The First Five Seconds in the Life of a Clathrin-Coated Pit

Transcription

1 The First Five Seons in the Life of lthrin-ote Pit Emnuele oui,,2 Frnçois Aguet, Steeve oulnt,,2,3 n Tom Kirhhusen,2, * Deprtment of ell iology, Hrvr Meil Shool, oston, MA 2, USA 2 Immune Disese Institute n Progrm in ellulr n Moleulr Meiine t oston hilren s Hospitl, oston, MA 2, USA 3 Present ress: Lortory of Virl Infetion n Innte Immune Sensing Dynmis, Rupreht-Krls-Universität, Heielerg 697, Germny *orresponene: kirhhusen@rystl.hrvr.eu SUMMARY ote pits ssemle y growth of lthrin lttie, whih is linke y ptors to the unerlying memrne. How oes this proess strt? We use live-ell TIRF imging with single-moleule EGFP sensitivity n high temporl resolution to etet rrivl of the lthrin triskelions n AP2 ptors tht initite ot ssemly. Unise ojet ientifition n trjetory trking, together with sttistil moel, yiel the rrivl times n numers of iniviul proteins, s well s experimentlly onfirme estimtes of the extent of sustitution of enogenous y expresse, fluoresently tgge proteins. Pits initite y oorinte rrivl of lthrin n AP2, whih is usully etete s two sequentil steps, eh of one triskelion with two ptors. PI-4,-P 2 is essentil for initition. The essory proteins FHo/2 re not; inste, they re require for sustine growth. This ojetive piture of ote pit initition lso shows tht methos outline here will e roly useful for stuies of ynmi ssemlies in living ells. INTRODUTION Memrne trffi estlishes, mintins, n reorgnizes most of the prinipl omprtments of ell. It oes so while retining the ompositionl n funtionl heterogeneity of the onor n eptor memrnes. lthrin-ote vesiles, the first memrne trffi rriers reognize n nlyze in etil, hve eome prigm for efforts to unerstn moleulr mehnisms of other moes of vesiulr trnsport (Hrrison n Kirhhusen, 2). They rry rgo, suh s trnsferrin, immunogloulins, low-ensity lipoprotein (LDL), hormones, n signling reeptors, from the plsm memrne to enosomes n etween enosomes n the trns-golgi network. The nonil ote pit is n invginting struture in whih ssemly of urve lthrin lttie, linke y ptors n other proteins to eformtion of the unerlying memrne, gives rise to ote vesile y onstrition n (ynmin-tlyze) sission (Kirhhusen, 29; Tru, 29). euse it tkes ple t the ell surfe, ote pit ssemly is prtiulrly fvorle for etile moleulr nlysis y live-ell fluoresene mirosopy. Our urrent piture of the stges in the formtion of ote pits n ote vesiles erives primrily from rel-time imging of living ells y totl internl refletion fluoresene (TIRF) n spinning-isk onfol mirosopy to follow the formtion of ote pits n vesiles t the plsm memrne (Ehrlih et l., 24; Girov et l., 999; Mettlen et l., 2; Sffrin et l., 29; Tylor et l., 2). We n formlly istinguish severl sequentil stges orresponing to nuletion, growth n invgintion, uing n sission, n unoting. The whole yle ours in out min. The most importnt struturl omponents of the ot re lthrin n its AP2 (-2-m2-s2) heterotetrmeri ptor omplex. ote pit formtion proees y sequentil ition of lthrin triskelions n ptors, generting shrply urve ot; ptor-meite intertions with memrne-oun proteins (n lipis) eform the unerlying memrne; ynmin meites sission when the eformtion hs rete suitly nrrow nek; n uxilin, whih rrives immeitely following sission, reruits Hs7 to iret unoting (Lee et l., 26; Mssol et l., 26). HipR, whih ins lthrin light hins, reruits tin, whih is require in some instnes for otevesile mturtion n uing (Ferguson et l., 29; Gottfrie et l., 29; Merrifiel et l., 22; Sffrin et l., 29). A numer of essory proteins ssoite with ote pits t speifi stges of ssemly n isssemly (Henne et l., 2; Reier et l., 29; Toshim et l., 26; Tru, 29), ut their funtions re less ertin. Eps, epsin, FHo n FHo2 (FHo/2), n intersetin form omplex tht ppers to ollet t the rim of ote pit (Henne et l., 2; Reier et l., 29; Sffrin et l., 29; Ter et l., 996). This rim omplex umultes uring erly stges of ote pit ssemly, ut its omponents re exlue from ue ote vesile. It hs een propose tht the rim omplex omponents re require for ote pit initition euse ote vesiles fil to form in their sene. Other, nonessentil omponents re require for inorportion of prtiulr rgo moleules (Goomn et l., 996; Miller et l., 2; Yu et l., 27). Our present unerstning of ote pit initition omes from ensemle iohemil ssys n from live-ell imging tht i not hieve levels of sensitivity n temporl resolution require ell, 49 7, August 3, 22 ª22 Elsevier In. 49

2 A D # EGFP TIRF exittion EGFP-L Fluoresene intensity Weighte omintion of moels 3 2 Itertive moel fitting Dwell times 2 2 Time 2 Intensity steps Figure. Shemti Representtion of the Experimentl Setup n omputtionl Anlysis (A) TIRF imging setup use for the experiments. This illustrtion shows n exmple of the reruitment of lthrin n AP2 ptors to the plsm memrne (yellow) of ell tthe through the moifie PEG support to glss overslip. Eh lthrin triskelion ontins three light hins tht, epening on the expression level, might or might not e reple y etopilly expresse EGFP-L (green). The imging experiments use here were esigne to etet n trk with single-moleule sensitivity the rrivl of the first lthrin (or AP2) moleules to the site of ote pit initition. () Distriution of numers of triskelions ontining none, one, two, or three EGFP-L moleules. Inorportion of EGFP-L follows inomil istriution, s shown in this exmple for replement of 6%. () Frme from TIRF time series showing fluoresent spots orresponing to ote pits lele with lthrin EGFP-L. Sle r, mm. The fluoresene intensity tre (lue) orrespons to the profile from single lthrin-ote pit imge uring its initition phse. A step-fitting funtion (lk) ws use to etermine the fluoresene intensity n well time (urtion) ssoite with the first two steps (inite y their respetive numers); these vlues were omine to generte the fluoresene intensity istriution shown in the gry histogrm of (D). (D) Dt flow n omputtionl nlysis. Stge shows the weighte ontriutions (green) for the lulte istriution of the numer of EGFPs orresponing to ifferent moes of triskelion reruitment (weights to 3 ) onstrine y the known moleulr strutures. For exmple, in the se of lthrin, EGFPs n only rrive in sets of one, two, three, et., s prt of one or more triskelions, eh ontining either zero, one, two, or three EGFP-L, n their reltive mounts re weighte y the extent of light-hin replement (). Stge 2 shows the omine weighte istriution of numers of 3 4 to etet rrivl of iniviul moleules (Kirhhusen, 29; MMhon n ourot, 2; Tylor et l., 2; Tru, 29). Moleulr speies lerly neessry to lunh ssemly of ommitte ote pit t the inner plsm-memrne surfe re lthrin n AP2s; PI-4,-P 2 my e essentil to ring AP2 to the memrne (Antonesu et l., 2; ourot et l., 26; Zonu et l., 27); n memers of the rim omplex re require t some erly stge (Henne et l., 2; Reier et l., 29). Any ensemle mesurement or ny set of low-sensitivity imging sequenes is likely to osure temporl sequenes n potentil usl reltionships. We esrie here mesurements tht etermine the sequene of initil events in iniviul ote strutures (Figure ). We use unise ojet etetion n trjetory trking to nlyze live-ell TIRF imges reore with single-moleule enhne green fluoresent protein (EGFP) etetion n high temporl resolution. euse we oul etet the rrivl of iniviul lthrin triskelions n AP2 ptors to sites of ote pit initition (Figures A ), we oul pply omputtionl moeling to etermine the stoihiometry of the protein omplexes t erly time points s well s the extent of sustitution of enogenous y etopilly expresse fluoresently tgge himers (Figure D). We fin tht ll pits initite with two sequentil events, n eh event is usully oorinte rrivl of one triskelion n two AP2 omplexes ut is sometimes two triskelions n four AP2s. PI-4,-P 2 is essentil. FHo n FHo2 re not essentil to initite ote pit formtion ut rther to sustin growth of the lthrin ot n invgintion of the memrne. RESULTS Reruitment of lthrin to ote Pits Detete with Single-Moleule Sensitivity To stuy the moleulr events uring initition of ote pit t the ell surfe, we first estlishe tht our TIRF mirosope n our nlytil tools (see Extene Experimentl Proeures n Figure S ville online) woul llow etetion of the fluoresene ontriute to iffrtion-limite spot y single EGFP. We imge iotinylte EGFPs pture y viin on the surfe of glss overslip moifie (to prevent nonspeifi sorption of protein) with n inert lyer of iotinylte poly(ethylene glyol) (PEG) (öking et l., 2). The erement in single photolehing step of the intensity from iffrtionlimite spot (Figures SA n S) oeye norml istriution, n we oul tke the verge of tht istriution s the EGFPs (lue) from stge n the lulte EGFP istriution otine y onvolving the istriution of lulte EGFP moleules with Gussins (light lue), for whih the mens n SDs were erive from the single-moleule lirtion of fluoresene intensity. lirtions re presente in Figure S. Stge 3 orrespons to the omprison etween the lulte EGFP intensity istriution (lue tre) n the experimentlly etermine EGFP mesurements (gry). The numer of lthrin triskelions reruite uring step is otine y n itertive serh proess tht minimizes the lest-squres ifferene of the umultive istriution funtions etween the experimentlly mesure n the lulte EGFP istriution vlues yieling the finl weighte ontriution n light-hin sustitution prmeters (stge 4). See lso Figure S. 496 ell, 49 7, August 3, 22 ª22 Elsevier In.

3 fluoresene signl from one EGFP (Figure S). We then foun, s expete, tht the intensity thus lirte sle linerly with the numer of EGFP moleules pture within the spot (Figure SD). We onfirme tht EGFP ssoition with triskelions or AP2 imge on nonmoifie glss overslip i not ffet the mplitue of the photolehing step y showing tht the mplitue ws the sme whether EGFP ws lone or fuse to triskelion-oun lthrin light hin L (EGFP-L) or fuse to the AP2-oun ptin s2 (s2-egfp) (Figure SE); lthrin n AP2 tgging were hieve y stle expression of EGFP- L n s2-egfp, respetively (Ehrlih et l., 24; Loerke et l., 2). We use the TIRF setup thus lirte with iotinylte EGFP to follow ote pit formtion in S ells (Figure ). ells were llowe to tth to lyer of iotinylte fironetin, whih ws rige y viin to the iotinylte PEG tht ote the overslip n provie n optilly flt support. We onfirme tht the lthrin-epenent enoyti tivity ws norml in ells tthe to the moifie PEG support y showing tht plting onto the moifie sustrte h no effet on the kinetis of ot formtion. This ws etermine y live-ell spinning-isk onfol mirosopy of fluoresently tgge lthrin or AP2 imge in the ottom n top surfes of the ells n of uptke of fluoresently tgge trnsferrin (t not shown). ells plte on the moifie PEG support lso h mny fewer lthrin-ote plques thn i those tthe iretly to glss for or more ys (t not shown). We quire TIRF t t frequeny of. Hz to provie n equte numer of t points n reore for totl intervl of 6 s to minimize photolehing n potentil phototoxiity (see for exmple Movie S). The reltively short reoring intervl i not, in generl, llow us to etermine whether growing lthrin-ote struture orrespone to ommitte or n ortive pit (Ehrlih et l., 24; Kirhhusen, 29; Loerke et l., 29; Sffrin et l., 29), s the time series for most of them ene efore omplete ssemly. We elieve tht this unertinty hs no effet on the onlusions we rw here euse, uring the initition phse, the hrteristis of lthrin n AP2 reruitment re the sme, regrless of the urtion of the event (Ehrlih et l., 24; Loerke et l., 2). We ientifie ll the fluoresent ojets from five inepenent ells y using the u-trk softwre pkge (Jqmn et l., 28). We selete events for nlysis y pplying the following riteri. () The fluoresent spot remine iffrtion limite for the full urtion of the time series. (2) The spot move less thn.6 mm (2 pixels/frme) in x n y n i not ollie with other fluoresent ojets. These riteri selete plsmmemrne-oun pits n rejete strutures ssoite with enosoml memrnes tht trnsiently pprohe the ell surfe. (3) The spot ws not present when the time series egn n remine longer thn frmes (.7 s). This riterion eliminte trnsients n ensure tht we inlue only true inititions. The fluoresene intensity of spots tht met these riteri lwys inrese with time (Figures n 2A), whih is property estlishe previously for oth ommitte n ortive pits (Ehrlih et l., 24; Loerke et l., 29; Sffrin et l., 29). The eginning of the tre ws tken s the time point t whih the net fluoresene intensity (over kgroun) ws equivlent to the signl from t lest one EGFP (Figures n 2A, right pnels). We inspete the iniviul tres of ll ojets tht lste longer thn s n onfirme tht the utomte ssignment of the strting point gree with the time hosen y hn in over 8% of suh events; the strting point for the remining pits ws juste mnully so s to inlue the omplete initition phse. Detile nlysis of lthrin tres for erly phses of 37 ote pits from five ells showe tht the first etetle events were two onseutive stepwise inreses in fluoresene intensity (Figure 2A, right pnels, selete exmples). Histogrms of the istriution of time intervls etween the first n seon intensity inrements n etween the seon n susequent ones, with verge well times of 2.3 n.9 s, respetively, re in Figure 2. The rise n fll, rther thn single exponentil ehvior, of the istriutions suggests tht more thn one rtelimiting step etermines the kinetis of eh of these two lthrin-reruitment events. The numer of EGFP-L per lthrin triskelion n vry from zero to three, epening on the level of fluoresent light-hin expression n the egree of sustitution for enogenous lthrin light hin (L) n lthrin light hin (L) (Figure ), n iret inspetion inee showe onsierle vriility in the mgnitues of the fluoresene inrements. To etermine the numer of EGFP-L moleules reruite uring eh of the onseutive steps, we fitte the intensity istriutions with ifferent moels tht took into ount vrile egrees of light-hin sustitution n lterntive ontriutions of lthrin triskelions uring the first n seon steps of reruitment for exmple, only one triskelion, only two triskelions, or vrile omintion of one n two triskelions, et. For eh moel n for eh of the first two events, we lulte n expete EGFP frequeny istriution se on the onstrint tht eh event must orrespon to rrivl of one, two, or more triskelions, eh with zero, one, two, or three EGFP-L, uner the ssumption tht the EGFP- L oupny follows inomil istriution tht epens on the rtio of etopilly expresse EGFP-L to enogenous L n L (see Experimentl Proeures n Figure ). We vrie oth the reltive frtion of events in whih one, two, or more triskelions rrive t the plsm memrne n the extent of light-hin replement (Figure D). From the EGFP frequeny istriution ssoite with eh moel, we then lulte the ssoite EGFP intensity istriution y omining the orresponing Gussins for whih the mens n SDs were given y the single-moleule lirtion of fluoresene intensity (see Experimentl Proeures n Figure D; see Figure 2 for ll ells groupe together; n see Figure S2A for ells ). We then lulte the numer of lthrin triskelions reruite uring eh of the two events y minimizing the lest-squres ifferene etween the umultive istriution funtions of the lulte EGFP intensity for eh moel, etermine s just esrie, n the experimentlly etermine EGFP mesurements. Seletion of the est moel ws se on the yesin informtion riterion (I) (Jqmn n Dnuser, 26; Shwrz, 978) (see Experimentl Proeures; Figure 2). In the moel tht gve the est fit, 7% of the events (either first or seon step) orrespone to ition of single lthrin triskelion, n ell, 49 7, August 3, 22 ª22 Elsevier In. 497

4 A F. Intensity (.u.) 2K 2K K K K ote pit # ote pit #2 6K 4K 3K K 6 8 F. Intensity (.u.) 2K 2K K K K 6K 4K 3K K I E D # EGFPs K 3K 4K 6K K 3K 4K 6K Figure 2. Reruitment of lthrin uring the Initition Phse of ote Pit Formtion Detete with Single-Moleule Sensitivity (A) Plot of the fluoresene intensity tres uring the formtion of two ote pits ontining lthrin EGFP-L. The t were otine from S ells stly expressing EGFP-L imge y TIRF mirosopy every 7 ms with n exposure of 3 ms per frme. The pnels on the right re expne tres orresponing to the first s uring the lifetime of the ote pits; they show the result of the fit (lk) otine y pplying step-fitting funtion to estimte the verge fluoresene intensity n well time of the first two steps uring the initition phse of the pit. () Distriution of well times of the first n seon steps of lthrin EGFP-L reruitment uring the initition phse of ote pit formtion. Dt from 37 ote pits in five ells. The rk lue line is fit of simple moel se on two rte-limiting moleulr steps. 498 ell, 49 7, August 3, 22 ª22 Elsevier In.

5 the reminer orrespone to ition of two or three triskelions (% % of events eh) (Figures 2 n 2D, I vlues for ll ells omine n Figures S2A n S2 for iniviul ells ). The est fit gve 6% replement of enogenous light hin y L-EGFP (Figure 2 for ll ells n Figure S2D for ells ), whih ws in exellent greement with the experimentl vlue of 6% from onventionl western lot nlysis of lrge pool of ells (Figure S2E). For some other moels, the qulity of the fit ws similr to tht for the est moel (Figure 2, moels ); in these moels, single triskelion lso rrive in 7% of the events, ut the remining events orrespone to vrile rrivl of smll mounts of two or three triskelions (Figure 2E). We otine very poor fits with lultions tht ssume signifintly ifferent reruitment moels or ifferent replement levels (Figure 2 for ll ells groupe together n Figure S2A for ells ). The nlysis thus suggests tht ote pit formtion generlly egins with rrivl of single triskelion t eh of two suessive reruitment steps n tht oinient rrivl (within the 7 ms time resolution of our mesurements) of two or three triskelions n lso our ut with muh lower proility. These initil steps re then followe y more rpi reruitment of mny itionl triskelions. We estlishe the roustness of the nlysis use to etermine how ote pit ssemly strts y performing the lultions just esrie on simulte noisy imge sequenes (movies) orresponing to lthrin reruitment uring ote pit formtion (see Anlytil Vlition in Extene Experimentl Proeures n Figure S3). Reruitment of AP2 to ote Pits Detete with Single-Moleule Sensitivity We investigte reruitment of AP2 tgge with s2-egfp uring initition of ote pit formtion y using the sme pproh with whih we etete the erly rrivl of lthrin (see Movie S2). We use the ell-tthment n TIRF imging onitions esrie ove for the lthrin-reruitment experiments. We reore t from 698 ote pits in six ifferent ells. As for lthrin, we etete two well-efine, stepwise inrements in fluoresene intensity (Figure 3A, two pits shown s exmples), with verge times etween suessive inrements of 2.6 n 2.2 s, respetively. The istriutions for these intervls (Figure 3) were the sme s those for the intervls etween initil lthrin reruitments (Figure 2) (p >.2, step ; p >.2, step 2; Kolmogorov-Smirnov test [KS-test]), initing tht the two proesses re relte. The istriution of well times etween the first reruitment steps of lthrin or AP2 showe rise-n-fll profile tht ws onsistent with more thn one rte-limiting event rther thn following n exponentil ey tht woul e onsistent with single rte-limiting step (see Anlytil Vlition in Extene Experimentl Proeures n lso Figure S4). We use Gussin mixture moel, s ove, to etermine for eh ell the istriution of intensity inrements ssoite with eh of the two reruitment events (Figure 3 for ll ells groupe together n Figure SA for ells 6). There is one s2-egfp per AP2 heterotetrmer, so the istriution of EGFP intensities orrespons iretly to the istriution of tgge omplexes. The istriutions showe strong preferene for two AP2 omplexes per event in the first n seon inrements (Figure 3D, insets, for ll ells groupe together n Figure S for ells 6). We fitte the experimentl AP2 istriution t with reruitment moel similr to the one esrie ove for lthrin triskelions. In the est fit (moel ), two AP2 omplexes rrive together in 8% n 6% of the events in the first n seon steps, n four or six (e.g., two or three pirs) rrive in the remining 2% 4% (Figures 3D n 3E, inset for ll ells groupe together n Figure S for ells 6). We teste lrge numer of other moels, ll of whih gve signifintly poorer fits (Figure 3 for ll ells together n Figure S for ells 6). Moels,,, n e were not very ifferent from eh other, n in every se the ommon feture ws the fvore rrivl of two AP2s. We vrie the egree of enogenous s2 replement y s2-egfp n serhe for the est fit onsistent with the experimentl frequeny istriutions. The lulte replement vlue ws 84% (Figures 3 n 3E for ll ells n Figure SD for ells 6), whih ws in exellent greement with the 8% replement etermine experimentlly y western lot (Figure SE). Anlytil vlition for these proeures is provie in Extene Experimentl Proeures (see lso Figure S6). We further teste the onsisteny of our moels y ing onstrints erive from fitting the lthrin rrivl istriutions (7%, one triskelion; 2%, two n three triskelions, Figure S7). The ltter istriutions yiele goo fit to the AP2 istriutions, giving n estimte tht, uring the initil event, 9% of the triskelions rrive with two oun AP2 omplexes. euse we i not know how mny AP2 were rk (untgge) uring ny speifi step in growth of n iniviul pit, we oul not etermine whether there ws ny orreltion etween the numer of AP2 omplexes (or lthrin triskelions) in the first n seon reruitment events. () Vlue of the I use to etermine the est fit etween the experimentl t n the reruitment moels of lthrin inite t the ottom. The qulity of the fit inreses with more negtive I vlues (see Experimentl Proeures; Shwrz, 978). Eh point ws olor oe oring to the lulte sustitution level of enogenous light hin y the etopilly expresse EGFP-L. The reltive ontriutions of triskelions in moels re presente in (E). (D) The ompile istriution of net fluoresene intensities (fluoresene intensity for given spot minus the fluoresene intensity of the kgroun, in ritrry units) of reruite lthrin EGFP-L ws etermine for the first n seon steps uring the initition phse of ll pits in the five ells nlyze (gry). The ontinuous fluoresene intensity signl (rk lue) is the sum of the reltive ontriutions to the fluoresene signl y the inorportion of one, two, et., EGFP moleules (light lue) tht were otine from the moel with the est I sore (pnel, moel ). For the first step, the moel represents the rrivl of single triskelion in 7% of the events n two n three triskelions in the remining 2% (inset). For the seon step, the moel represents the rrivl of one, two, n three triskelions in 7%, 4%, n 6% of the events, respetively (inset). The lulte extent of enogenous light-hin sustitution for ll ells with EGFP-L ws 6%. (E) Arrivl of triskelions to the first n seon steps of the moels highlighte in (). The gry histogrms show the reltive ontriutions of triskelions reruite in the first n seon steps of lthrin-ote pit formtion for the three moels (,, n ) with I sore losest to the est moel (). The nlyses of the single ells re reporte in Figure S2 for ells. See lso Figures S3 n S7 n Movie S. ell, 49 7, August 3, 22 ª22 Elsevier In. 499

6 A F. Intensity (.u.) K 8K 6K 4K 2K 6 ote pit # ote pit #2 3K K 3K 2K K 6 8 F. Intensity (.u.) 8K 6K 4K 2K 2K K I e E e D # EGFPs K 3K 4K 6K K 3K 4K 6K Figure 3. Reruitment of AP2 uring the Initition Phse of ote Pit Formtion Detete with Single-Moleule Sensitivity (A) Plot of the fluoresene intensity tres uring the formtion of two ote pits ontining AP2 tgge with s2-egfp. The t were otine from S ells stly expressing s2-egfp imge y TIRF mirosopy every 7 ms with n exposure of 3 ms per frme. The pnels on the right re expne tres orresponing to the first s uring the lifetime of the ote pits; they show the result of the fit (lk) otine y pplying step-fitting funtion to estimte the verge fluoresene intensity n well time of the first two steps uring the initition phse of the pit. ell, 49 7, August 3, 22 ª22 Elsevier In.

7 Joint Reruitment of lthrin n AP2 for ote Pit Initition The strong orreltion etween the istriutions of time intervls etween initil steps of lthrin reruitment n AP2 reruitment n the fit of the onstrine moel just esrie oth suggest tht lthrin n AP2 rrive s prtners. We therefore pte our TIRF onfigurtion to imge EGFP n mherry in the sme experiment, thus llowing us to follow reruitment of s2- EGFP n mherry-l to the sme ote pit. We use S ells, stly expressing s2-egfp, tht h een trnsfete 48 hr efore the experiment with plsmi-enoing mherry-l n moifie the mirosope to llow simultneous ul-wvelength exittion n etetion of oth fluorophores. We verifie sene of rosstlk etween the two emitte signls. The two intensities were expresse s reltive vlues to eh other euse mherry photolehes quite rpily, mking it imprtil to otin n solute fluoresene intensity lirtion reltive to single mherry. The representtive tres in Figures 4A n 4 show ler orreltion of fluoresene from lthrin n AP2, prtiulrly uring the erly stge of ot ssemly. The istriution of the ifferene etween times of initil lthrin n AP2 signls is Gussin entere on s, suggesting tht, within the time resolution of our experiments (7 ms), the two speies rrive together (Figure 4). Unertinties in ientifying the eginning of the first step ue to the inherently noisy fluoresene intensity t from ells simultneously expressing s2-egfp n mherry-l re likely to explin the istriution of oserve timing ifferenes euse similr istriutions were otine y using simulte tres generte with the sme signl-tonoise rtio (t not shown). Another potentil soure for the oserve unertinty is oorinte rrivl of untgge AP2 with tgge lthrin or the onverse; the proportion of tgge AP2 woul hve een lower euse of low expression of s2- EGFP in ells trnsiently expressing L-mherry riven y the sme promoter (E.. n T.K., unpulishe t). Role of FHo n FHo2 in ote Pit Initition It hs een propose tht FHo n FHo2 re require for ote pit initition euse pits fil to form in their sene (Henne et l., 2). One line of eviene is sene of AP2-ontining pits on the tthe plsm memrne of ells imge y spinning-isk onfol mirosopy fter epletion of oth FHo n FHo2 y RNA interferene (RNAi) (Henne et l., 2). We reproue this oservtion y using smll hirpin RNA (shrna) with the pulishe epletion protool n the sme s2-egfp-expressing S ells. We onfirme the sene of AP2 punt t the ell surfe n enhne ytosoli AP2 fluoresene kgroun (Figures A n ); the positive ontrol from ells expressing FHo/2 t norml levels showe norml AP2 punt n lower ytosoli kgroun. A quntittive omprison showing loss of ote vesiles in the sene of FHo/2 is shown in Figure. As others hve foun y using spinning-isk onfol imging (Henne et l., 2), we oserve loss of reeptor-meite enoytosis of trnsferrin in ells eplete of oth FHo n FHo2. y using spinningisk onfol imging, we foun tht, in ells lking AP2 punt, Alex647 trnsferrin file to internlize n umulte in enosomes (Figure A). Fluoresene-tivte ell sorting (FAS) nlysis onfirme the prtil loss of trnsferrin uptke in ells sujete to FHo/2 epletion (Figure D). The prtil effet is in line with the extent of protein epletion etermine y western lot nlysis (Henne et l., 2; Nunez et l., 2) n is onsistent with n % effiy of FHo/2 epletion etermine y rel-time quntittive PR (qtpr) (t not shown). The sensitivity of the spinning-isk onfol mirosope is insuffiient, however, to etet the wek fluoresent signls ssoite with smll numer of fluoresent moleules. We therefore use the more sensitive TIRF imging to etermine whether or not FHo/2 re require for AP2 reruitment uring the initil phses of ote pit formtion esrie ove. We foun sustntil reution in the numer of longer-live AP2 spots (lifetimes >2 s) in the FHo/2-eplete ells ut no erese in the numer of shorter-live spots (lifetimes < s) (Figures E n F). The ltter re ortive pits tht fil to proee to omplete ssemly n pinhing. We inlue two negtive ontrols to ensure tht the short-live events re on fie AP2 pits rther thn ollisions of ytosoli AP2 with the plsm memrne. In one experiment, we showe totl sene of AP2 events in ells trete riefly with -utnol (Figures E n F), proeure tht ompletely elimintes formtion of lthrin/ap2-ote pits (ourot et l., 26; Henne et l., 2). In the other, we showe sene of etetle rnom ssoition of EGFP with the plsm memrne in ells expressing ytosoli EGFP rther thn s2-egfp (Figures E n F). () Distriution of well times of the first n seon steps of AP2 s2-egfp reruite uring the initition phse of ote pit formtion. Dt from 698 pits in six ells. The rk lue line is fit of simple moel se on two rte-limiting moleulr steps. () Vlue of the I use to etermine the est fit etween the experimentl t n the reruitment moels of AP2 inite t the ottom. The qulity of the fit inreses with more negtive I vlues. Eh point ws olor oe oring to the lulte sustitution level of enogenous s2 y the etopilly expresse s2-egfp. The reltive ontriutions of AP2 reruitment in moels e re presente in (E). (D) The ompile istriution of net fluoresene intensities (fluoresene intensity for given spot minus the fluoresene intensity of the kgroun, in ritrry units) of reruite AP2 s2-egfp ws etermine for the first n seon steps uring the initition phse of ll pits in the six nlyze ells (gry). The ontinuous fluoresene intensity signl (rk lue) is the sum of the reltive ontriutions to the fluoresene signl y the inorportion of one, two, et., EGFP moleules (light lue) tht were otine from the moel with the est I sore (pnel, moel ). For the first step, the moel represents the rrivl of two AP2 in 7% of the events n four n six AP2 in the remining 2% (inset). For the seon step, the moel represents the rrivl of two, four, n six AP2 in %, 3%, n % of the events, respetively (inset). The lulte extent of enogenous s2 sustitution with s2-egfp ws 84% for ll ells. (E) Arrivl of AP2s to the first n seon steps of the moels e highlighte in (). The gry histogrms show the reltive ontriutions of AP2 reruite in the first n seon steps of lthrin-ote pit formtion for the four moels ( n e) with I sore losest to the est moel (). The nlyses of the single ells re reporte in Figure S for ells 6. See lso Figures S4, S6, n S7 n Movies S2 n S3. ell, 49 7, August 3, 22 ª22 Elsevier In.

8 A We lso use TIRF imging to hrterize the ynmis of pit formtion in S ells overexpressing untgge FHo n stly expressing s2-egfp. Although there ws no signifint inrese in the totl numer of initition events (e.g., AP2 spots with lifetimes >2 s, Figure G), we foun ler inrese in the numer of longer events tht is, those lsting etween n 2 s (Figure H). A frtion of these 2 s events proly represent fully forme ote pits tht ssemle more rpily euse their AP2 ontent ws equivlent to tht of ommitte pits tht took 4 s or more to form. In ition, FHo overexpression le to notiele erese of ortive events lsting etween 2 n s. We onlue tht, lthough FHo/2 re lerly importnt for ensuring growth n ompletion of the ot, they re not essentil for ote pit initition. We propose inste tht the FHo moleules re prt of lrger omplex tht stilizes the ssemling ot, llowing further growth of the lthrin lttie. DISUSSION Figure 4. Reruitment of lthrin n AP2 uring the Initition Phse of the Sme ote Pit (A) Fluoresene intensity tres orresponing to the reruitment of lthrin n AP2 uring the formtion of two ote pits ontining lthrin mherry- L n s2-egfp. The t were otine from S ells stly expressing s2-egfp n trnsiently expressing mherry-l. The ells were imge y TIRF mirosopy with the ul view setup every 7 ms with simultneous exittion of mherry n EGFP using exposures of 3 ms per frme. The tres orrespon to the first 3 s uring the lifetime of the ote pits. () The expne tres show the rw fluoresene signls (light lue, light ornge); the orresponing smoothene plots (rk lue n re) were otine with running verge filter (winow size = 3). The fitte steps (lk) otine y pplying the step-fitting funtion to the rw signls were then use to mesure the well time of the first step n to etermine the ifferene in the rrivl time (Dt) of AP2 n lthrin uring the first step. () Distriution of the ifferene in the rrivl time (Dt) of lthrin mherry-l n AP2 s2-egfp uring the initition step of 83 ote pits from five ells. Our experimentl nlysis of the first s of lthrin-ote pit ssemly les to the following moleulr esription (Figure 6). There re two erly reruitment events tht we n resolve here, followe in rpi suession y itionl reruitment of lthrin n AP2 in steps tht we nnot resolve. The two erly events inlue oth AP2 n lthrin, whih rrive together t the site estine to eome ote pit. The moleulr esription of mjority of the reruitment events (oth first n seon) is one lthrin triskelion n two AP2 omplexes; in smller frtion of the events, two triskelions n four AP2s prtiipte. This esription lerly rules out the lterntive notion inferre from ells prtilly eplete of lthrin tht triskelions ssemle on preforme pth of AP2 (Hinrihsen et l., 26). oorinte Arrivl of One Triskelion n Two AP2 omplexes The most strightforwr explntion of the oserve stoihiometry is tht only if two AP2 omplexes nhor lthrin to the memrne will its lifetime there e long enough to llow susequent ition of more lthrins. This interprettion is onsistent with known properties of the omponents. AP2 ins wekly ut speifilly to lipi ilyers (suh s the plsm memrne) tht ontin PI-4,-P 2 ; lthrin hs no iret memrne ontts. One lttie hs egun to form, lthrin-lthrin ontts will stility n will gretly inrese the men resiene time, oth for lthrin n for the AP2 omplexes it ins. Eh of the two resolvle, erly ition events inlues more thn one rte-limiting moleulr step. The rise-n-fll shpe of the well-time histogrm les to this onlusion, even without speifi moleulr piture. It is not yet ler, however, whih of the steps implie y the stoihiometry just esrie etermine the oserve kinetis. A full nlysis hs require moel tht expliitly inorportes the egree of sustitution of untgge omponents y tgge ones, the istriution of light-hin oupnies, n the istriution of the numer of lthrin trimers tht ontriute to eh event. In the se of lthrin, eh triskelion hs three light hins t equivlent sites oupie rnomly y L n L. 2 ell, 49 7, August 3, 22 ª22 Elsevier In.

9 A Trnsferrin AP2 D E 2 /se ontrol Events/ m G Inititions/ m 2 /se Trnsferrin 647 (F.I..u.) 4 ontrol 3 ontrol ontrol ol %8 % FHo FHo/2 shrna FHo/2 shrna AP2-EGFP (F.I..u.) 4 6 Lifetime (s) Events % %6 %44 ortives ommitte ortives ommitte.6 ontrol FHo/2 shrna utnol Lifetime (s) EGFP H se 2 se F ontrol ontrol FHo/2 shrna Inititions/ m 2 /se ontrol 2% ommitte 2% 4% Aortives 3% % ommitte 3% 3% Aortives 38% 63% Aortives 4% ommitte/ m 2 /se FHo/2 shrna utnol FHo ontrol ** FHo/2 shrna EGFP 2- s -2 s 2- s Figure. Effet of FHo Proteins on ote Pit Initition n Formtion (A) Uptke of Alex 647 trnsferrin (mgent) y S ells stly expressing s2-egfp (green) in the presene n sene of FHo n FHo2. Depletion of FHo/2 ws otine fter 4 y inution with lentivirus enoing short-hirpin interfering RNA sequenes speifi for FHo n FHo2 (FHo/2 shrna). ells were inute for min t 37 with mg/ml Alex 647 trnsferrin n then imge in 3D using spinning-isk onfol mirosopy. The representtive imges orrespon to mximum z projetions from stk of 3 imging plnes spe. mm. Sle r, mm for oth pnels. () Representtive kymogrphs from time series from the ottom tthe surfe of S ells otine y spinning-isk onfol mirosopy. The ells stly expressing s2-egfp were imge in the presene (top) or sene (ottom) of FHo/2. Time series were otine 4 ys fter tretment of the ells with lentivirus enoing srmle or short-hirpin interfering RNA sequenes speifi for FHo n FHo2. Sle r, mm for oth pnels. () Distriutions of the numers of ote pits longer thn 2 s forming in the presene (.23 ±.4 ommitte pits/ mm 2 /s; totl numer of pits = 3,27) n sene (.42 ±.27; totl numer of pits =,39) of FHo/2. Error rs represent ell-to-ell SD; **p < 4, t test. Dt from five ells for eh onition. (D) FAS nlysis to follow the uptke of Alex 647 trnsferrin y S ells stly expressing s2-egfp in the presene (left) n sene (right) of FHo/2. (E) Numer of ote pit events etete y TIRF in the presene n sene of FHo/2, respetively. Time series were otine y imging every 7 ms with n exposure of 3 ms per frme. The numer of ommitte pits (>2 s) ws unerrepresente euse the length of the time series use ws min in urtion. (F) Distriutions of fluoresent spots representing the numer of initition events with urtion longer thn s etete y TIRF mirosopy in S ells stly expressing s2-gfp; s time series were otine y imging every 7 ms with n exposure of 3 ms per frme. The t were otine from ontrol ells expressing norml mounts of FHo n FHo2 (.44 ±.76 inititions/ mm 2 /s; n = 4 ells), from ells eplete of FHo n FHo2 (. 696 ±.23; n = 3 ells), n from ontrol ells riefly expose to -utnol (.89 ±.94; n = 3 ells). The lst r shows the istriution of fluoresent spots etete t the plsm memrne of ells expressing solule ytosoli monomeri EGFP (.34; n = ell). Error rs represent SD. (G) Distriutions of the numers of fluoresent spots representing initition events (>2 s) etete y TIRF mirosopy in S ells stly expressing s2-gfp lone or together with trnsiently expresse FHo. We reore s time series y imging every 7 ms with n exposure of 3 ms per frme. The t were otine oth from ontrol ells expressing norml mounts of FHo/2 (.722 ±.79; n = ells) n from ells trnsiently expressing FHo for 3 ys (.864 ±.26; n = ells). Error rs represent SD. (H) The events etete in (G) were ivie into three groups: those lsting 2, 2, n 2 s. The t re olor oe to ifferentite ortive (full olor) from ommitte pits (stripe), n the lter were selete y their higher mximum fluoresene intensity. Thus, epening on the level of expression of the tgge L, triskelion might hve etween zero n three fluorophores. Our t show isernle rrivl of up to nine EGFPs in eh of the first two events. Assuming stohsti replement of enogenous light hins with the etopilly expresse L- EGFP, we serhe for the est orreltion of oserve n moele inomil frequeny istriutions with the egree of replement s vrile. For lthrin, we foun the est fit with single triskelion in 7% of the events n two or three in the remining 2%, with n overll replement of 6% of the light hins with EGFP-L. For AP2, we etete steps of etween one n four lthrin ptor omplexes n strong preferene for two. A step with single AP2 oul e rrivl of pir with one of the omplexes untgge (i.e., ering enogenous s2). A glol fit with ifferent inomil moels onverge to one in whih two AP2 omplexes rrive together in 8% of ell, 49 7, August 3, 22 ª22 Elsevier In. 3

10 2 3 Figure 6. Propose Moel for Reruitment of lthrin n AP2 uring the First Five Seons of ote Pit Formtion Shemti representtion of the erly events uring initition of ote pit formtion. () AP2 ins wekly to PI-4,-P 2 ontine in the plsm memrne, leing to rpi ssoition n issoition. lthrin hs no ffinity for the memrne, n intertions etween lthrin n single AP2 re lso too wek to form stle omplex. (2) The first reognizle event oorinte ining of lthrin triskelion to two ~ 2 se memrne-nhore AP2s; the two nhor points stilize the resulting omplex n inrese its resiene time t the memrne. (3) The inrese resiene time of the triskelion/ap2 omplex results in the seon resolvle event, inorportion of further uiling lok, typilly onsisting of one triskelion oun to two AP2s. In smll proportion of ses (3%), the inorportion rte of seon triskelion/ap2 omplex is fster thn the temporl resolution of t quisition (7 ms), resulting in the omine moel of 7% one triskelion/2 AP2 + 3% two triskelions/4 AP2 in steps one n two. The essory proteins FHo n FHo2 re not involve in the initil two stepsof ssemly. the events n four or six AP2 omplexes in the rest, with out 8% overll replement of enogenous s2 y s2-egfp. We foun no eviene for prelustering of AP2 efore rrivl of lthrin. The moels for lthrin n AP2 reruitment yiel replement levels in exellent greement with the vlues mesure iretly y western lots from poole-ell extrts. Moreover, when we onstrin the AP2 reruitment moel y the est fit of the lthrin moel 7% of the events with single triskelion n 2% with two or three n llow eh triskelion to rrive with one, two, or three ssoite AP2 omplexes, the est fit onverges to strong preferene for two AP2s per step n to essentilly the sme replement vlues s in the unonstrine lultion. We further vlite the nlytil metho use to etermine the first steps of lthrin n AP2 reruitment leing to ote pit formtion y showing tht the metho returne the sme vlues s those input to moels use to generte movies simulting ote pit formtion. Single-moleule sensitivity in our mesurements hs een ritil for the roustness of the moeling just esrie n for the exellent greement the moels yiel with experimentlly etermine replement levels of enogenous y tgge omponents. To hieve single-moleule etetion in live-ell imging without resorting to quntum ots or other lrge lusters of fluorophores (Howrth et l., 28; Howrth n Ting, 28), we neee to mke numer of improvements in ell hnling, mirosope hrwre, n t nlysis. Atthing ells to lyer of iotinylte fironetin rige y viin to oting of iotinylte PEG llowe ess to the ell surfe fing the overslip, minimize kgroun, n essentilly eliminte formtion of ote plques. Improvements in temperture ontrol n z xis stility of the mirosope stge n use of TIRF illumintion from n intense n stle lser soure hve llowe us to reor signls from single EGFP moleules tht re 3 ±.7 SDs ove ellulr kgroun in 3 ms exposures (lultion one y using the AP2 t from ll six ells). The orresponing sttistil signifine (p >.8 ±.3, t test) inreses if susequent time points hve mesurle signl for the sme ojet (p <. fter 2 ± frmes). Moreover, rpi reoring 7 ms intervls in our work enhnes the stringeny of the riteri we n pply for the mximum isplement etween frmes n the minimum numer of frmes in whih the ojet ppers. lirtion of the fluoresene intensity y photolehing of immoilize EGFP llowe us to mke iret orresponene etween signl strength n numer of moleules ontriuting to ny event we etete. FHo n FHo2 Are Not Essentil to Initite ote Pit Formtion The experiments esrie here illustrte the importne of imging with single-moleule sensitivity when stuying proesses, suh s initition of ssemly, tht involve very smll numer of omponents n the stohstiity tht smll numers inevitly imply. Aess to informtion out the istriution of moleulr ontriutions to the events eing nlyze vois miguities inherent in ensemle mesurements n isolte snpshots. Our renlysis of the effet of lting FHo/2 or overexpressing FHo shows tht methos (suh s spinning-isk onfol imging with onventionl illumintion) requiring extrpoltion from lter time points n stronger signls my le to inorret inferene. FHo/2 re lerly neessry for ote pit ssemly n lthrin-meite enoytosis of trnsferrin (Henne et l., 2), ut we hve shown tht knokown of these omponents oes not ffet initition. Inste, we fin tht normlly initite ote pits ort in the sene of FHo/2 n tht frtion of ote pits ssemle even fster thn usul in the presene of lrge mounts of FHo. We propose tht FHo/2 re prt of omplex tht stilizes the nsent ote pit n permits or filittes ontinue growth. When FHo is overexpresse, the frtion of fully forme ommitte ote pits inreses, n often they ssemle more rpily, with notiele erese of ortive events. When FHo proteins re missing, ote pits ort ssemly, typilly 2 2 s fter rrivl of the initil lthrin n AP2s. The verge lifetime of ote pits in the S ells stuie here is 4 6 s; one pit ssemly hs initite, lthrin s t reltively stey rte, so tht 2 2 s woul orrespon to pit with roughly hemispheril ot. The ritil stge t whih FHo/2 n their prtners re essentil for ot ssemly is therefore ner the point t whih the invginte memrne strts to onstrit. We hve shown reently tht 4 ell, 49 7, August 3, 22 ª22 Elsevier In.

11 pits forming on memrnes uner tension require resue t this stge (y tin polymeriztion) euse the net free energy of memrne eformtion egins to inrese s onstrition proees (oulnt et l., 2). Thus, y stilizing the growing ot, the FHo proteins n their prtners oul llow ontinue growth to overome inresing memrne resistne. The mehnism oul involve stilizing urve memrne or reinforing the lthrin lttie. The FHo proteins ssoite with intersetin, epsin, n Eps (Henne et l., 2). They hve n F-AR omin, whih ssoites preferentilly with urve memrnes; the epsin N-terminl homology (ENTH) omin hs similr preferene. Eps, Epsin, n FHo proteins re present seletively t the rim of n ssemling ot (Henne et l., 2; Sffrin et l., 29; Ter et l., 996). FHo/2 n epsin might therefore stilize ilyer urvture s the pit invgintes or simply reognize memrne urvture s prt of mehnism tht stilizes (iretly or iniretly) the lthrin ot itself. Moel for ote Pit Initition The oserve reruitment kinetis suggests the following moel for ssoition of lthrin n AP2 in ote pit initition (Figure 6). ytosoli AP2s re onstntly smpling memrnes. Assoition of AP2 n PI-4,-P 2 t speifi site on the -suunit fvors pture of AP2 t the plsm memrne, ut the ffinity for the lipi he group is reltively wek, n the resiene time, in the sene of further intertion, is proly muh less thn s. A single lthrin-ap2 ontt or single AP2-memrne-rgo protein ssoition is lso wek n omprly short live. If, however, memrne-ssoite AP2 ins lthrin triskelion tht reruits or rings with it n itionl AP2, whih n ssoite with seon PI-4,-P 2 in the memrne, the three-omponent luster (one triskelion n two AP2 omplexes) will then hve muh longer memrne resiene time. We propose tht this sort of luster esries the most prole initil moleulr omplex, whih is stle (in generl) for the.7 s require for reruitment of seon lthrin. euse single lthrin-lthrin intertion is wek (Fotin et l., 24), stle ssoition of the seon lthrin will in most ses lso require tht it hve two oun AP2 omplexes. The stility n multiple vlenies of the resulting struture will then permit numer of lterntive moleulr steps e.g., reruitment of ytosoli lthrin with no oun AP2s, reruitment of n itionl AP2 to one of the unoupie terminl omins, et. Our esription of initition is n verge of most prole sets of steps, not proposl for unique moleulr sequene. Our moel inlues three entrl prtiipnts: AP2, PI-4,-P 2, n lthrin. A ruil role for PI-4,-P 2 follows from our oservtion tht loss of this phosphoinositie from the plsm memrne fter ute tretment of ells with -utnol prevents formtion of ny new ote pits. Our erlier work (ourot et l., 26, 2) n tht of others (Henne et l., 2; von Kleist et l., 2) hs shown tht ote pits re sent in ells eplete of PI-4,-P 2 ; our urrent t show tht even the initil moleulr reruitment steps fil to our. We lso see no eviene for ssoition of lthrin-free AP2 with sorting motifs on the ytosoli extensions of memrne-resient rgo, s this intertion, together with ining of PI-4,-P2, woul gretly inrese the resiene time of lthrin-free AP2, whih is ontrry to our oservtions. Assoition with lthrin tivtes AP2, swithing the m2 suunit into its open onformtion (Rpoport et l., 997) n enhning the likelihoo of rgo pture one ot ssemly is unerwy. This mehnism is onsistent with oservtions tht show pture of LDL (Ehrlih et l., 24), trnsferrin (E.. n T.K., unpulishe t), n severl types of viruses (ureton et l., 22; Ehrlih et l., 24) to previously initite ssemling pits, rther thn rgoinue initio pit formtion. We hve tgge with fluoresent reporters only the lthrin n AP2 omponents of ot. Other proteins oul, in priniple, prtiipte in the initition steps we hve followe. The most importnt mehnisti reson for speifi heterologous inititor of ny ssemly proess is to gurntee inlusion of prtiulr omponent. Susequent reruitment steps n lso hve this funtion, however. We hve rule out requirement for FHo/2 s inititors, showing inste tht they prevent ssemly from orting fter 2 s; they oul therefore iret inorportion of further omponents essentil for lter events, suh s fusion of the unote vesile with trget memrne. We note tht moel invoking stohsti initition, followe y moleulr ssoitions tht ommit the ot to omplete its ssemly, is more onsistent with the lrge oy of oservtions tht hve umulte sine our erly live-ell imging stuies (Ehrlih et l., 24) thn is moel invoking heterologous inititor. EXPERIMENTAL PROEDURES ell iology All of the proeures use for ell iologil mnipultions re esrie in etil in the Extene Experimentl Proeures. Visuliztion n Imge Anlysis Smples were visulize y using TIRF mirosopy with single-moleule EGFP etetion n high temporl resolution or spinning-isk onfol fluoresene mirosopy with high temporl resolution. ote pits were etete n trke y using the u-trk softwre (Jqmn et l., 28). The ojets thus selete were nlyze further y using itionl softwre written in Mtl (Mthworks, Ntik, MA). We only onsiere for nlysis those ojets whose fluoresene intensity inrese with time, ppere fter the time series strte, move less thn.6 mm/frme long the x n y xis (the verge of the movement ws.4 pixel/frme, n the mein ws.28 pixel/frme), n i not ollie with other fluoresent ojets. Fluoresene intensity tres uring the first s of lthrin or AP-2 reruitment thus otine were fitte y using step etetion funtion (Smith, 998) to efine the intensity n the well time of the moleule inorportion t the nsent ote pits. To quntify protein reruitment, the umultive istriutions of intensities of the first n seon steps of ote pit formtion for ll pits in eh ell were together fitte with moel inorporting ifferent omintions of protein reruitment s well s the extent of sustitution in the ell, i.e., the proility q of fluoresent moleule eing inorporte. Detile proeures, inluing simultions, re esrie in the Extene Experimentl Proeures. SUPPLEMENTAL INFORMATION Supplementl Informtion inlues Extene Experimentl Proeures, seven figures, n three movies n n e foun with this rtile online t ell, 49 7, August 3, 22 ª22 Elsevier In.

12 AKNOWLEDGMENTS This work ws supporte y NIH grnt GM-722 (T.K.), GlxoSmithKline Fellowship (E..), Swiss Ntionl Siene Fountion fellowship (F.A.) n prtil support from NIH grnt GM-736 (to G. Dnuser, Hrvr Meil Shool) (F.A.), n Hrvr Digestive Disese onsortium Fesiility Awr (S..). We thnk E. Mrino (supporte y NIH grnt U4 AI79, New Engln Regionl enter of Exellene in ioefense n Emerging Infetious Diseses) for mintining the imging resoures, G. Finly for qtpr etermintions, Jnet Iws for the grphil strt, n S.. Hrrison for eitoril ssistne. We grtefully knowlege G. Dnuser, K. Jqmn, S.. Hrrison, n memers of the Kirhhusen l for thought-provoking isussions. E.. n T.K. esigne experiments; E.. n S.. performe experiments; E.. n F.A. esigne n implemente the omputtionl methos; n E.. n F.A. nlyze t. E.., F.A., n T.K. isusse the results n ontriute to the finl mnusript. Reeive: August 27, 2 Revise: Jnury 2, 22 Aepte: My 3, 22 Pulishe: August 2, 22 REFERENES Antonesu,.N., Aguet, F., Dnuser, G., n Shmi, S.L. (2). Phosphtiylinositol-(4,)-isphosphte regultes lthrin-ote pit initition, stiliztion, n size. Mol. iol. ell 22, öking, T., Aguet, F., Hrrison, S.., n Kirhhusen, T. (2). Singlemoleule nlysis of moleulr isssemlse revels the mehnism of Hs7-riven lthrin unoting. Nt. Strut. Mol. iol. 8, ourot, E., Sffrin, S., Mssol, R., Kirhhusen, T., n Ehrlih, M. (26). Role of lipis n tin in the formtion of lthrin-ote pits. Exp. ell Res. 32, ourot, E., Sffrin, S., Zhng, R., n Kirhhusen, T. (2). Roles of AP-2 in lthrin-meite enoytosis. PLoS ONE, e97. oulnt, S., Kurl,., Zeeh, J.., Uelmnn, F., n Kirhhusen, T. (2). Atin ynmis ountert memrne tension uring lthrin-meite enoytosis. Nt. ell iol. 3, ureton, D.K., Hrison,.E., oui, E., Prrish,.R., n Kirhhusen, T. (22). Limite trnsferrin reeptor lustering llows rpi iffusion of nine prvovirus into lthrin enoyti strutures. J. Virol. 86, Ehrlih, M., oll, W., Vn Oijen, A., Hrihrn, R., hnrn, K., Niert, M.L., n Kirhhusen, T. (24). Enoytosis y rnom initition n stiliztion of lthrin-ote pits. ell 8, 9 6. Ferguson, S.M., Rimoni, A., Prise, S., Shen, H., Meski, K., Ferguson, A., Desting, O., Ko, G., Tkski, J., remon, O., et l. (29). oorinte tions of tin n AR proteins upstrem of ynmin t enoyti lthrin-ote pits. Dev. ell 7, Fotin, A., heng, Y., Sliz, P., Grigorieff, N., Hrrison, S.., Kirhhusen, T., n Wlz, T. (24). Moleulr moel for omplete lthrin lttie from eletron ryomirosopy. Nture 432, Girov, I., Sntini, F., Wrren, R.A., n Keen, J.H. (999). Sptil ontrol of ote-pit ynmis in living ells. Nt. ell iol., 7. Goomn, O.., Jr., Krupnik, J.G., Sntini, F., Gurevih, V.V., Penn, R.., Ggnon, A.W., Keen, J.H., n enovi, J.L. (996). et-rrestin ts s lthrin ptor in enoytosis of the et2-renergi reeptor. Nture 383, Gottfrie, I., Ehrlih, M., n Ashery, U. (29). HIP exhiits n erly reruitment n lte stge funtion in the mturtion of ote pits. ell. Mol. Life Si. 66, Hrrison, S.., n Kirhhusen, T. (2). Struturl iology: onservtion in vesile ots. Nture 466, Henne, W.M., ourot, E., Meineke, M., Evergren, E., Vllis, Y., Mittl, R., n MMhon, H.T. (2). FHo proteins re nuletors of lthrin-meite enoytosis. Siene 328, Hinrihsen, L., Meyerholz, A., Groos, S., n Ungewikell, E.J. (26). ening memrne: how lthrin ffets uing. Pro. Ntl. A. Si. USA 3, Howrth, M., n Ting, A.Y. (28). Imging proteins in live mmmlin ells with iotin ligse n monovlent streptviin. Nt. Proto. 3, Howrth, M., Liu, W., Puthenveetil, S., Zheng, Y., Mrshll, L.F., Shmit, M.M., Wittrup, K.D., weni, M.G., n Ting, A.Y. (28). Monovlent, reue-size quntum ots for imging reeptors on living ells. Nt. Methos, Jqmn, K., n Dnuser, G. (26). Linking t to moels: t regression. Nt. Rev. Mol. ell iol. 7, Jqmn, K., Loerke, D., Mettlen, M., Kuwt, H., Grinstein, S., Shmi, S.L., n Dnuser, G. (28). Roust single-prtile trking in live-ell time-lpse sequenes. Nt. Methos, Kirhhusen, T. (29). Imging enoyti lthrin strutures in living ells. Trens ell iol. 9, Lee, D.W., Wu, X., Eisenerg, E., n Greene, L.E. (26). Reruitment ynmis of GAK n uxilin to lthrin-ote pits uring enoytosis. J. ell Si. 9, Loerke, D., Mettlen, M., Yrr, D., Jqmn, K., Jqmn, H., Dnuser, G., n Shmi, S.L. (29). rgo n ynmin regulte lthrin-ote pit mturtion. PLoS iol. 7, e7. Loerke, D., Mettlen, M., Shmi, S.L., n Dnuser, G. (2). Mesuring the hierrhy of moleulr events uring lthrin-meite enoytosis. Trffi 2, Mssol, R.H., oll, W., Griffin, A.M., n Kirhhusen, T. (26). A urst of uxilin reruitment etermines the onset of lthrin-ote vesile unoting. Pro. Ntl. A. Si. USA 3, MMhon, H.T., n ourot, E. (2). Moleulr mehnism n physiologil funtions of lthrin-meite enoytosis. Nt. Rev. Mol. ell iol. 2, Merrifiel,.J., Felmn, M.E., Wn, L., n Almers, W. (22). Imging tin n ynmin reruitment uring invgintion of single lthrin-ote pits. Nt. ell iol. 4, Mettlen, M., Loerke, D., Yrr, D., Dnuser, G., n Shmi, S.L. (2). rgo- n ptor-speifi mehnisms regulte lthrin-meite enoytosis. J. ell iol. 88, Miller, S.E., Shlener, D.A., Grhm, S.., Höning, S., Roinson, M.S., Peen, A.A., n Owen, D.J. (2). The moleulr sis for the enoytosis of smll R-SNAREs y the lthrin ptor ALM. ell 47, 8 3. Nunez, D., Antonesu,., Mettlen, M., Liu, A., Shmi, S.L., Loerke, D., n Dnuser, G. (2). Hotspots orgnize lthrin-meite enoytosis y effiient reruitment n retention of nuleting resoures. Trffi 2, Rpoport, I., Miyzki, M., oll, W., Dukworth,., ntley, L.., Shoelson, S., n Kirhhusen, T. (997). Regultory intertions in the reognition of enoyti sorting signls y AP-2 omplexes. EMO J. 6, Reier, A., rker, S.L., Mishr, S.K., Im, Y.J., Mlono-áez, L., Hurley, J.H., Tru, L.M., n Wenln,. (29). Syp is onserve enoyti ptor tht ontins omins involve in rgo seletion n memrne tuultion. EMO J. 28, Sffrin, S., oui, E., n Kirhhusen, T. (29). Distint ynmis of enoyti lthrin-ote pits n ote plques. PLoS iol. 7, e9. Shwrz, G. (978). Estimting the imension of moel. Ann. Stt. 6, Smith, D.A. (998). A quntittive metho for the etetion of eges in noisy time-series. Philos. Trns. R. So. Lon. iol. Si. 33, Tylor, M.J., Perris, D., n Merrifiel,.J. (2). A high preision survey of the moleulr ynmis of mmmlin lthrin-meite enoytosis. PLoS iol. 9, e64. 6 ell, 49 7, August 3, 22 ª22 Elsevier In.

13 Ter, F., Sorkin, T., Sorkin, A., Erisson, M., n Kirhhusen, T. (996). Eps is omponent of lthrin-ote pits n vesiles n is lote t the rim of ote pits. J. iol. hem. 27, Toshim, J.Y., Toshim, J., Kksonen, M., Mrtin, A.., King, D.S., n Druin, D.G. (26). Sptil ynmis of reeptor-meite enoyti trffiking in uing yest revele y using fluoresent lph-ftor erivtives. Pro. Ntl. A. Si. USA 3, Tru, L.M. (29). lthrin outure: fshioning istintive memrne ots t the ell surfe. PLoS iol. 7, e92. von Kleist, L., Sthlshmit, W., ulut, H., Gromov, K., Puhkov, D., Roertson, M.J., MGregor, K.A., Tomilin, N., Pehstein, A., hu, N., et l. (2). Role of the lthrin terminl omin in regulting ote pit ynmis revele y smll moleule inhiition. ell 46, Yu, A., Rul, J.F., Tmi, K., Hr, Y., Vil, M., He, X., n Kirhhusen, T. (27). Assoition of Dishevelle with the lthrin AP-2 ptor is require for Frizzle enoytosis n plnr ell polrity signling. Dev. ell 2, Zonu, R., Perer, R.M., Sestin, R., Nktsu, F., hen, H., ll, T., Ayl, G., Toomre, D., n De milli, P.V. (27). Loss of enoyti lthrin-ote pits upon ute epletion of phosphtiylinositol 4,-isphosphte. Pro. Ntl. A. Si. USA 4, ell, 49 7, August 3, 22 ª22 Elsevier In. 7

14 Supplementl Informtion EXTENDED EXPERIMENTAL PROEDURES Regents Mouse monolonl ntioies ginst lthrin hevy hin, lthrin light hin n the et 2 suunit of AP-2 were proue in our lortory from hyrioms X22 (rosky, 98), ON. (Näthke et l., 992) n 42 A (lirmont et l., 997), respetively. The rit polylonl ntioy ginst the s2 suunit of AP2 ws purhse from Am (mrige, MA). HRP-onjugte seonry ntioies to revel either mouse or rit primry ntioies were purhse from GE Heltre (Little hlfont ukinghmshire, UK). Plsmis expressing EGFP-L n mherry-l were me y fusing EGFP or mherry to the N-terminus of rt rin lthrin light hin in pegfp or pmherry vetors (lonteh, MountinView, A); the rt s2 suunit of AP-2 ws fuse to the N-terminus of egfp (s2-egfp) in pegfp (Ehrlih et l., 24). The plsmis enoing poly-hystiine tgge EGFP (EGFP-6his) n untgge Fho were kin gifts of Mssimo Merighi n Linton Tru. hemils were purhse from Sigm-Alrih (St. Louis, MO) unless speifie otherwise. Glss overslip Preprtion Glss overslips (#., Wrner Instruments, Hmen, T) were lene y sonition (rnson, Dnury, T) for 3 min first in filtere ethnol n then in M queous NOH in eionize Milli-Q (Millipore, illeri, MA) filtere wter. overslips were wshe in wter etween the sonition steps. The overslips were then rinse in ethnol n rie t 2. lene overslips were expose to ir plsm insie glow ishrge unit (Eletron Mirosopy Siene, Htfiel, PA) operte t ma for 3 min. The overslips were ote with o-polymer ompose of poly-l-lysine (PLL) n iotinylte poly(ethylene glyol) (PEG) (Susos AG, PLL(2)-g[3.4]-PEG(2)/PEG(3.4)-iotin [2%]) issolve in PS ( mg/ml), s esrie in öking et l. (2). riefly, 6 ml of the PLL-PEG solution ws snwihe etween two lene overslips n inute in humi hmer t room temperture for hr. The PEG moifie overslips were rinse with eionize wter n store ry uner reue pressure for up to 2 weeks. Prior to use, the PEG moifie overslips were inute for 3 min with solution ontining streptviin (.2 mg/ml) in PS ontining.2% Tween-2. Exess streptviin ws remove y rinsing with eionize wter. These overslips were use to pture n then imge single moleules of iotinylte EGFP moleules y TIRF mirosopy. Alterntively, these overslips were ote with iotinylte fironetin to rete support for ells to tth n spre prior to their imging y TIRF mirosopy. In this se, the overslips were inute for min in solution ontining nm iotinylte fironetin n.2% Tween 2 in PS. Exess fironetin ws remove y severl wshes with PS, then sterilize in 7% ethnol for min, wshe twie with ell ulture meium n immeitely use to plte ells. ell Hnling ells were grown t 37 n % O 2 in DMEM supplemente with 2 mm L-glutmine, % fetl ovine serum, U ml peniillin n streptomyin. Single S ells stly expressing EGFP-L or s2-egfp were lone to otin homogeneously expressing ells. 4x 4 S ells were ple on fironetin-ote funtionlize overslips n imge 2 to 24 hr fter plting. In the experiments esigne to evlute the ifferentil rrivl of AP-2 n lthrin, S ells stly expressing s2-egfp were trnsfete with plsmi DNA enoing mherry-l n imge 48 hr fter trnsfetion. For the FHo/2 epletion experiments, -2x 4 S s2-egfp ells were seee on non-funtionlize lene overslips n imge 96 hr fter trnsution with lentiviruses enoing srmle or FHo/2 speifi shrnas. Protein Proution n iotinyltion EGFP-6His ws expresse in E. oli strin L2 grown in L meium ontining mg/l mpiillin t 37 with onstnt shking (2 rpm) up to n optil ensity of.6 t 6 nm. After inution with. mm IPTG for 3 hr t 37, the ells were hrveste y entrifugtion (Sorvll R3 rotor, rpm, min, 4 ) n resuspene in ie-ol lysis uffer (2 mm imizol,.2 M Nl, mm EDTA, in PS) in the presene of protese inhiitor oktil (Rohe Applie Siene, Ininpolis, IN). The resuspene ells were sonite for min on ie (Flt tip t 2% power, Ultrsoni proessor XL; Het Systems, Frmingle, NY). The ell eris ws pellete y high-spee entrifugtion (ekmn oulter 4Ti, 4 rpm, 4 min, 4 ), n the protein elute from Tlon Metl ffinity resin (lonteh, Mountin View, A) with 2 mm imizole in PS to finl onentrtion of. mm. Fironetin (Sigm Alrih, St. Louis, MO) ws suspene in PS t finl onentrtion of.2 mm. oth proteins were iotinylte t room temperture t molr rtio of : with NHS-L-iotin (Piere, Rokfor, IL) for hr, followe y ilysis (Slie-A-Lyzer, mini ilysis unit; ut off: 4 Dltons, Thermo sientifi, rrington, IL) t 4 ginst filtere PS. iotinylte EGFP n fironetin were store in the presene of 2% glyerol t 8 n 2, respetively. Immunopreipittion n Western lotting S ells stly expressing either EGFP-L or s2-egfp, were wshe 3 times in PS n soluilize t 4 in lysis uffer ( mm HEPES ph7.4, mm Nl, mm Mgl 2, mm EGTA, % glyerol n % Triton X-) with protese inhiitor oktil (Rohe, rnfor, T). Nulei were remove y low spee entrifugtion (8 g, min, 4, entrifuge 47R, Eppenorf, ell, 49 7, August 3, 22 ª22 Elsevier In. S

15 Huppge, NY). The protein onentrtion of the superntnt (totl lyste) ws etermine using the A ssy (Piere, Rokfor, IL). Immunopreipittion ws one using mg of ntioy e to mg of totl lyste for 3 hr, followe y the ition of 2 ml of % G-Sephrose es (GE Helthre, ukinghmshire, UK) pre-wshe for 3 min in Tris uffer sline (TS: 2 mm Nl,.% Tween 2 n mm Tris, ph 7.4). Totl lystes (2 ml, 4 mg) were pre-lere for 3 min with 3 ml of % w/w G-Sephrose es. The es were remove y rief entrifugtion n the lyste inute for 3 hr t 4 with 4 mg of the monolonl ntioies, X22 ginst lthrin hevy hin or 42 A ginst /2 ptin. This inution ws followe y ition of 8 ml % G-Sephrose es for 2 hr; the es were pellete t 8 g, wshe three times in lysis uffer n twie in TS. oun proteins were nlyze y SDS-PAGE n Western lotting. Eletrophoreti trnsfer to nitroellulose memrnes (Whtmn, Springfiel Mill, UK) from non-fixe gels ws rrie t 22 ; the nitroellulose memrne ws then trete for hr with % nonft ry milk in TS, followe y inution for 3 hr with the pproprite primry ntioies ilute in PS with 3% SA, followe y five min wshes with TS n finl inution for hr with mg/ml of the pproprite HRP-onjugte seonry ntioy (Amershm iosienes). After extensive wshes with TS, the memrnes were imge with Ls 3 system (Fujifilm, Logn, UT) using the enhne hemiluminesene Western lotting Detetion regent (Amershm iosienes). Trnsfetions, Virus Proution, n Trnsution Trnsient expression of mherry-l or of Fo ws hieve y trnsfetion (Invitrogen, rls, A)..4 mg of plsmi DNA enoing for mherry-l or 2 mg enoing for FHo together with.2 mg enoing for mherry (to help ientify the ells expressing FHo) were ilute in ml Optimem (GIO, Lngley, OK) n omine for 3 min t room temperture with solution of 2 ml of Lipofetmine 2 (Invitrogen, rls, A) ilute in ml Optimem. The mixture ws then e to. ml of Optimem on top of S s2-egfp ells (4 3 4 ) previously plte in 2.8 m-imeter plsti well. After 4 hr, the Optimem solution ws reple with stnr ell ulture meium. Depletion of FHo n FHo2 ws hieve y lentivirus-se shrna-meite gene silening. Three short hirpin interfering RNA sequenes speifi for FHo n three for FHo2 were inorporte into the lentivirus vetor plko. (Agene, mrige, MA), to generte six viruses. The forwr oligonuleotie sequenes for FHo were: GGAAAGATTTGGTAAATTGAGATGTTGAGAGAA GTTTTGTTTTTG; GGGAGGAAGGATGAAAGTTTTGAGAAAGTTTATGTTTGTTTTTG; n GGGAGGT GATGAGGAATTTAATGAGTTAAATTTATGATGTTTTTG. The forwr oligonuleotie sequenes for FHo2 were: GGGTAAGTATTAAAAGAAATGAGTTTTGGTTTAATAT GTAGTTTTTG; GGGAAGAAAAGTAAAGTTATTGAGATGAGATTTATTGTTTTTTTTTG; n GGGTGAAT ATAAAGTATGAGTATGTTGGAGTATTGGAGTTTTTG. Lentivirus stoks were prepre y otrnsfetion of 293T ells with the plsmis pmv-r8.74pspax2 (oing for gg, pol n rev genes) n pvsv-g (lonteh, Mountin View, A) n the moifie plko- plsmi ontining the FHo/ 2 shrna sequenes. ell superntnts were hrveste fter 72 hr, filtere with.4 mm filter, n store t 8. Lentivirus titers were estimte using the GoStix Lentivirus titrtion kit (lonteh, Mountin View, A). S- ells ( 3 6 ) stly expressing s2-egfp plte in 3 mm in imeter plsti ishes were infete with the 6 shrna enoing lentiviruses, eh t finl MOI of. The extent of protein epletion ws etermine y Western lot nlysis four ys post-infetion. The effet of protein epletion on ote pit ynmis ws etermine y TIRF n spinning isk onfol mirosopy n the effet on min uptke of mg/ml Alex 647 humn trnsferrin (Moleulr Proes, Invitrogen) in single ells ws etermine y spinning isk onfol mirosopy n of trnsferrin uptke in popultions of, ells y flow ytometri nlysis (FASliur, D iosienes) (oulnt et l., 2). Live-ell Imging n Fluoresene lirtion Glss overslips with plte ells were wshe with sterile PS, ple in n open perfusion hmer n overe with prewrme Minimum Essentil Meium lph without phenol re (GIO, Lngley, OK). The hmer ws inserte into Peltier-temperture ontrolle smple holer mintine in humiifie environment t % O 2 (2/2 Tehnology, Wilmington, N) kept t 37 ple on the mirosope stge enlose y n environmentl hmer kept t Spinning isk onfol fluoresene mirosopy ws one using using Mrin TD system me of omputer-ontrolle inverte mirosope (Axiovert 2M, rl Zeiss, Thornwoo, NY) equippe with 63x ojetive (Pln-Apohromt, NA.4, Zeiss), spinning isk onfol he (SU-XI, Yokogw Eletri orportion, Sugr Ln, TX) n spheril errtion orretion system (Infinity Photo-Optil, ouler,o). Exittion light ws provie y 488 nm soli-stte lser (Sphire, mw, oherent In, Snt lr, A) ouple to n ousto-optil tunle filter. Imges were otine with ms exposures t. Hz rte using oole D mer (QuntEM, 2S, Photometris, Tuson, AZ) uner ontrol of Slieook quisition softwre (Intelligent Imging Innovtions). TIRF (totl internl refletion fluoresene) mirosopy imges were quire using Mrin TD system se on n Axiovert 2M mirosope equippe with n Alph Pln-Apo x ojetive (.46 NA, rl Zeiss), TIRF slier with mnul ngle n fous ontrols (rl Zeiss) n spheril errtion orretion system (Infinity Photo-Optil) (öking et l., 2). The iniene ngle of the exittion light on the overslip ws juste to generte n evnesent fiel with penetrtion epth of -2 nm s esrie in Sffrin n Kirhhusen (28). Soli-stte lsers were use for exittion t 488 nm (Sphire, mw, oherent S2 ell, 49 7, August 3, 22 ª22 Elsevier In.

16 In, Snt lr, A) n 6 nm (Jive, mw, oolt A, Soln, SE). The exittion light ws ouple through n ousto-optil tunle filter into single moe optil fier, rrie to the TIRF slier n reflete into the ojetive using multi-n ihroi mirror (Di-R4/488/6/63, Semrok, Rohester, NY). Emission light ollete y the ojetive psse the ihroi mirror n multi-n emission filter (FF-466/23/6/677, Semrok, Rohester, NY). For simultneous ul wvelength etetion, the emission filter ws sustitute with the orresponing filters (FF-2/3 for EGFP n FF-63/69 for mherry, Semrok, Rohester, NY) ple in ul view unit (DV2, Photometris, Tuson, AZ). Unless speifie otherwise, the time series were quire t. Hz with n exposure time 3 ms per frme. The pixel sizes orrespone to.8 n. mm in ojet spe in the TIRF n spinning isk onfol systems, respetively. iotinylte EGFP-6His were pture on PEG moifie overslip ote with streptviin n lehe y ontinuous TIRF illumintion n imge with ms exposure per frme. Single iffrtion-limite spots were ientifie (öking et l., 2) n their fluoresene intensity profiles etermine y summing the intensities in 7x7 pixel region entere on the spot sutrte from the lol kgroun. The fluoresene intensity tres were fitte with the step fitting funtion n the intensity of single EGFP moleule orrespone to the loss of signl from one photolehing step. The verge n stnr evition of these mesurements (m n s) were otine y fitting norml istriution. A similr proeure ws use to etermine the mplitue of the photolehing step from EGFP-L (oun to triskelions) or s2-egfp (oun to AP2) expresse in S ells n iretly oun to the overslip from ytosol ilute in PS. ells sujete to fst imging (.Hz) uner TIRF illumintion were susequently imge with slower quisition rte (.Hz) to onfirm tht lthrin ote pit formtion ws not ffete y strong lser illumintion. The lifetime of ote pits etermine y TIRF on the ottom surfe using low quisition rte (. Hz) were 4 ± 4 s (men n stnr evition) in ontrol ells n 42 ± s fter quisition of the s time series quire t the high imging rte of. Hz. The numer of initition events etermine t the slow quisition rte efore the fst time series ws.4 ±.8 essentilly ientil to the numer.3 ±. pits/ mm 2 /s, reore uring the fst time series. These results onfirm tht the experimentl esign se on high rte of t quisition tht we use to etet the initition step i not ffet the ynmis of ot formtion. Imge Anlysis ote pits were etete n trke using the u-trk softwre (Jqmn et l., 28; etetion prmeters use: psfsigm, ; integwinow, ; lphlomx,.2; numsigmiter, 3). For the TIRF time series, the trking ws onstrine to () retin only those ojets present in t lest onseutive frmes (.7 s lifetime); the lrgest gp length llowe ws frmes. For the spinning isk onfol time series, the onstrints use were minimum of 3 onseutive frmes (6 s) n gp length of frme. The ojets thus selete were sujete to further nlysis using itionl softwre written in Mtl (MthWorks, Ntik, MA). The fluoresene intensity profiles of the tres were otine y summing the intensities in pixel region of interest roun the enter of intensity of the ojet. The lol kgroun ws lulte y verging the fluoresene signl from the losest 3 pixels surrouning the region of interest ut skipping those pixels orresponing to nery fluoresent ojets. Only ojets whose fluoresene intensity inrese with time, tht were present fter the time series strte, i not ollie with other fluoresent ojets n move less thn 2 pixels/frme (.6 mm/frme) in x n y, were onsiere for further nlysis (the verge of the movement ws.4 pixel/frme, n the mein.28 pixel/frme). Fluoresene intensity tres uring the first s of lthrin or AP-2 reruitment thus otine were then fitte using step etetion funtion (Smith, 998) to efine the intensity n the well time of the moleule inorportion t the nsent ote pits. To quntify protein reruitment, the umultive istriutions of intensities of the first n seon steps of ote pit formtion for ll pits in eh ell were together fitte with moel inorporting ifferent omintions of protein reruitment s well s the extent of sustitution in the ell, i.e., the proility q of fluoresent moleule eing inorporte. Speifilly, the proility of prtiulr numer of moleules reruite t eh step, i, ws n input prmeter (e.g., for the first step of lthrin reruitment, the proilities of or 2 triskelions), with the onition tht P i i =. Then, the sustitution proility q (lso prmeter) n the mximum numer of fluorophores, n i, for eh vlue of i (e.g., 3 EGFP-L for one triskelion, 6 EGFP-L for 2 triskelions) were use to ompute the totl expete istriution of EGFPs s weighte sum of inomil istriutions for eh step: f½kš = XM ni i,,q k,ð qþ n i k k i = where M is the mximum numer of moleules inlue in the moel for tht step. From this istriution of fluorophore ounts, the orresponing umultive intensity istriution ws lulte s x ðm,nþ FðxÞ = Xnmx f½nš, n = + erf p s, ffiffiffiffiffiffiffiffi 2,n for eh step, where n mx is the mximum numer of fluorophores in f[k], n m n s re the men n stnr evition of the intensity of single moleule, respetively; the vlues of m n s were tken from the single EGFP lirtion. During the fit ell, 49 7, August 3, 22 ª22 Elsevier In. S3

17 of F to the mesure umultive intensity istriutions, the prmeters i n q were estimte for given onfigurtion of protein reruitment. To the simplest possile initil esription (e.g., in the se of lthrin, one triskelion reruite uring eh step), other omponents orresponing to the reruitment of itionl protein omplexes were itertively e. Seletion of the est omintion of moels ws se on the yesin Informtion riterion (I) (Jqmn n Dnuser, 26; Shwrz, 978). The I efines n optiml tre-off etween the likelihoo of moel n the numer of prmeters use in the moel esription. It is use to prevent overfitting of the t. The vlue of the I ereses s funtion of the moel likelihoo n inreses s funtion of the numer of moel prmeters; mong ompeting moels, the moel with the lowest I vlue is the est esriptor of the t. In the se of lthrin, the initil moel ws single inomil istriution with n = 3 (one triskelion), to whih moels with n = 6, n n = 9 (two, three, et. triskelions respetively) were susequently e, sine eh triskelion ontins 3 light hins n 3 hevy hins. In the se of AP2, ll possile permuttions of moels were teste ue to lk of similr moleulr onstrints. The initil moel ws single inomil istriution with n = (one AP2), to whih moels with itionl AP2s were e, sine eh AP2 is heterotetrmer ontining one opy of s2. Simultions Simultion movies losely repliting our experimentl oservtions were generte in Mtl. Iniviul ote pits were moele s iffrtion-limite spots to whih lthrin or AP2 were reruite on eh step oring to speifi moel ( triskelion, Figure S3; 2 or 3 AP2, Figure S6). The well time ws rnomly generte from istriution either of the form pðtþ = k k 2 k k 2 e k t e k 2t where k =.84 n k 2 =.63 for the first step (Figures S3 n S6), or from single exponentil ey pðtþ = k e kt, where k =. for the first step (Figure S4). The pits ontine either triskelions or AP2 ering L or s2 tgge with EGFP with reltive ompositions tht followe inomil istriution proportionl to 6 or 8% sustitution, respetively. Two-imensionl iffusion of the pits n the signl-to-noise rtio of the fluoresene in the simultions were hosen to mth the experimentl t. Anlytil Vlition We estlishe the roustness of the nlysis use to etermine how ote pit ssemly strts y performing the lultions just esrie on simulte noisy imge sequenes (movies) orresponing to lthrin or AP2 reruitment uring ote pit formtion (see ove). The moel lultions llowe us to verify tht the etetion, trking n nlysis use here relily returne the input vlues of the simulte movies. The simulte movies were of the sme urtion s the experimentl time series, n the pits ontine triskelions ering light hins tgge with EGFP with reltive omposition tht followe inomil istriution efine y the extent of light-hin sustitution. The signl-to-noise rtio of the fluoresene intensity ssoite with single fluorophore ws simulte to mth tht oserve experimentlly. Regrless of the moel use, the lultions returne the orret input vlues for the numer of reruite triskelions prtiulrly for the first step of ote pit formtion s well s the extent of light hin sustitution (Figure S3). The roustness test performe using two other noisy movies simulting AP2 ote pit formtion lso returne the orret numer of AP2 omplexes n the extent of s2 sustitution (Figure S6 n Movie S3). Further vlition for the reliility of the step etetion lgorithm ws otine y simulting tres for reruitment moel of ontinuous growth with the sme overll slope n noise s the noisier lthrin-mherry t use for the experiments ssoite with Figure 4. We then pplie the sme step ientifition lgorithm s use to nlyze the rel t. As expete, this generte series of first steps, eh of ifferent well time. Anlysis of the frequeny istriution of these well times ( proess equivlent to wht is shown in Figure 2) lerly showe tht the well time istriution from the simultion extens to muh longer times, peking t 6 7 s n extening wy eyon 2 s (t not shown). The istriution of well times etween the first reruitment steps of lthrin or AP2 showe rise-n-fll profile onsistent with more thn one rte-limiting event. It is possile, however, tht the istriution of well times follows n exponentil ey tht woul e onsistent with single rte-limiting step; in this se the rise portion of the well time istriution profile woul pper if frtion of short steps were misse n inste were unle with longer ones. This possiility ws exlue se on the effet of unling on the intensity istriution of the etete steps in simultion movies generte with well times tht followe n exponentil istriution or rise n fll istriution tht mthe experimentl t (Figure S4). unling of steps in the movie with exponentil istriution ise the lulte fluoresene intensity istriution towr vlues higher thn the input moel, wheres this effet ws not oserve with the simulte experimentl t. These sets of results provie nlytil vlition of our unise pproh for nlyzing the fluoresene tres, omining use of step-fining lgorithm, moels of the fluoresene intensity expete for speifi moes of moleulr reruitment, n itertive moels seletion se on the I. S4 ell, 49 7, August 3, 22 ª22 Elsevier In.

18 SUPPLEMENTAL REFERENES rosky, F.M. (98). lthrin struture hrterize with monolonl ntioies. II. Ientifition of in vivo forms of lthrin. J. ell iol., lirmont, K.., oll, W., Erisson, M., n Kirhhusen, T. (997). A role for the hinge/er omin of the et hins in the inorportion of AP omplexes into lthrin-ote pits n ote vesiles. ell. Mol. Life Si. 3, Näthke, I.S., Heuser, J., Lups, A., Stok, J., Turk,.W., n rosky, F.M. (992). Foling n trimeriztion of lthrin suunits t the triskelion hu. ell 68, Sffrin, S., n Kirhhusen, T. (28). Differentil evnesene nnometry: live-ell fluoresene mesurements with -nm xil resolution on the plsm memrne. iophys. J. 94, Smith, D.A. (998). A quntittive metho for the etetion of eges in noisy time-series. Philos. Trns. R. So. Lon. iol. Si. 33, ell, 49 7, August 3, 22 ª22 Elsevier In. S

19 A K Intensity D Men (Fluoresene Intensity) s K 4K 3K 2K K 4 s 2 STD (Fluoresene Intensity) K K K 4 2 K 2K 3K 4K Fluoresene Intensity E # EGFPs Numer of Moleules EGFP 2K 4K 6K 8K Fluoresene Intensity (.u.) # EGFPs 2K 4K 6K 8K Numer of Moleules σ2-egfp AP2 Fluoresene Intensity (.u.) # EGFPs L-EGFP Triskelions 2K 4K 6K 8K Fluoresene Intensity (.u.) Figure S. Single-Moleule EGFP Fluoresene Intensity lirtion, Relte to Figure (A) iotinylte-egfps were tthe t low surfe ensity through streptviin to iotinylte PLL-PEG ote overslips n illuminte ontinuously with TIRF. The kymogrph is from time series otine using ms exposures. () Fluoresene intensity tres orresponing to the exmples highlighte in pnel (A). The kgroun-orrete fluoresene intensities orresponing to single-step lehing within single iffrtion-limite spot were otine using step fitting funtion (lk). () Distriution of intensity hnges for single lehing step, etermine from 88 iffrtion-limite spots. The fit is norml istriution of 828 ± 983 (men ± SD). (D) Linerity test for the etetion of multiple EGFPs within the sme iffrtion-limite spot. Plots orrespon to the men n stnr evition of the fluoresene intensity istriution for lehing events s one (272), two (4) or three (3) steps within the sme spot. The oserve linerity etween numer of lehing steps n men fluoresene istriution, n the squre root epenene of the numer of moleules n the stnr evition of the fluoresene intensity inites inepenent fluoresene of the EGFP moleules within the spot. (E) Distriution of intensity hnges for single lehing step, etermine for EGFP lone (purifie from E. oli), for s2-egfp oun to AP2 or for EGFP-L oun to triskelions (from ilute ytosol) from smples iretly sore to glss overslips imge with TIRF with ontinuous illumintion otine using ms exposures. The fit for EGFP n s2-egfp re norml istriutions of 82 ± 484 (N = 34) n 82 ± 484 (n = 28). The EGFP-L fit orrespons to liner omintion of three norml istriutions; the most prominent, entere t 82 ± 484 orrespons to the ontriution of one EGFP-L either free or oun to triskelions (n = 38). S6 ell, 49 7, August 3, 22 ª22 Elsevier In.

20 8 A I lthrin ell lthrin ell 2 lthrin ell A I A I A I K 3K 4K 6K K 3K 4K 6K lthrin ell A I K 3K 4K 6K K 3K 4K 6K lthrin ell K 3K 4K 6K K 3K 4K 6K K 3K 4K 6K ell # K 3K 4K 6K K 3K 4K 6K K 3K 4K 6K D E Western lot nlysis Experiment # Experiment #2 EGFP-L ells WT ells IP: lthrin x 2x 3x x 2x 3x W: H EGFP-L L L EGFP-L ells WT ells IP: lthrin x 2x 4x x 2x 4x W: H EGFP-L L L Figure S2. Reruitment of lthrin uring the Initition Phse of ote Pit Formtion Detete with Single-Moleule Sensitivity, Relte to Figure 2 The t in (A), (), n () orrespon to oservtions for ells summrize in Figure 2. (A) Vlue of the yesin informtion riterion (I) use to etermine the est fit etween the experimentl t n the reruitment moels of lthrin inite t the ottom. The reltive ontriutions of triskelions in moels - re presente in pnel. () ompile istriution of net fluoresene intensities of reruite lthrin EGFP-L etermine for the first n seon steps uring the initition phse of the pits ollete in eh of the five nlyze ells (gry). The ontinuous fluoresene intensity signl (rk lue) is the sum of the reltive ontriutions to the fluoresene signl y the inorportion of one, two, et., EGFP moleules (light lue) tht were otine from the moel with the lowest I sore (pnels A). () Arrivl of triskelions to the first n seon steps of the moels - highlighte in pnels A. (D) Extent of sustitution of enogenous lthrin light hins y etopilly expresse EGFP-L otine omputtionlly for eh iniviul ell from the est fits for lthrin in pnels A. (E) Immunopreipittion with monolonl ntioies speifi for lthrin hevy hin followe y Western lot nlysis with ntioies speifi for L/L from ell-free lystes otine from S ells stly expressing EGFP-L. omprison of n intensity etween enogenous n himer proteins fuse to EGFP inites 6% replement of enogenous light hins y etopilly expresse EGFP-L. ell, 49 7, August 3, 22 ª22 Elsevier In. S7

21 A F. Intensity (.u.) I D 2K 2K K K K ote pit # ote pit #2 6K 4K 3K K K 2K K K K E 6K 4K 3K K # EGFPs K 3K 4K 6K K 3K 4K 6K Figure S3. Simulte Reruitment of lthrin uring the Initition Phse of ote Pit Formtion, Relte to Figure 2 (A E) The t in this figure were otine from the nlysis of simulte noisy movies mimiking the reruitment of triskelions uring ote pit formtion. The simulte lthrin movies were of the sme urtion ( s) s the experimentl time series. The signl-to-noise rtio of the fluoresene intensity ssoite with single fluorophore ws simulte to mth tht oserve experimentlly. The input moel for the numer of triskelions reruite uring the first n seon steps onsiste of the rrivl of one single triskelion in % of the events. The numer of fluoresent light hins in eh triskelion ws rnomly generte from inomil istriution efine y 6% light-hin sustitution. The lulte rrivls for the first step n extent of light hin sustitution were in exellent greement with the vlue use in the input moel. (A) Plot of the fluoresene intensity tres uring the formtion of two simulte ote pits ontining lthrin EGFP-L. The t were otine every 7 ms with n exposure of 3 ms per frme. The pnels on the right re expne tres orresponing to the first s uring the lifetime of the ote pits; they show the result of the fit (lk) otine y pplying step-fitting funtion to estimte the verge fluoresene intensity n well time of the first two steps uring the initition phse of the pit. () Distriution of well times of the first n seon steps of lthrin EGFP-L reruitment uring the initition phse of ote pit formtion. Dt from 234 simulte ote pits in three simulte movies. The rk lue line is fit of simple moel se on two rte-limiting moleulr steps. () Vlue of the yesin informtion riterion (I) use to etermine the est fit etween the simulte t n the reruitment moels of lthrin inite t the ottom. The reltive ontriutions of triskelions in moels - re presente in pnel E. (D) ompile istriution of net fluoresene intensities of reruite lthrin EGFP-L etermine for the first n seon steps uring the initition phse of ll pits in the three simulte n nlyze ells (gry). The ontinuous fluoresene intensity signl (rk lue) is the sum of the reltive ontriutions to the fluoresene signl y the inorportion of one, two, et., EGFP moleules (light lue) tht were otine from the moel with the est I sore (pnel, ). For the first step, the moel represents the rrivl of single triskelion in 9% of the events, n three triskelions in the remining % (inset). For the seon step, the moel represents the rrivl of one, two n three triskelions in %, 2% n 2% of the events, respetively (inset). The lulte extent of enogenous light hin sustitution for ll simulte ells with EGFP-L ws 67%. (E) Arrivl of triskelions to the first n seon steps of the moels - highlighte in pnel. See relte simultions for AP-2 in Figure S. S8 ell, 49 7, August 3, 22 ª22 Elsevier In.

22 A # EGFPs # EGFPs K 3K 4K 6K K 3K 4K 6K Fluoresene Intensity (.u.) Fluoresene Intensity (.u.) K 3K 4K 6K K 3K 4K 6K Figure S4. Simultion to Determine the Effet of Ill-Determine Short Dwell Times on the Distriution of Fluoresene Intensities Assigne to the First Steps of AP2 Reruite oring to Two Different Types of Dwell-Time Distriution, Relte to Figure 3 Simulte noisy time sequenes (movies) of the reruitment of two AP2 in % of the events uring the initil steps of ote pit formtion were generte mimiking either the well time istriution of AP2 reruitment oserve experimentlly (Figures 2 n 3) (A), or following single exponentil ey (). The replement of enogenous s2 with s2-egfp ws 8%. The right pnels show the ompile istriution of net fluoresene intensities of reruite AP2 etermine for the first n seon steps uring the initition phse of ll pits (gry). The reltive ontriutions to the fluoresene signl y the inorportion of one, two, et., EGFP moleules (light lue) were otine from the t moel with the est I sore (not shown). (A) Dwell times (lue histogrm) istriute oring to simple moel se on two rte-limiting moleulr steps tht ws erive y fitting to the experimentlly oserve well times (lk she urve). urying short into long well-times hs miniml effet on the istriution of etermine well-times (histogrms) n the fitte istriution (lue urve) for the first two steps (left pnels) n no isernle effet on the ompile istriution of reruite AP2 (right pnels). () Dwell times following n exponentil istriution with the sme men s the istriution in (A) (lk she urve). The strong effets of urying frtion of the shortest into the lrgest well-times in the istriution of etermine well-times (histogrms) n the fitte istriution (lue urve) for the first two steps re shown in the left pnels. urying short into long well-times hs strong effet of shifting the intensity profile towr lrge vlues if the well-time istriution follows n exponentil ey. This lustering oes not mth the experimentl t (e.g., Figure 3). ell, 49 7, August 3, 22 ª22 Elsevier In. S9

23 A I 2 2 AP2 ell AP2 ell 2 AP2 ell 3.8 e e A I e e A I e e A I K 3K 4K 6K e K 3K 4K 6K e I K 3K 4K 6K e K 3K 4K 6K e I K 3K 4K 6K AP2 ell 4 AP2 ell AP2 ell 6 A A.8 e K 3K 4K 6K e K 3K 4K 6K K 3K 4K 6K K 3K 4K 6K K 3K 4K 6K K 3K 4K 6K K 3K 4K 6K D E Experiment # IP: AP2 W: β/β2 σ2-egfp σ2 Western lot nlysis σ2-egfp ells WT ells x 2x 3x x 2x 3x σ2-egfp ells WT ells ell # Experiment #2 IP: AP2 W: β/β2 σ2-egfp σ2 x 2x 4x x 2x 4x Figure S. Reruitment of AP2 uring the Initition Phse of ote Pit Formtion Detete with Single-Moleule Sensitivity, Relte to Figure 3 The t in pnels A, n orrespon to oservtions for ells 6 summrize in Figure 3. (A) Vlue of the yesin informtion riterion (I) use to etermine the est fit etween the experimentl t n the reruitment moels of AP2 inite t the ottom. The reltive ontriutions of AP2 reruitment in moels -e re presente in pnels. () ompile istriution of net fluoresene intensities of reruite AP2 s2-egfp etermine for the first n seon steps uring the initition phse of the pits ollete in eh of the six nlyze ells (gry). The ontinuous fluoresene intensity signl (rk lue) is the sum of the reltive ontriutions to the fluoresene signl y the inorportion of one, two, et., EGFP moleules (light lue) tht were otine from the moel with the lowest I sore (pnels A). () Arrivl of AP2s to the first n seon steps of the moels -e highlighte in pnels. (D) Extent of sustitution of enogenous s2 y etopilly expresse s2-egfp otine omputtionlly for eh iniviul ell from the est fits for AP2 in pnels A. (E) Immunopreipittion with monolonl ntioies speifi for /2 of AP2 followe y Western lot nlysis with ntioies speifi for s2 from ell-free lystes otine from S ells stly expressing s2-egfp inites n 8% replement of enogenous s2 y etopilly expresse s2-egfp. S ell, 49 7, August 3, 22 ª22 Elsevier In.