Pathways and Controls of N 2 O Production in Nitritation Anammox Biomass

Size: px
Start display at page:

Download "Pathways and Controls of N 2 O Production in Nitritation Anammox Biomass"

Transcription

1 Supporting Information for Pathways and Controls of N 2 O Production in Nitritation Anammox Biomass Chun Ma, Marlene Mark Jensen, Barth F. Smets, Bo Thamdrup, Department of Biology, University of Southern Denmark, 5230 Odense M, Denmark Department of Environmental Engineering, Technical University of Denmark, 2800 Kongens Lyngby, Denmark Corresponding author. bot@biology.sdu.dk; Tel: ; Fax: Number of pages: 9 2 Figures and 4 Tables Table of contents Figure S1. Examples of incubations with 15 NH NO 2 - at 0.2 mg O 2 L -1 (black) and 1.0 mg O 2 L -1 (red) from Experiment 1. (A) Changes in concentrations of 15 N labeled N 2, N 2 O, NH 4 + and NO 2 -, and in the 15 N labeling of the NH 4 + and NO 2 - pools (F A and F N ) over time; (B). Calculated net cumulative N 2 O production by the hydroxylamine oxidation pathway (HA oxid.) and denitrification pathways (Nit. den. and Het. den.) during the first 2 hours. Lines represent linear regression. Figure S2. Net N 2 O production rates by the denitrification pathways (Nit. den. and Het. den.) as a function of nitrite concentration (average ± SD). Data from Experiment 1 to 4; all experiments at around 0.2 mg O 2 L -1. Each data point represents individual time intervals during the incubations. Error bars on rates represent standard errors from linear regressions of concentration versus time from each single treatment. Table S1. Summary of 15 N incubation experiments. Table S2. Primers and conditions used for the quantification of gene copy numbers of and functional genes by qpcr. Table S3. Abundance of nitrogen transforming microbes, as gene copy numbers, and functional genes based on biomass used for Experiment 1 and 4 (Table 1). Standard deviations in parentheses. Table S4. Rates ± SE of net N 2 O production, N 2 production, and aerobic ammonium oxidation in combination with bulk NO 2 - concentrations (average ± SD) and N 2 O yields at varying imposed concentrations of oxygen, NO 2 -, and 15 NH 4 +. S1

2 Figure S1. Examples of incubations with 15 NH NO 2 - at 0.2 mg O 2 L -1 (black) and 1.0 mg O 2 L -1 (red) from Experiment 1. (A) Changes in concentrations of 15 N labeled N 2, N 2 O, NH 4 + and NO 2 -, and in the 15 N labeling of the NH 4 + and NO 2 - pools (F A and F N ) over time; (B). Calculated net cumulative N 2 O production by the hydroxylamine oxidation pathway (HA oxid.) and denitrification pathways (Nit. den and Het. den.) during the first 2 hours. Lines represent linear regression. S2

3 Net N 2 O production by Nit. den. (µmoln gvss -1 h -1 ) NO 2 - (µm) Figure S2. Net N 2 O production rates by the denitrification pathways (Nit. den. and Het. den.) as a function of nitrite concentration (average ± SD). Data from Experiment 1 to 4; all experiments at around 0.2 mg O 2 L -1. Each data point represents individual time intervals during the incubations. Error bars on rates represent standard errors from linear regressions of concentration versus time from each single treatment. S3

4 Table S1 Summary of 15 N incubation experiments. Experiment Sludge sampling /experiment date 1 June 30 - July May May October O 2 (mg O 2 L -1 ) ± ± ± ± ± ± ± ± 0.08 Same treatment as listed for the one above. Substrate composition (mm added) 15 NH + 4 (1) + 14 NO - 2 (0.075) 15 NO - 2 (1.0) + 14 NH + 4 (1.0) 15 - NO 3 (1.0) + 14 NH + 4 (1.0) 15 NH + 4 (1.0) 15 NO - 2 (1.0) 15 NO - 3 (1.0) 15 NH + 4 (1.0) 15 NH + 4 (1.0) + 14 NO - 2 (0.2) 15 NH + 4 (1.0) + 14 NO - 2 (0.7) 15 NH + 4 (1.0) + 14 NO - 2 (1.1) 15 NH 4 + (1.3) 15 NH 4 + (4.7) 15 NH 4 + (8.4) 15 NH 4 + (13.1) 15 NH 4 + (34.1) 18 O NH 4 + (1.3) 18 O NH 4 + (4.9) 18 O NH 4 + (8.9) 18 O NH 4 + (13.8) 18 O NH 4 + (34.8) Aim Effect of O 2 concentration Anoxic process rates. Determination of Het. Den. potential. Effect of NO 2 -. Effect of NH 4 +. Comparison of N 2 O production pathways by 15 N and 18 O 2 labeling. S4

5 Table S2. Primers and conditions used for the quantification of gene copy numbers of and functional genes by qpcr. Target Organism All Bacteria Betaproteobac terial AOB NOB Nitrobacter Target Gene Primers Sequence (5-3 ) Annealing Temp. Reference 1055f ATG GCT GTC GTC AGC T 55 1, r ACG GGC GGT GTG TAC CTO189fa/b CTO189fc RT1r FGPS872f FGP1269r GGA GRA AAG CAG GGG ATC G GGA GGA AAG TAG GGG ATC G CGT CCT CTC AGA CCA RCT ACT G CTA AAA CTC AAA GGA ATT GA TTT TTT GAG ATT TGC TAG 60 3, NOB Nitrospira Anammox Ammonium oxidizing bacteria NOB Nitrobacter/ Nitrococcus Denitrifying bacteria Denitrifying bacteria/ AOB Denitrifying bacteria amoa nxra nirs nirk nosz Nspra675f Nspra746r Amx809f Amx1066r amoa 1f amoa 2r F1370f1 F2843r2 cd3af R3cd F1aCu R3Cu nosz2f nosz2r GCG GTG AAA TGC GTA GAK ATC G TCA GCG TCA GRW AYG TTC CAG AG GCC GTA AAC GAT GGG CAC T AACGTCTCACGACACGAGCTG GGG GTT TCT ACT GGT GGT CCC CTC KGS AAA GCC TTC TTC CAG ACC GAC GTG TGC GAA AG TCC ACA AGG AAC GGA AGG TC AAC GYS AAG GAR ACS GG GAS TTC GGR TGS GTC TTS AYG AA ATC ATG GT(C/G) CTG CCG CG GCC TCG ATC AG(A/G) TTG TGG TT CGC RAC GGC AAS AAG GTS MSS GT CAK RTG CAK SGC RTG GCA GAA , , S5

6 Table S3. Abundance of nitrogen transforming microbes, as gene copy numbers, and functional genes based on biomass used for Experiment 1 and 4 (Table 1). Standard deviations in parentheses. + Target bacterial O 2 experiment NH 4 experiment group or gene Copy number 1 (copies g wet biomass -1 ) Rel. abundance 1 (%) Copy number 1 (copies g wet biomass -1 ) Rel. abundance 2 (%) AOB 6.3 (1.2) (0.5) 2.6 (0.22) (0.05) Anammox 6.0 (2.3) (5.3) 2.3 (0.25) (0.3) Nitrobacter 8.3 (3.1) (0.03) 2.3 (0.55) (0.01) Nitrospira 2.3 (0.2) (0.02) 2.2 (0.18) (0.03) Other 1.3 (0.2) (5.0) 5.6 (0.55) (0.2) amoa 1.4 (0.5) (0.09) 4.9 (0.5) (0.1) N bacter nxra 7.1 (1.6) (0.001) 2.7 (1.1) (0.01) nirs 1.9 (0.4) (22) 6.5 (0.3) (11) nirk 1.5 (0.11) (1.1) 7.3 (0.2) (0.6) nosz 5.5 (0.8) (0.7) 1.6 (0.01) (0.5) 1 Abundance relative to bacterial gene copy number S6

7 Table S4. Rates ± SE of net N 2 O production, N 2 production, and aerobic ammonium oxidation in combination with bulk NO 2 - concentrations (average ± SD) and N 2 O yields at varying imposed concentrations of oxygen, NO 2 -, and 15 NH 4 +. Experiment Experimental parameter O 2 (mg O 2 L 1 ) a Net N 2 O production (µmol N gvss -1 h -1 ) Aerobic ammonium oxidation rate c (µmol N gvss -1 h -1 ) NO 2 - conc. (µm) N 2 production rate (µmol N gvss -1 h -1 ) Yield (N 2 O/N 2 in %) 1 3 Anoxic b n.a. n.d ± n.a ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±57.1 n.d. n.d. Initial 14 NO - 2 (mm) at 0.2 mg O 2 L ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± NH + 4 (mm) at 0.2 mg O 2 L -1 d 1.1± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± a Oxygen concentrations are averages ± SD of measurements made during the incubations (n = 10). b Rates and concentrations are based on the first 0.5 h of incubation as total NO - 2 concentration decreased fast and was below detection after 0.5 h c Aerobic ammonium oxidation rates in Experiment 4 were calculated as the sum of accumulation rates of NO - 2, NO (excluding NO 3 produced by anammox bacteria) and NO 2 - consumption rate by anammox, because the relative precision of the ammonium analysis was too low to yield accurate rates at the highest concentrations. d Ammonium concentrations are averages ± SD of measurements made during the incubations (n = 7-10). S7

8 References (1) Lane, D. J., 16S/23S sequencing. Nucleic Acid Techniques in Bacterial Systematics, Wiley, Chichester (2) Ferris, M. J.; Muyzer, G.; Ward, D. M., Denaturing gradient gel electrophoresis profiles of 16S -defined populations inhabiting a hot spring microbial mat community. Appl Environ Microb 1996, 62, (2), (3) Kowalchuk, G. A.; Stephen, J. R.; DeBoer, W.; Prosser, J. I.; Embley, T. M.; Woldendorp, J. W., Analysis of ammonia-oxidizing bacteria of the beta subdivision of the class Proteobacteria in coastal sand dunes by denaturing gradient gel electrophoresis and sequencing of PCR-amplified 16S ribosomal DNA fragments. Appl Environ Microb 1997, 63, (4), (4) Hermansson, A.; Lindgren, P. E., Quantification of ammonia-oxidizing bacteria in arable soil by real-time PCR. Appl Environ Microb 2001, 67, (2), (5) Degrange, V.; Bardin, R., Detection and Counting of Nitrobacter Populations in Soil by Pcr. Appl Environ Microb 1995, 61, (6), (6) Graham, D. W.; Knapp, C. W.; Van Vleck, E. S.; Bloor, K.; Lane, T. B.; Graham, C. E., Experimental demonstration of chaotic instability in biological nitrification. ISME J 2007, 1, (5), (7) Tsushima, I.; Kindaichi, T.; Okabe, S., Quantification of anaerobic ammonium-oxidizing bacteria in enrichment cultures by real-time PCR. Water Res 2007, 41, (4), (8) Rotthauwe, J. H.; Witzel, K. P.; Liesack, W., The ammonia monooxygenase structural gene amoa as a functional marker: Molecular fine-scale analysis of natural ammonia-oxidizing populations. Appl Environ Microb 1997, 63, (12), (9) Poly, F.; Wertz, S.; Brothier, E.; Degrange, V., First exploration of Nitrobacter diversity in soils by a PCR cloning-sequencing approach targeting functional gene nxra. FEMS Microbiol Ecol 2008, 63, (1), (10) Wertz, S.; Poly, F.; Le Roux, X.; Degrange, V., Development and application of a PCRdenaturing gradient gel electrophoresis tool to study the diversity of Nitrobacter-like nxra sequences in soil. FEMS Microbiol Ecol 2008, 63, (2), (11) Throbäck, I. N.; Enwall, K.; Jarvis, A.; Hallin, S., Reassessing PCR primers targeting nirs, nirk and nosz genes for community surveys of denitrifying bacteria with DGGE. FEMS Microbiol Ecol 2004, 49, (3), S8

9 (12) Philippot, L.; Piutti, S.; Martin-Laurent, F.; Hallet, S.; Germon, J. C., Molecular analysis of the nitrate-reducing community from unplanted and maize-planted soils. Appl Environ Microb 2002, 68, (12), (13) Hallin, S.; Lindgren, P. E., PCR detection of genes encoding nitrile reductase in denitrifying bacteria. Appl Environ Microb 1999, 65, (4), (14) Henry, S.; Bru, D.; Stres, B.; Hallet, S.; Philippot, L., Quantitative detection of the nosz gene, encoding nitrous oxide reductase, and comparison of the abundances of 16S, narg, nirk, and nosz genes in soils. Appl Environ Microb 2006, 72, (8), S9

Table S1. Primers and PCR conditions used in this paper Primers Sequence (5 3 ) Thermal conditions Reference Rhizobacteria 27F 1492R

Table S1. Primers and PCR conditions used in this paper Primers Sequence (5 3 ) Thermal conditions Reference Rhizobacteria 27F 1492R Table S1. Primers and PCR conditions used in this paper Primers Sequence (5 3 ) Thermal conditions Reference Rhizobacteria 27F 1492R AAC MGG ATT AGA TAC CCK G GGY TAC CTT GTT ACG ACT T Detection of Candidatus

More information

Practical Bioinformatics

Practical Bioinformatics 5/2/2017 Dictionaries d i c t i o n a r y = { A : T, T : A, G : C, C : G } d i c t i o n a r y [ G ] d i c t i o n a r y [ N ] = N d i c t i o n a r y. h a s k e y ( C ) Dictionaries g e n e t i c C o

More information

SUPPORTING INFORMATION FOR. SEquence-Enabled Reassembly of β-lactamase (SEER-LAC): a Sensitive Method for the Detection of Double-Stranded DNA

SUPPORTING INFORMATION FOR. SEquence-Enabled Reassembly of β-lactamase (SEER-LAC): a Sensitive Method for the Detection of Double-Stranded DNA SUPPORTING INFORMATION FOR SEquence-Enabled Reassembly of β-lactamase (SEER-LAC): a Sensitive Method for the Detection of Double-Stranded DNA Aik T. Ooi, Cliff I. Stains, Indraneel Ghosh *, David J. Segal

More information

High throughput near infrared screening discovers DNA-templated silver clusters with peak fluorescence beyond 950 nm

High throughput near infrared screening discovers DNA-templated silver clusters with peak fluorescence beyond 950 nm Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2018 High throughput near infrared screening discovers DNA-templated silver clusters with peak fluorescence

More information

Clay Carter. Department of Biology. QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture.

Clay Carter. Department of Biology. QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture. QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture. Clay Carter Department of Biology QuickTime and a TIFF (LZW) decompressor are needed to see this picture. Ornamental tobacco

More information

SSR ( ) Vol. 48 No ( Microsatellite marker) ( Simple sequence repeat,ssr),

SSR ( ) Vol. 48 No ( Microsatellite marker) ( Simple sequence repeat,ssr), 48 3 () Vol. 48 No. 3 2009 5 Journal of Xiamen University (Nat ural Science) May 2009 SSR,,,, 3 (, 361005) : SSR. 21 516,410. 60 %96. 7 %. (),(Between2groups linkage method),.,, 11 (),. 12,. (, ), : 0.

More information

Supplemental data. Pommerrenig et al. (2011). Plant Cell /tpc

Supplemental data. Pommerrenig et al. (2011). Plant Cell /tpc Supplemental Figure 1. Prediction of phloem-specific MTK1 expression in Arabidopsis shoots and roots. The images and the corresponding numbers showing absolute (A) or relative expression levels (B) of

More information

Number-controlled spatial arrangement of gold nanoparticles with

Number-controlled spatial arrangement of gold nanoparticles with Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Number-controlled spatial arrangement of gold nanoparticles with DNA dendrimers Ping Chen,*

More information

Electronic supplementary material

Electronic supplementary material Applied Microbiology and Biotechnology Electronic supplementary material A family of AA9 lytic polysaccharide monooxygenases in Aspergillus nidulans is differentially regulated by multiple substrates and

More information

Crick s early Hypothesis Revisited

Crick s early Hypothesis Revisited Crick s early Hypothesis Revisited Or The Existence of a Universal Coding Frame Ryan Rossi, Jean-Louis Lassez and Axel Bernal UPenn Center for Bioinformatics BIOINFORMATICS The application of computer

More information

SUPPLEMENTARY DATA - 1 -

SUPPLEMENTARY DATA - 1 - - 1 - SUPPLEMENTARY DATA Construction of B. subtilis rnpb complementation plasmids For complementation, the B. subtilis rnpb wild-type gene (rnpbwt) under control of its native rnpb promoter and terminator

More information

Advanced topics in bioinformatics

Advanced topics in bioinformatics Feinberg Graduate School of the Weizmann Institute of Science Advanced topics in bioinformatics Shmuel Pietrokovski & Eitan Rubin Spring 2003 Course WWW site: http://bioinformatics.weizmann.ac.il/courses/atib

More information

Characterization of Pathogenic Genes through Condensed Matrix Method, Case Study through Bacterial Zeta Toxin

Characterization of Pathogenic Genes through Condensed Matrix Method, Case Study through Bacterial Zeta Toxin International Journal of Genetic Engineering and Biotechnology. ISSN 0974-3073 Volume 2, Number 1 (2011), pp. 109-114 International Research Publication House http://www.irphouse.com Characterization of

More information

Supplementary Information

Supplementary Information Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Directed self-assembly of genomic sequences into monomeric and polymeric branched DNA structures

More information

Supplementary Information for

Supplementary Information for Supplementary Information for Evolutionary conservation of codon optimality reveals hidden signatures of co-translational folding Sebastian Pechmann & Judith Frydman Department of Biology and BioX, Stanford

More information

Supporting Information for. Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)-

Supporting Information for. Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)- Supporting Information for Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)- Dependence and Its Ability to Chelate Multiple Nutrient Transition Metal Ions Rose C. Hadley,

More information

Supporting Information

Supporting Information Supporting Information T. Pellegrino 1,2,3,#, R. A. Sperling 1,#, A. P. Alivisatos 2, W. J. Parak 1,2,* 1 Center for Nanoscience, Ludwig Maximilians Universität München, München, Germany 2 Department of

More information

NSCI Basic Properties of Life and The Biochemistry of Life on Earth

NSCI Basic Properties of Life and The Biochemistry of Life on Earth NSCI 314 LIFE IN THE COSMOS 4 Basic Properties of Life and The Biochemistry of Life on Earth Dr. Karen Kolehmainen Department of Physics CSUSB http://physics.csusb.edu/~karen/ WHAT IS LIFE? HARD TO DEFINE,

More information

SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS. Prokaryotes and Eukaryotes. DNA and RNA

SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS. Prokaryotes and Eukaryotes. DNA and RNA SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS 1 Prokaryotes and Eukaryotes 2 DNA and RNA 3 4 Double helix structure Codons Codons are triplets of bases from the RNA sequence. Each triplet defines an amino-acid.

More information

Regulatory Sequence Analysis. Sequence models (Bernoulli and Markov models)

Regulatory Sequence Analysis. Sequence models (Bernoulli and Markov models) Regulatory Sequence Analysis Sequence models (Bernoulli and Markov models) 1 Why do we need random models? Any pattern discovery relies on an underlying model to estimate the random expectation. This model

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Zn 2+ -binding sites in USP18. (a) The two molecules of USP18 present in the asymmetric unit are shown. Chain A is shown in blue, chain B in green. Bound Zn 2+ ions are shown as

More information

Building a Multifunctional Aptamer-Based DNA Nanoassembly for Targeted Cancer Therapy

Building a Multifunctional Aptamer-Based DNA Nanoassembly for Targeted Cancer Therapy Supporting Information Building a Multifunctional Aptamer-Based DNA Nanoassembly for Targeted Cancer Therapy Cuichen Wu,, Da Han,, Tao Chen,, Lu Peng, Guizhi Zhu,, Mingxu You,, Liping Qiu,, Kwame Sefah,

More information

TM1 TM2 TM3 TM4 TM5 TM6 TM bp

TM1 TM2 TM3 TM4 TM5 TM6 TM bp a 467 bp 1 482 2 93 3 321 4 7 281 6 21 7 66 8 176 19 12 13 212 113 16 8 b ATG TCA GGA CAT GTA ATG GAG GAA TGT GTA GTT CAC GGT ACG TTA GCG GCA GTA TTG CGT TTA ATG GGC GTA GTG M S G H V M E E C V V H G T

More information

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008 MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION DOI:.38/NCHEM.246 Optimizing the specificity of nucleic acid hyridization David Yu Zhang, Sherry Xi Chen, and Peng Yin. Analytic framework and proe design 3.. Concentration-adjusted

More information

Supplemental Figure 1.

Supplemental Figure 1. A wt spoiiiaδ spoiiiahδ bofaδ B C D E spoiiiaδ, bofaδ Supplemental Figure 1. GFP-SpoIVFA is more mislocalized in the absence of both BofA and SpoIIIAH. Sporulation was induced by resuspension in wild-type

More information

Supplemental Table 1. Primers used for cloning and PCR amplification in this study

Supplemental Table 1. Primers used for cloning and PCR amplification in this study Supplemental Table 1. Primers used for cloning and PCR amplification in this study Target Gene Primer sequence NATA1 (At2g393) forward GGG GAC AAG TTT GTA CAA AAA AGC AGG CTT CAT GGC GCC TCC AAC CGC AGC

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.8/NCHEM. Conditionally Fluorescent Molecular Probes for Detecting Single Base Changes in Double-stranded DNA Sherry Xi Chen, David Yu Zhang, Georg Seelig. Analytic framework and probe design.. Design

More information

N 2 production rates limited by nitrite availability in the Bay of Bengal oxygen minimum zone

N 2 production rates limited by nitrite availability in the Bay of Bengal oxygen minimum zone In the format provided by the authors and unedited. 5 SUPPLEMENTARY INFORMATION DOI: 10.1038/NGEO2847 N 2 production rates limited by nitrite availability in the Bay of Bengal oxygen minimum zone L.A.

More information

Evolvable Neural Networks for Time Series Prediction with Adaptive Learning Interval

Evolvable Neural Networks for Time Series Prediction with Adaptive Learning Interval Evolvable Neural Networs for Time Series Prediction with Adaptive Learning Interval Dong-Woo Lee *, Seong G. Kong *, and Kwee-Bo Sim ** *Department of Electrical and Computer Engineering, The University

More information

evoglow - express N kit distributed by Cat.#: FP product information broad host range vectors - gram negative bacteria

evoglow - express N kit distributed by Cat.#: FP product information broad host range vectors - gram negative bacteria evoglow - express N kit broad host range vectors - gram negative bacteria product information distributed by Cat.#: FP-21020 Content: Product Overview... 3 evoglow express N -kit... 3 The evoglow -Fluorescent

More information

The role of the FliD C-terminal domain in pentamer formation and

The role of the FliD C-terminal domain in pentamer formation and The role of the FliD C-terminal domain in pentamer formation and interaction with FliT Hee Jung Kim 1,2,*, Woongjae Yoo 3,*, Kyeong Sik Jin 4, Sangryeol Ryu 3,5 & Hyung Ho Lee 1, 1 Department of Chemistry,

More information

3. Evolution makes sense of homologies. 3. Evolution makes sense of homologies. 3. Evolution makes sense of homologies

3. Evolution makes sense of homologies. 3. Evolution makes sense of homologies. 3. Evolution makes sense of homologies Richard Owen (1848) introduced the term Homology to refer to structural similarities among organisms. To Owen, these similarities indicated that organisms were created following a common plan or archetype.

More information

Modelling and Analysis in Bioinformatics. Lecture 1: Genomic k-mer Statistics

Modelling and Analysis in Bioinformatics. Lecture 1: Genomic k-mer Statistics 582746 Modelling and Analysis in Bioinformatics Lecture 1: Genomic k-mer Statistics Juha Kärkkäinen 06.09.2016 Outline Course introduction Genomic k-mers 1-Mers 2-Mers 3-Mers k-mers for Larger k Outline

More information

evoglow - express N kit Cat. No.: product information broad host range vectors - gram negative bacteria

evoglow - express N kit Cat. No.: product information broad host range vectors - gram negative bacteria evoglow - express N kit broad host range vectors - gram negative bacteria product information Cat. No.: 2.1.020 evocatal GmbH 2 Content: Product Overview... 4 evoglow express N kit... 4 The evoglow Fluorescent

More information

Sex-Linked Inheritance in Macaque Monkeys: Implications for Effective Population Size and Dispersal to Sulawesi

Sex-Linked Inheritance in Macaque Monkeys: Implications for Effective Population Size and Dispersal to Sulawesi Supporting Information http://www.genetics.org/cgi/content/full/genetics.110.116228/dc1 Sex-Linked Inheritance in Macaque Monkeys: Implications for Effective Population Size and Dispersal to Sulawesi Ben

More information

The Trigram and other Fundamental Philosophies

The Trigram and other Fundamental Philosophies The Trigram and other Fundamental Philosophies by Weimin Kwauk July 2012 The following offers a minimal introduction to the trigram and other Chinese fundamental philosophies. A trigram consists of three

More information

ChemiScreen CaS Calcium Sensor Receptor Stable Cell Line

ChemiScreen CaS Calcium Sensor Receptor Stable Cell Line PRODUCT DATASHEET ChemiScreen CaS Calcium Sensor Receptor Stable Cell Line CATALOG NUMBER: HTS137C CONTENTS: 2 vials of mycoplasma-free cells, 1 ml per vial. STORAGE: Vials are to be stored in liquid N

More information

Re- engineering cellular physiology by rewiring high- level global regulatory genes

Re- engineering cellular physiology by rewiring high- level global regulatory genes Re- engineering cellular physiology by rewiring high- level global regulatory genes Stephen Fitzgerald 1,2,, Shane C Dillon 1, Tzu- Chiao Chao 2, Heather L Wiencko 3, Karsten Hokamp 3, Andrew DS Cameron

More information

Near-instant surface-selective fluorogenic protein quantification using sulfonated

Near-instant surface-selective fluorogenic protein quantification using sulfonated Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 Supplemental nline Materials for ear-instant surface-selective fluorogenic

More information

The 3 Genomic Numbers Discovery: How Our Genome Single-Stranded DNA Sequence Is Self-Designed as a Numerical Whole

The 3 Genomic Numbers Discovery: How Our Genome Single-Stranded DNA Sequence Is Self-Designed as a Numerical Whole Applied Mathematics, 2013, 4, 37-53 http://dx.doi.org/10.4236/am.2013.410a2004 Published Online October 2013 (http://www.scirp.org/journal/am) The 3 Genomic Numbers Discovery: How Our Genome Single-Stranded

More information

part 3: analysis of natural selection pressure

part 3: analysis of natural selection pressure part 3: analysis of natural selection pressure markov models are good phenomenological codon models do have many benefits: o principled framework for statistical inference o avoiding ad hoc corrections

More information

Protein Threading. Combinatorial optimization approach. Stefan Balev.

Protein Threading. Combinatorial optimization approach. Stefan Balev. Protein Threading Combinatorial optimization approach Stefan Balev Stefan.Balev@univ-lehavre.fr Laboratoire d informatique du Havre Université du Havre Stefan Balev Cours DEA 30/01/2004 p.1/42 Outline

More information

Why do more divergent sequences produce smaller nonsynonymous/synonymous

Why do more divergent sequences produce smaller nonsynonymous/synonymous Genetics: Early Online, published on June 21, 2013 as 10.1534/genetics.113.152025 Why do more divergent sequences produce smaller nonsynonymous/synonymous rate ratios in pairwise sequence comparisons?

More information

Codon Distribution in Error-Detecting Circular Codes

Codon Distribution in Error-Detecting Circular Codes life Article Codon Distribution in Error-Detecting Circular Codes Elena Fimmel, * and Lutz Strüngmann Institute for Mathematical Biology, Faculty of Computer Science, Mannheim University of Applied Sciences,

More information

Encoding of Amino Acids and Proteins from a Communications and Information Theoretic Perspective

Encoding of Amino Acids and Proteins from a Communications and Information Theoretic Perspective Jacobs University Bremen Encoding of Amino Acids and Proteins from a Communications and Information Theoretic Perspective Semester Project II By: Dawit Nigatu Supervisor: Prof. Dr. Werner Henkel Transmission

More information

Evolutionary dynamics of abundant stop codon readthrough in Anopheles and Drosophila

Evolutionary dynamics of abundant stop codon readthrough in Anopheles and Drosophila biorxiv preprint first posted online May. 3, 2016; doi: http://dx.doi.org/10.1101/051557. The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. All rights reserved.

More information

Chain-like assembly of gold nanoparticles on artificial DNA templates via Click Chemistry

Chain-like assembly of gold nanoparticles on artificial DNA templates via Click Chemistry Electronic Supporting Information: Chain-like assembly of gold nanoparticles on artificial DNA templates via Click Chemistry Monika Fischler, Alla Sologubenko, Joachim Mayer, Guido Clever, Glenn Burley,

More information

Timing molecular motion and production with a synthetic transcriptional clock

Timing molecular motion and production with a synthetic transcriptional clock Timing molecular motion and production with a synthetic transcriptional clock Elisa Franco,1, Eike Friedrichs 2, Jongmin Kim 3, Ralf Jungmann 2, Richard Murray 1, Erik Winfree 3,4,5, and Friedrich C. Simmel

More information

Gas entrapment and microbial N 2 O reduction reduce N 2 O emissions from a biochar-amended sandy clay loam soil

Gas entrapment and microbial N 2 O reduction reduce N 2 O emissions from a biochar-amended sandy clay loam soil Gas entrapment and microbial N 2 O reduction reduce N 2 O emissions from a biochar-amended sandy clay loam soil Johannes Harter a, Ivan Guzman-Bustamante b, Stefanie Kuehfuss c, Reiner Ruser b, Reinhard

More information

Supplementary Information

Supplementary Information Supplementary Information Arginine-rhamnosylation as new strategy to activate translation elongation factor P Jürgen Lassak 1,2,*, Eva Keilhauer 3, Max Fürst 1,2, Kristin Wuichet 4, Julia Gödeke 5, Agata

More information

AtTIL-P91V. AtTIL-P92V. AtTIL-P95V. AtTIL-P98V YFP-HPR

AtTIL-P91V. AtTIL-P92V. AtTIL-P95V. AtTIL-P98V YFP-HPR Online Resource 1. Primers used to generate constructs AtTIL-P91V, AtTIL-P92V, AtTIL-P95V and AtTIL-P98V and YFP(HPR) using overlapping PCR. pentr/d- TOPO-AtTIL was used as template to generate the constructs

More information

Supplementary information. Porphyrin-Assisted Docking of a Thermophage Portal Protein into Lipid Bilayers: Nanopore Engineering and Characterization.

Supplementary information. Porphyrin-Assisted Docking of a Thermophage Portal Protein into Lipid Bilayers: Nanopore Engineering and Characterization. Supplementary information Porphyrin-Assisted Docking of a Thermophage Portal Protein into Lipid Bilayers: Nanopore Engineering and Characterization. Benjamin Cressiot #, Sandra J. Greive #, Wei Si ^#,

More information

Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day

Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day conditions. Photo was taken when the wild type plant started to bolt. Scale bar represents 1 cm. Supplemental Figure 2. Flowering

More information

Supplemental Figure 1. Differences in amino acid composition between the paralogous copies Os MADS17 and Os MADS6.

Supplemental Figure 1. Differences in amino acid composition between the paralogous copies Os MADS17 and Os MADS6. Supplemental Data. Reinheimer and Kellogg (2009). Evolution of AGL6-like MADSbox genes in grasses (Poaceae): ovule expression is ancient and palea expression is new Supplemental Figure 1. Differences in

More information

Introduction to Molecular Phylogeny

Introduction to Molecular Phylogeny Introduction to Molecular Phylogeny Starting point: a set of homologous, aligned DNA or protein sequences Result of the process: a tree describing evolutionary relationships between studied sequences =

More information

Supporting Information. An Electric Single-Molecule Hybridisation Detector for short DNA Fragments

Supporting Information. An Electric Single-Molecule Hybridisation Detector for short DNA Fragments Supporting Information An Electric Single-Molecule Hybridisation Detector for short DNA Fragments A.Y.Y. Loh, 1 C.H. Burgess, 2 D.A. Tanase, 1 G. Ferrari, 3 M.A. Maclachlan, 2 A.E.G. Cass, 1 T. Albrecht*

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/4/148/148ra116/dc1 Supplementary Materials for Tracking a Hospital Outbreak of Carbapenem-Resistant Klebsiella pneumoniae with Whole-Genome Sequencing

More information

Identification of a Locus Involved in the Utilization of Iron by Haemophilus influenzae

Identification of a Locus Involved in the Utilization of Iron by Haemophilus influenzae INFECrION AND IMMUNITY, OCt. 1994, p. 4515-4525 0019-9567/94/$04.00+0 Copyright 1994, American Society for Microbiology Vol. 62, No. 10 Identification of a Locus Involved in the Utilization of Iron by

More information

FliZ Is a Posttranslational Activator of FlhD 4 C 2 -Dependent Flagellar Gene Expression

FliZ Is a Posttranslational Activator of FlhD 4 C 2 -Dependent Flagellar Gene Expression JOURNAL OF BACTERIOLOGY, July 2008, p. 4979 4988 Vol. 190, No. 14 0021-9193/08/$08.00 0 doi:10.1128/jb.01996-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. FliZ Is a Posttranslational

More information

part 4: phenomenological load and biological inference. phenomenological load review types of models. Gαβ = 8π Tαβ. Newton.

part 4: phenomenological load and biological inference. phenomenological load review types of models. Gαβ = 8π Tαβ. Newton. 2017-07-29 part 4: and biological inference review types of models phenomenological Newton F= Gm1m2 r2 mechanistic Einstein Gαβ = 8π Tαβ 1 molecular evolution is process and pattern process pattern MutSel

More information

Insects act as vectors for a number of important diseases of

Insects act as vectors for a number of important diseases of pubs.acs.org/synthbio Novel Synthetic Medea Selfish Genetic Elements Drive Population Replacement in Drosophila; a Theoretical Exploration of Medea- Dependent Population Suppression Omar S. Abari,,# Chun-Hong

More information

Supplementary Figure 1. Schematic of split-merger microfluidic device used to add transposase to template drops for fragmentation.

Supplementary Figure 1. Schematic of split-merger microfluidic device used to add transposase to template drops for fragmentation. Supplementary Figure 1. Schematic of split-merger microfluidic device used to add transposase to template drops for fragmentation. Inlets are labelled in blue, outlets are labelled in red, and static channels

More information

ydci GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC

ydci GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC Table S1. DNA primers used in this study. Name ydci P1ydcIkd3 Sequence GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC Kd3ydcIp2 lacz fusion YdcIendP1 YdcItrgP2 GAC AGC

More information

Biosynthesis of Bacterial Glycogen: Primary Structure of Salmonella typhimurium ADPglucose Synthetase as Deduced from the

Biosynthesis of Bacterial Glycogen: Primary Structure of Salmonella typhimurium ADPglucose Synthetase as Deduced from the JOURNAL OF BACTERIOLOGY, Sept. 1987, p. 4355-4360 0021-9193/87/094355-06$02.00/0 Copyright X) 1987, American Society for Microbiology Vol. 169, No. 9 Biosynthesis of Bacterial Glycogen: Primary Structure

More information

160, and 220 bases, respectively, shorter than pbr322/hag93. (data not shown). The DNA sequence of approximately 100 bases of each

160, and 220 bases, respectively, shorter than pbr322/hag93. (data not shown). The DNA sequence of approximately 100 bases of each JOURNAL OF BACTEROLOGY, JUlY 1988, p. 3305-3309 0021-9193/88/073305-05$02.00/0 Copyright 1988, American Society for Microbiology Vol. 170, No. 7 Construction of a Minimum-Size Functional Flagellin of Escherichia

More information

DNA sequence analysis of the imp UV protection and mutation operon of the plasmid TP110: identification of a third gene

DNA sequence analysis of the imp UV protection and mutation operon of the plasmid TP110: identification of a third gene QD) 1990 Oxford University Press Nucleic Acids Research, Vol. 18, No. 17 5045 DNA sequence analysis of the imp UV protection and mutation operon of the plasmid TP110: identification of a third gene David

More information

Evidence for RNA editing in mitochondria of all major groups of

Evidence for RNA editing in mitochondria of all major groups of Proc. Natl. Acad. Sci. USA Vol. 91, pp. 629-633, January 1994 Plant Biology Evidence for RNA editing in mitochondria of all major groups of land plants except the Bryophyta RUDOLF HIESEL, BRUNO COMBETTES*,

More information

Electronic Supporting Information for

Electronic Supporting Information for Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Electronic Supporting Information for A DNA-conjugated small molecule catalyst enzyme mimic

More information

Symmetry Studies. Marlos A. G. Viana

Symmetry Studies. Marlos A. G. Viana Symmetry Studies Marlos A. G. Viana aaa aac aag aat caa cac cag cat aca acc acg act cca ccc ccg cct aga agc agg agt cga cgc cgg cgt ata atc atg att cta ctc ctg ctt gaa gac gag gat taa tac tag tat gca gcc

More information

It is the author's version of the article accepted for publication in the journal "Biosystems" on 03/10/2015.

It is the author's version of the article accepted for publication in the journal Biosystems on 03/10/2015. It is the author's version of the article accepted for publication in the journal "Biosystems" on 03/10/2015. The system-resonance approach in modeling genetic structures Sergey V. Petoukhov Institute

More information

Supporting Information. Archaeal Ammonium Oxidation Coupled with Bacterial Nitrite Oxidation in a Simulated Drinking Water Premise Plumbing System

Supporting Information. Archaeal Ammonium Oxidation Coupled with Bacterial Nitrite Oxidation in a Simulated Drinking Water Premise Plumbing System Electronic Supplementary Material (ESI) for Environmental Science: Water Research & Technology. This journal is The Royal Society of Chemistry 2016 Supporting Information Archaeal Ammonium Oxidation Coupled

More information

Chemical Biology on Genomic DNA: minimizing PCR bias. Electronic Supplementary Information (ESI) for Chemical Communications

Chemical Biology on Genomic DNA: minimizing PCR bias. Electronic Supplementary Information (ESI) for Chemical Communications Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Chemical Biology on Genomic DA: minimizing PCR bias Gordon R. McInroy, Eun-Ang Raiber, & Shankar

More information

How DNA barcoding can be more effective in microalgae. identification: a case of cryptic diversity revelation in Scenedesmus

How DNA barcoding can be more effective in microalgae. identification: a case of cryptic diversity revelation in Scenedesmus How DNA barcoding can be more effective in microalgae identification: a case of cryptic diversity revelation in Scenedesmus (Chlorophyceae) Shanmei Zou, Cong Fei, Chun Wang, Zhan Gao, Yachao Bao, Meilin

More information

THE MATHEMATICAL STRUCTURE OF THE GENETIC CODE: A TOOL FOR INQUIRING ON THE ORIGIN OF LIFE

THE MATHEMATICAL STRUCTURE OF THE GENETIC CODE: A TOOL FOR INQUIRING ON THE ORIGIN OF LIFE STATISTICA, anno LXIX, n. 2 3, 2009 THE MATHEMATICAL STRUCTURE OF THE GENETIC CODE: A TOOL FOR INQUIRING ON THE ORIGIN OF LIFE Diego Luis Gonzalez CNR-IMM, Bologna Section, Via Gobetti 101, I-40129, Bologna,

More information

Characterization of Multiple-Antimicrobial-Resistant Salmonella Serovars Isolated from Retail Meats

Characterization of Multiple-Antimicrobial-Resistant Salmonella Serovars Isolated from Retail Meats APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Jan. 2004, p. 1 7 Vol. 70, No. 1 0099-2240/04/$08.00 0 DOI: 10.1128/AEM.70.1.1 7.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Characterization

More information

Glucosylglycerate phosphorylase, a novel enzyme specificity involved in compatible solute metabolism

Glucosylglycerate phosphorylase, a novel enzyme specificity involved in compatible solute metabolism Supplementary Information for Glucosylglycerate phosphorylase, a novel enzyme specificity involved in compatible solute metabolism Jorick Franceus, Denise Pinel, Tom Desmet Corresponding author: Tom Desmet,

More information

ANALYZING THE DIVERSITY OF A SMALL ANTIBODY MIMIC LIBRARY. Nick Empey. Chapel Hill 2010

ANALYZING THE DIVERSITY OF A SMALL ANTIBODY MIMIC LIBRARY. Nick Empey. Chapel Hill 2010 ANALYZING THE DIVERSITY OF A SMALL ANTIBODY MIMIC LIBRARY Nick Empey A thesis submitted to the faculty of the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for

More information

codon substitution models and the analysis of natural selection pressure

codon substitution models and the analysis of natural selection pressure 2015-07-20 codon substitution models and the analysis of natural selection pressure Joseph P. Bielawski Department of Biology Department of Mathematics & Statistics Dalhousie University introduction morphological

More information

Title: Robust analysis of synthetic label-free DNA junctions in solution by X-ray scattering and molecular simulation

Title: Robust analysis of synthetic label-free DNA junctions in solution by X-ray scattering and molecular simulation Supplementary Information Title: Robust analysis of synthetic label-free DNA junctions in solution by X-ray scattering and molecular simulation Kyuhyun Im 1,5, Daun Jeong 2,5, Jaehyun Hur 1, Sung-Jin Kim

More information

World Journal of Pharmaceutical Research SJIF Impact Factor 8.074

World Journal of Pharmaceutical Research SJIF Impact Factor 8.074 SJIF Impact Factor 8.074 Volume 7, Issue 5, 966-973. Research Article ISSN 2277 7105 MOLECULAR DETECTION OF ENTEROTOXIGENIC ISOLATES OF SALMONELLA TYPHIMURIUM, SHIGELLA FLEXNERI AND STAPHYLOCOCCUS AUREUS

More information

Effects of nanomaterial disposal on wastewater treatment microbial communities and toxicity implications

Effects of nanomaterial disposal on wastewater treatment microbial communities and toxicity implications 2013 Sustainable Nanotechnology Organization Conference Effects of nanomaterial disposal on wastewater treatment microbial communities and toxicity implications Yanjun Ma Jacob Metch, Eric Vejerano, Amy

More information

MicroGenomics. Universal replication biases in bacteria

MicroGenomics. Universal replication biases in bacteria Molecular Microbiology (1999) 32(1), 11±16 MicroGenomics Universal replication biases in bacteria Eduardo P. C. Rocha, 1,2 Antoine Danchin 2 and Alain Viari 1,3 * 1 Atelier de BioInformatique, UniversiteÂ

More information

Table S1. DNA oligonucleo3des used for 3D pol mutagenesis. Fingers Domain Entry Channel. Fidelity

Table S1. DNA oligonucleo3des used for 3D pol mutagenesis. Fingers Domain Entry Channel. Fidelity Table S1. DNA oligonucleo3des used for 3D pol mutagenesis. Fingers Domain Entry Channel Fidelity Charged Residues Interac9ng with Template and Product RNAs Thumb Domain 3D pol Mutations Parental codon

More information

DNA Barcoding Fishery Resources:

DNA Barcoding Fishery Resources: DNA Barcoding Fishery Resources: A case study in Shandong Costal Water Shufang Liu Laboratory of Molecular ecology of fishery resources Yellow Sea Fisheries Research Institute (YSFRI) Chinese Academy of

More information

Diversity of Chlamydia trachomatis Major Outer Membrane

Diversity of Chlamydia trachomatis Major Outer Membrane JOURNAL OF ACTERIOLOGY, Sept. 1987, p. 3879-3885 Vol. 169, No. 9 0021-9193/87/093879-07$02.00/0 Copyright 1987, American Society for Microbiology Diversity of Chlamydia trachomatis Major Outer Membrane

More information

Metabolic evidence for biogeographic isolation of the extremophilic bacterium Salinibacter ruber.

Metabolic evidence for biogeographic isolation of the extremophilic bacterium Salinibacter ruber. Supplementary information: Metabolic evidence for biogeographic isolation of the extremophilic bacterium Salinibacter ruber. Ramon Rosselló-Mora 1, Marianna Lucio², Arantxa Peña 3, Jocelyn Brito-Echeverría

More information

Using algebraic geometry for phylogenetic reconstruction

Using algebraic geometry for phylogenetic reconstruction Using algebraic geometry for phylogenetic reconstruction Marta Casanellas i Rius (joint work with Jesús Fernández-Sánchez) Departament de Matemàtica Aplicada I Universitat Politècnica de Catalunya IMA

More information

Motif Finding Algorithms. Sudarsan Padhy IIIT Bhubaneswar

Motif Finding Algorithms. Sudarsan Padhy IIIT Bhubaneswar Motif Finding Algorithms Sudarsan Padhy IIIT Bhubaneswar Outline Gene Regulation Regulatory Motifs The Motif Finding Problem Brute Force Motif Finding Consensus and Pattern Branching: Greedy Motif Search

More information

Appendix B Protein-Signaling Networks from Single-cell Fluctuations and Information Theory Profiling B.1. Introduction

Appendix B Protein-Signaling Networks from Single-cell Fluctuations and Information Theory Profiling B.1. Introduction 92 Appendix B Protein-Signaling Networks from Single-cell Fluctuations and Information Theory Profiling B.1. Introduction Protein-signaling pathways play important roles in tissue processes ranging from

More information

supplementary information

supplementary information DOI: 10.1038/ncb1825 Figure S1 Venus::UNC-6 expression prior to and during AC invasion. (a-c) Nomarski images overlayed with Venus::UNC-6 ( SP) expression shown in yellow (left), and Venus::UNC-6 ( SP)

More information

HADAMARD MATRICES AND QUINT MATRICES IN MATRIX PRESENTATIONS OF MOLECULAR GENETIC SYSTEMS

HADAMARD MATRICES AND QUINT MATRICES IN MATRIX PRESENTATIONS OF MOLECULAR GENETIC SYSTEMS Symmetry: Culture and Science Vol. 16, No. 3, 247-266, 2005 HADAMARD MATRICES AND QUINT MATRICES IN MATRIX PRESENTATIONS OF MOLECULAR GENETIC SYSTEMS Sergey V. Petoukhov Address: Department of Biomechanics,

More information

A functional homologue of goosecoid in Drosophila

A functional homologue of goosecoid in Drosophila Development 122, 1641-1650 (1996) Printed in Great Britain The Company of Biologists Limited 1996 DEV1069 1641 A functional homologue of goosecoid in Drosophila Anne Goriely 1, Michael Stella 1, Catherine

More information

NEW DNA CYCLIC CODES OVER RINGS

NEW DNA CYCLIC CODES OVER RINGS NEW DNA CYCLIC CODES OVER RINGS NABIL BENNENNI, KENZA GUENDA AND SIHEM MESNAGER arxiv:1505.06263v1 [cs.it] 23 May 2015 Abstract. This paper is dealing with DNA cyclic codes which play an important role

More information

dead, a New Escherichia coli Gene Encoding a Presumed

dead, a New Escherichia coli Gene Encoding a Presumed JOURNAL OF BACTERIOLOGY, June 1991, p. 3291-3302 0021-9193/91/113291-12$02.00/0 Copyright 1991, American Society for Microbiology Vol. 173, No. 11 dead, a New Escherichia coli Gene Encoding a Presumed

More information

evoglow yeast kit distributed by product information Cat.#: FP-21040

evoglow yeast kit distributed by product information Cat.#: FP-21040 evoglow yeast kit product information distributed by Cat.#: FP-21040 Flavin-mononucleotide-based Fluorescent Protein (FbFP) evoglow basic kit Cat.# FP-21010 Quantity 20 µg each General Information Fluorescent

More information

evoglow basic kit product information

evoglow basic kit product information evoglow basic kit product information Cat. No.: 2.1.010 Flavin-mononucleotide-based Fluorescent Protein (FbFP) evoglow basic kit Catalog No. evo-2.1.010 Quantity 20 µg each General Information Fluorescent

More information

Gene manipulation in Bacillus thuringiensis : Biopesticide Development

Gene manipulation in Bacillus thuringiensis : Biopesticide Development Gene manipulation in Bacillus thuringiensis : Biopesticide Development For safer Environment, Agriculture and Food! Samir JAOUA Univ. of Qatar, CAS, Dept of Biol. & Environ. Sc / Centre of Biotechno. Sfax,

More information

Objective: You will be able to justify the claim that organisms share many conserved core processes and features.

Objective: You will be able to justify the claim that organisms share many conserved core processes and features. Objective: You will be able to justify the claim that organisms share many conserved core processes and features. Do Now: Read Enduring Understanding B Essential knowledge: Organisms share many conserved

More information

Codon-model based inference of selection pressure. (a very brief review prior to the PAML lab)

Codon-model based inference of selection pressure. (a very brief review prior to the PAML lab) Codon-model based inference of selection pressure (a very brief review prior to the PAML lab) an index of selection pressure rate ratio mode example dn/ds < 1 purifying (negative) selection histones dn/ds

More information