANSWERS in
More informationCHEM 107 (Spring-2005) Exam 3 (100 pts)
CHEM 107 (Spring-2005) Exam 3 (100 pts) Name: ------------------------------------------------------------------------, Clid # ------------------------------ LAST NAME, First (Circle the alphabet segment
More informationFOR RUMINANTS. kemin.com/guthealth
FOR RUMINANTS kemin.com/guthealth What is CLOSTAT? CLOSTAT contains a proprietary, patented strain of Bacillus subtilis PB6. PB6 is a unique, naturally occurring, spore-forming microorganism. Kemin has
More informationSalmonella enteritidis Identification and Isolation
Department of Microbiology, Qom Branch, Islamic Azad University. Qom, Iran Start Here Advisor Dr.Mohsen Zargar Consulting Advisor Dr.Taghi Salehi Zahraei Presented by Zeinab Yazdanpanah 1 Outcome Enterobacteriaceae
More informationSalmonella Serotyping
Salmonella Serotyping Patricia Fields National Salmonella Reference Lab CDC 10 th Annual PulseNet Update Meeting April 5, 2006 What is Salmonella serotyping? The first-generation subtyping method Established
More informationChain-like assembly of gold nanoparticles on artificial DNA templates via Click Chemistry
Electronic Supporting Information: Chain-like assembly of gold nanoparticles on artificial DNA templates via Click Chemistry Monika Fischler, Alla Sologubenko, Joachim Mayer, Guido Clever, Glenn Burley,
More informationLecture IV A. Shannon s theory of noisy channels and molecular codes
Lecture IV A Shannon s theory of noisy channels and molecular codes Noisy molecular codes: Rate-Distortion theory S Mapping M Channel/Code = mapping between two molecular spaces. Two functionals determine
More informationChem Exam 1. September 26, Dr. Susan E. Bates. Name 9:00 OR 10:00
Chem 1711 Exam 1 September 26, 2013 Dr. Susan E. Bates Name 9:00 OR 10:00 N A = 6.022 x 10 23 mol 1 I A II A III B IV B V B VI B VII B VIII I B II B III A IV A V A VI A VII A inert gases 1 H 1.008 3 Li
More informationTM1 TM2 TM3 TM4 TM5 TM6 TM bp
a 467 bp 1 482 2 93 3 321 4 7 281 6 21 7 66 8 176 19 12 13 212 113 16 8 b ATG TCA GGA CAT GTA ATG GAG GAA TGT GTA GTT CAC GGT ACG TTA GCG GCA GTA TTG CGT TTA ATG GGC GTA GTG M S G H V M E E C V V H G T
More informationKIR gene polymorphism study in the Uygur population in Xinjiang, China
KIR gene polymorphism study in the Uygur population in Xinjiang, China G.-Y. Lin and Y.-B. Wang No. 474 Hospital of Chinese PLA, Urumqi, China Corresponding author: G.-Y. Lin E-mail: lgy474@yeah.net Genet.
More informationStudies on virulence characters of Salmonella Typhimurium isolated from animal and human. Khalilia A. El-Taib
Studies on virulence characters of Salmonella Typhimurium isolated from animal and human. Khalilia A. El-Taib Microbiology Unit, Suez Canal university Hospitals, Egypt dr. khalilia11@yahoo.com Abstract:
More informationIntroduction to the SNP/ND concept - Phylogeny on WGS data
Introduction to the SNP/ND concept - Phylogeny on WGS data Johanne Ahrenfeldt PhD student Overview What is Phylogeny and what can it be used for Single Nucleotide Polymorphism (SNP) methods CSI Phylogeny
More informationElectronic supplementary material
Applied Microbiology and Biotechnology Electronic supplementary material A family of AA9 lytic polysaccharide monooxygenases in Aspergillus nidulans is differentially regulated by multiple substrates and
More informationWhat are viruses? Marine Viruses I & II. OCN 626 Marine Microplankton Ecology. Characteristics, Abundance, and Diversity
OCN 626 Marine Microplankton Ecology Marine Viruses I & II Characteristics, Abundance, and Diversity What Are Viruses? What are they made of? How do they replicate? Are they alive? What are viruses? Infectious
More informationDetection of Enterotoxic Bacillus cereus Producing Hemolytic and Non Hemolytic Enterotoxins by PCR Test
Polish Journal of Microbiology 2006, Vol. 55, No 2, 113 118 Detection of Enterotoxic Bacillus cereus Producing Hemolytic and Non Hemolytic Enterotoxins by PCR Test EL BIETA O TUSZAK-WALCZAK *, PIOTR WALCZAK
More informationNatural Genetic Resistance to Infection
Natural Genetic Resistance to Infection The Discovery of Natural Determinants of Susceptibility to Infection in Cattle, especially Tarentaise Steve A Carlson, DVM PhD Tim A Day, PhD PSR Genetics, LLC Scott
More informationCrick s early Hypothesis Revisited
Crick s early Hypothesis Revisited Or The Existence of a Universal Coding Frame Ryan Rossi, Jean-Louis Lassez and Axel Bernal UPenn Center for Bioinformatics BIOINFORMATICS The application of computer
More informationFlow Cytometry In Microbiology: Technology And Applications READ ONLINE
Flow Cytometry In Microbiology: Technology And Applications READ ONLINE If searching for a book Flow Cytometry in Microbiology: Technology and Applications in pdf format, in that case you come on to the
More informationPathways and Controls of N 2 O Production in Nitritation Anammox Biomass
Supporting Information for Pathways and Controls of N 2 O Production in Nitritation Anammox Biomass Chun Ma, Marlene Mark Jensen, Barth F. Smets, Bo Thamdrup, Department of Biology, University of Southern
More informationBy Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food Supervised by Henrik Hasman, PhD
By Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food elibi@food.dtu.dk Supervised by Henrik Hasman, PhD 1. Introduction to plasmid biology 2. Plasmid encoded resistance to β- lactams (basic theories)
More informationMicrobial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationThe Open Microbiology Journal
Send Orders for Reprints to reprints@benthamscience.ae The Open Microbiology Journal, 2017, 11, i-vi The Open Microbiology Journal Supplementary Material Content list available at: www.benthamopen.com/tomicroj/
More informationLedyard Public Schools Science Curriculum. Biology. Level-2. Instructional Council Approval June 1, 2005
Ledyard Public Schools Science Curriculum Biology Level-2 1422 Instructional Council Approval June 1, 2005 Suggested Time: Approximately 9 weeks Essential Question Cells & Cell Processes 1. What compounds
More informationSupplemental Table 1. Primers used for cloning and PCR amplification in this study
Supplemental Table 1. Primers used for cloning and PCR amplification in this study Target Gene Primer sequence NATA1 (At2g393) forward GGG GAC AAG TTT GTA CAA AAA AGC AGG CTT CAT GGC GCC TCC AAC CGC AGC
More informationSUPPLEMENTARY INFORMATION
DOI:.8/NCHEM. Conditionally Fluorescent Molecular Probes for Detecting Single Base Changes in Double-stranded DNA Sherry Xi Chen, David Yu Zhang, Georg Seelig. Analytic framework and probe design.. Design
More information(C) Pavel Sedach and Prep101 1
(C) Pavel Sedach and Prep101 1 (C) Pavel Sedach and Prep101 1 (C) Pavel Sedach and Prep101 2 (C) Pavel Sedach and Prep101 2 (C) Pavel Sedach and Prep101 3 (C) Pavel Sedach and Prep101 3 (C) Pavel Sedach
More information(please print) (1) (18) H IIA IIIA IVA VA VIA VIIA He (2) (13) (14) (15) (16) (17)
CHEM 10113, Quiz 3 September 28, 2011 Name (please print) All equations must be balanced and show phases for full credit. Significant figures count, show charges as appropriate, and please box your answers!
More informationFINAL EXAM April 26, 2004
CM 1045 (11:15 am Lecture) Dr. Light FINAL EXAM April 26, 2004 Name (please print) Check your recitation section: Sec. 21 5:30-6:20 pm (Popovic) Sec. 24 3:30-4:20 pm (Giunta) Sec. 22 6:30-7:20 pm (Popovic)
More informationWhitney Grummon. She kick started a fire in my soul Teaching me a tool to cleanse my mind That ll last a life time. That s how I will remember
W Gmm S kk f m T m m m T f m T I mmb N m p f p f f G L A f b k, b k v M k b p:, bb m, m f m, v. A b m, f mm mm f v b G p. S m m z pp pv pm f, k mk, f v M. I m, I m, fm k p x. S f 45 m m CMS, I p mf,. B
More informationAPPENDIX II. Laboratory Techniques in AEM. Microbial Ecology & Metabolism Principles of Toxicology. Microbial Physiology and Genetics II
APPENDIX II Applied and Environmental Microbiology (Non-Thesis) A. Discipline Specific Requirement Biol 6484 Laboratory Techniques in AEM B. Additional Course Requirements (8 hours) Biol 6438 Biol 6458
More informationFeatures of Salmonella serovars among food handlers in Kyushu, Japan
NEW MICROBIOLOGICA, 30, 155-159, 2007 Features of Salmonella serovars among food handlers in Kyushu, Japan Koichi Murakami 1, Tatsuo Ishihara 2, Kazumi Horikawa 1, Takahiro Oda 3 1 Division of Pathology
More informationCh 3. Bacteria and Archaea
Ch 3 Bacteria and Archaea SLOs for Culturing of Microorganisms Compare and contrast the overall cell structure of prokaryotes and eukaryotes. List structures all bacteria possess. Describe three basic
More informationLast 4 Digits of USC ID:
Chemistry 05 B Practice Exam Dr. Jessica Parr First Letter of last Name PLEASE PRINT YOUR NAME IN BLOCK LETTERS Name: Last 4 Digits of USC ID: Lab TA s Name: Question Points Score Grader 8 2 4 3 9 4 0
More informationEffect of Mid-Ocean Exchange of Ballast Water on Bacterial Community in Ballast Tanks
Effect of Mid-Ocean Exchange of Ballast Water on Bacterial Community in Ballast Tanks 58,098 GT Length(O.A.) 239.80m Length(PP) 230.00m Breadth 43.00m Depth 20.50m Akiko Tomaru 1, Yasuwo Fukuyo 1, Masanobu
More informationCLASS TEST GRADE 11. PHYSICAL SCIENCES: CHEMISTRY Test 4: Matter and materials 1
CLASS TEST GRADE PHYSICAL SCIENCES: CHEMISTRY Test 4: Matter and materials MARKS: 45 TIME: hour INSTRUCTIONS AND INFORMATION. Answer ALL the questions. 2. You may use non-programmable calculators. 3. You
More informationNSCI Basic Properties of Life and The Biochemistry of Life on Earth
NSCI 314 LIFE IN THE COSMOS 4 Basic Properties of Life and The Biochemistry of Life on Earth Dr. Karen Kolehmainen Department of Physics CSUSB http://physics.csusb.edu/~karen/ WHAT IS LIFE? HARD TO DEFINE,
More informationTHE IDENTIFICATION OF TWO UNKNOWN BACTERIA AFUA WILLIAMS BIO 3302 TEST TUBE 3 PROF. N. HAQUE 5/14/18
THE IDENTIFICATION OF TWO UNKNOWN BACTERIA AFUA WILLIAMS BIO 3302 TEST TUBE 3 PROF. N. HAQUE Introduction: The identification of bacteria is important in order for us to differentiate one microorganism
More informationDetection of Tobacco mosaic virus in Petunia and Tobacco By Light Microscopy Using a Simplified Inclusion Body Staining Technique
International Journal of Agricultural Technology 2017 Vol. 13(2): 163-168 Available online http://www.ijat-aatsea.com ISSN 2630-0192 (Online) Detection of Tobacco mosaic virus in Petunia and Tobacco By
More informationGenotypic Characterization of Salmonella enteritidis Phage Types by Plasmid Analysis, Ribotyping, and Pulsed-Field Gel Electrophoresis
JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 1998, p. 2314 2321 Vol. 36, No. 8 0095-1137/98/$04.00 0 Copyright 1998, American Society for Microbiology. All Rights Reserved. Genotypic Characterization of Salmonella
More informationNumber-controlled spatial arrangement of gold nanoparticles with
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Number-controlled spatial arrangement of gold nanoparticles with DNA dendrimers Ping Chen,*
More information8. Relax and do well.
CHEM 1314.03 Exam I John I. Gelder September 25, 1997 Name TA's Name Lab Section Please sign your name below to give permission to post, by the last 4 digits of your student I.D. number, your course scores
More information