Symbol Definition Value Range (Experimental) Time of the end of residual growth 10 h 10

Size: px
Start display at page:

Download "Symbol Definition Value Range (Experimental) Time of the end of residual growth 10 h 10"

Transcription

1 Table 1. Definitions and experimental values of parameters Symbol Definition Value ange (Experimental) T I Time of the end of residual growth 10 h 10 T D D D ate s s G max V max c-fed c-fed Delay in Death rate of Death rate of Death rate of s entry into death phase after the onset of starvation h 70 denine supplied per ysine supplied per Maximum growth rate of in the absence of ade after time T Value* /h 0.01 in the absence of lys averaged from time T I to T 0.054/h in the absence of lys after time T Maximum lysine uptake rate per de consumed to produce a fed ys consumed to produce a fed 0.02/h 0.02 cell upon death 3 fmole per cell 3 cell upon death 15 fmole per cell 15 I Fold-increase in cell density during residual growth of when lysine is in excess 0.31/h 0.31 cell when lysine is in excess 2.4 fmole per cell/h 2.4 cell when ade is in excess 1 fmole per cell cell when lys is in excess 5.4 fmole per cell I Fold-increase in cell density during residual growth of c ** c ** de consumed in order to produce a starving ys consumed in order to produce a starving cell fmole per cell 1 cell fmole per cell K m Michaelis-Menten half-saturation constant of lysine transporter µm (1, 2) 50 2 *Values used in calculations. Data from Fig 2. Death rates were measured during the specified time windows and were found to be density-dependent. D = 0.01 is the average of 0.007, 0.009, and per h, respectively, obtained over a range of initial cell densities varying from 0.05 to cells per ml. D and D ate were obtained at initial cell densities ranging from 0.28 to cells per ml. The kinetics of metabolite release approximately coincided with that of cell death (Fig. 2B). Thus, we assume that a starving cell releases a fixed amount of the overproduced metabolite into the medium on

2 death. Metabolite supplied per dead cell was estimated from Fig. 2B by dividing the final concentration of released metabolite by the final population density of dead cells. See SI Fig. 10. When adenine was present in excess, the maximum uptake rate of adenine V max was 0.5 fmole per cell/h, and the maximum growth rate of cells was G max = 0.37/h (methods of measurement similar to those in Fig. 10). Thus, it took c-fed = V max (ln2/ G max ) ~1 fmole adenine to produce a fed ln2/ G max was the doubling time of lysine to produce a fed **Because one fed cell. cell, where. Similarly, it took c-fed = V max (ln2/ G max ) = 5.4 fmole cell gave rise to I lysine-starved c-fed /I amount of lysine to produce a starving adenine to produce an adenine-starved cell. cells during residual growth, it took c= cell. Similarly, it took c = c-fed /I amount of 1. Sychrova H, Chevallier M (1993) east 9: Garcia JC, Kotyk (1988) Folia Microbiol (Praha) 33:

3 Fig. 6. Viability of CoSMO requires both adenine- and lysine-overproduction mutations. Monocultures of two strains with indicated genotypes were washed free of adenine and lysine and mixed at time 0. Plots show the dynamics of live (red), live (green), dead (gray), and total (black) cell densities of the coculture. Fig. 7. Stabilization of CoSMO partner ratio. Duplicate CoSMO cultures, in which partners were mixed at : = (magenta), 1 (cyan), and 10-3 (blue) to OD 600 of 0.01, were initiated at time 0. Whenever the cultures reached the near-saturation set point of OD 600 = 0.4-1, they were diluted to OD 600 of [dsim] t various time points, population densities of Dsed-positive and FP-positive cells were measured twice by flow cytometry. The average : ratio is shown with a vertical bar indicating the range. Triangles mark points of dilution. Fig. 8. schematic diagram of the experimental protocol for Fig. 5B. near-saturation ound-0 culture was subjected to 10-fold serial dilutions with three replicate cultures at a fixed volume per dilution so that density requirement of the culture, expressed in the number of cultures (out of 3) that are viable at various dilutions, could be measured. Out of diluted cultures that were able to grow, one near-saturation culture was chosen and subjected to 10-fold serial dilutions. This procedure was repeated 10 times, spanning a total of 70 generations. The last near-saturation culture chosen was the ound-10 culture, and its density requirement was similarly determined. Fig. 9. Characterization of CoSMO components using flow cytometry. Exponentially growing (eft) and (ight) cells were washed free of supplements at time 0. Percentages of red-fluorescent (), yellow-fluorescent (), and dark (dark) cells were measured at 0 h (Upper) and 97 h (ower), and their values are indicated. Fig. 10. Measurements of G max and V max. cells were grown in SD supplemented with lysine. Time 0 was arbitrarily chosen in early exponential phase. Plots show the

4 population density of (eft, green circles) and the concentration of lysine remaining in the medium (ight, brown circles) over time. The least-squares-fitting equation for the Gmax t left panel is = 0e (dotted line) and yields the initial population density 0 and the maximum growth rate G max. The least-squares-fitting equation for the right panel is = + V (1- e ) / G Gmax t 0 max 0 max (dotted line), which is the solution to the differential d Gmax t = Vmax = Vmax 0e equation dt, and yields the initial lysine concentration 0 and the maximum lysine uptake rate per cell V max.

5 Population Density (cells/ml) Time (hours)

6 : Time (hours)

7 inocula w/ various : ound-0 #1 #2 #10 ound Fold-Dilution 10 7

8 Dark Dark 1.7 Dsed Fluorescence Dark Dark hour 97 hour FP Fluorescence

9 Population Density (x10 6 cells/ml) [ys] (mm) Time (hours) Time (hours)

Enzyme Reactions. Lecture 13: Kinetics II Michaelis-Menten Kinetics. Margaret A. Daugherty Fall v = k 1 [A] E + S ES ES* EP E + P

Enzyme Reactions. Lecture 13: Kinetics II Michaelis-Menten Kinetics. Margaret A. Daugherty Fall v = k 1 [A] E + S ES ES* EP E + P Lecture 13: Kinetics II Michaelis-Menten Kinetics Margaret A. Daugherty Fall 2003 Enzyme Reactions E + S ES ES* EP E + P E = enzyme ES = enzyme-substrate complex ES* = enzyme/transition state complex EP

More information

Michaelis-Menten Kinetics. Lecture 13: Kinetics II. Enzyme Reactions. Margaret A. Daugherty. Fall Substrates bind to the enzyme s active site

Michaelis-Menten Kinetics. Lecture 13: Kinetics II. Enzyme Reactions. Margaret A. Daugherty. Fall Substrates bind to the enzyme s active site Lecture 13: Kinetics II Michaelis-Menten Kinetics Margaret A. Daugherty Fall 2003 Enzyme Reactions E + S ES ES* EP E + P E = enzyme ES = enzyme-substrate complex ES* = enzyme/transition state complex EP

More information

ACCGGTTTCGAATTGACAATTAATCATCGGCTCGTATAATGGTACC TGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGG AATTGTGAGCGGATAACAATTTCACAGGTACC

ACCGGTTTCGAATTGACAATTAATCATCGGCTCGTATAATGGTACC TGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGG AATTGTGAGCGGATAACAATTTCACAGGTACC SUPPLEMENTAL TABLE S1. Promoter and riboswitch sequences used in this study. Predicted transcriptional start sites are bolded and underlined. Riboswitch sequences were obtained from Topp et al., Appl Environ

More information

Previous Class. Today. Cosubstrates (cofactors)

Previous Class. Today. Cosubstrates (cofactors) Previous Class Cosubstrates (cofactors) Today Proximity effect Basic equations of Kinetics Steady state kinetics Michaelis Menten equations and parameters Enzyme Kinetics Enzyme kinetics implies characterizing

More information

CELL REPLICATION. Fluorescent light microscopy showing mitosis, especially immunolabelled cytoskeleton and tubulin

CELL REPLICATION. Fluorescent light microscopy showing mitosis, especially immunolabelled cytoskeleton and tubulin CELL REPLICATION Fluorescent light microscopy showing mitosis, especially immunolabelled cytoskeleton and tubulin Cell REPLICATION PROLIFERATION MUTIPLICATION DIVISION CELL REPLICATION Fluorescent light

More information

Supplementary Figure 1. Confirmation of REF52-hE2F1p::4NLS-d4Venus reporter cells and characterization of E2F dynamics. (a) Alignment of E2F dynamics

Supplementary Figure 1. Confirmation of REF52-hE2F1p::4NLS-d4Venus reporter cells and characterization of E2F dynamics. (a) Alignment of E2F dynamics Supplementary Figure 1. Confirmation of REF52-hE2F1p::4NLS-d4Venus reporter cells and characterization of E2F dynamics. (a) Alignment of E2F dynamics trajectories to endogenous E2F1 mrna expression. Gray

More information

Prion peptides are extremely sensitive to copper induced oxidative stress

Prion peptides are extremely sensitive to copper induced oxidative stress Supporting Information Prion peptides are extremely sensitive to copper induced oxidative stress Simone Dell'Acqua, a Chiara Bacchella, a Enrico Monzani, a Stefania Nicolis, a Giuseppe Di Natale, b Enrico

More information

THE THIRD GENERAL TRANSPORT SYSTEM BRANCHED-CHAIN AMINO ACIDS IN SALMONELLA T YPHIMURI UM KEIKO MATSUBARA, KUNIHARU OHNISHI, AND KAZUYOSHI KIRITANI

THE THIRD GENERAL TRANSPORT SYSTEM BRANCHED-CHAIN AMINO ACIDS IN SALMONELLA T YPHIMURI UM KEIKO MATSUBARA, KUNIHARU OHNISHI, AND KAZUYOSHI KIRITANI J. Gen. Appl. Microbiol., 34, 183-189 (1988) THE THIRD GENERAL TRANSPORT SYSTEM BRANCHED-CHAIN AMINO ACIDS IN SALMONELLA T YPHIMURI UM FOR KEIKO MATSUBARA, KUNIHARU OHNISHI, AND KAZUYOSHI KIRITANI Department

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Breker et al., http://www.jcb.org/cgi/content/full/jcb.201301120/dc1 Figure S1. Single-cell proteomics of stress responses. (a) Using

More information

Tineke Jones Agriculture and Agri-Food Canada Lacombe Research Centre Lacombe, Alberta

Tineke Jones Agriculture and Agri-Food Canada Lacombe Research Centre Lacombe, Alberta Growth of Escherichia Coli at Chiller Temperatures Tineke Jones Agriculture and Agri-Food Canada Lacombe Research Centre Lacombe, Alberta \ Introduction The responses of mesophilic microorganisms to chiller

More information

Supporting Information for Bacterial Cheating Drives the Population Dynamics of Cooperative Antibiotic Resistance Plasmids

Supporting Information for Bacterial Cheating Drives the Population Dynamics of Cooperative Antibiotic Resistance Plasmids Supporting Information for Bacterial Cheating Drives the Population Dynamics of Cooperative Antibiotic Resistance Plasmids Eugene A. Yurtsev, Hui Xiao Chao, Manoshi Sen Datta, Tatiana Artemova and Jeff

More information

Supplementary Figure 1. Phenotype of the HI strain.

Supplementary Figure 1. Phenotype of the HI strain. Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants

More information

Supplementary material

Supplementary material Supplementary material Phosphorylation of the mitochondrial autophagy receptor Nix enhances its interaction with LC3 proteins Vladimir V. Rogov 1,*, Hironori Suzuki 2,3,*, Mija Marinković 4, Verena Lang

More information

ELECTRONIC SUPPLEMENTARY INFORMATION for

ELECTRONIC SUPPLEMENTARY INFORMATION for ELECTRONIC SUPPLEMENTARY INFORMATION for Complex Function by Design Using Spatially Pre-Structured Synthetic Microbial Communities: Degradation of Pentachlorophenol in the Presence of Hg(II) Supporting

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Sarcomere length-dependence of total fluorescence intensity in a relaxed muscle fibre containing BSR-RLC. a) Fluorescence intensity (I) relative to the value

More information

Previous Class. Today. Michaelis Menten equation Steady state vs pre-steady state

Previous Class. Today. Michaelis Menten equation Steady state vs pre-steady state Previous Class Michaelis Menten equation Steady state vs pre-steady state Today Review derivation and interpretation Graphical representation Michaelis Menten equations and parameters The Michaelis Menten

More information

(Supplementary Information)

(Supplementary Information) Foldamer-mediated Structural Rearrangement Attenuates Aβ Oligomerization and Cytotoxicity (Supplementary Information) Sunil Kumar* 1, Anja Henning-Knechtel 2, Ibrahim Chehade 2, Mazin Magzoub 2, and Andrew

More information

Z -LYTE Assay Setup Guide on the BMG LABTECH CLARIOstar Reader

Z -LYTE Assay Setup Guide on the BMG LABTECH CLARIOstar Reader 08 Jan 15 Page 1 of 18 Z -LYTE Assay Setup Guide on the BMG LABTECH CLARIOstar Reader The BMG LABTECH CLARIOstar Microplate Readers were tested for compatibility with the Life Technologies Z -LYTE Assay

More information

Supporting Information. Carbon Imidazolate Framework-8 Nanoparticles for

Supporting Information. Carbon Imidazolate Framework-8 Nanoparticles for Supporting Information Carbon Nanodots@Zeolitic Imidazolate Framework-8 Nanoparticles for Simultaneous ph-responsive Drug Delivery and Fluorescence Imaging Liu He, a Tingting Wang, b Jiping An, c Xiaomeng

More information

09/07/16 12/07/16: 14/07/16:

09/07/16 12/07/16: 14/07/16: 09/07/16 Transformation of DH5 alpha with the InterLab transformation protocol : DNA constructions were dried, so we resuspended them into 100µL nuclease-free water. We took 5µL of the product for 25µL

More information

Lecture 27. Transition States and Enzyme Catalysis

Lecture 27. Transition States and Enzyme Catalysis Lecture 27 Transition States and Enzyme Catalysis Reading for Today: Chapter 15 sections B and C Chapter 16 next two lectures 4/8/16 1 Pop Question 9 Binding data for your thesis protein (YTP), binding

More information

Simulated niche partitioning by bacteria

Simulated niche partitioning by bacteria Simulated niche partitioning by bacteria Steven S. Andrews and Adam P. Arkin Physical Biosciences Division Lawrence Berkeley National Laboratory 1 Cyclotron Road Berkeley, CA 94720 ssandrews@lbl.gov 1.

More information

Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a

Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a series of tmfret-pairs comprised of single cysteine mutants

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.

More information

A pentose bisphosphate pathway for nucleoside degradation in Archaea. Engineering, Kyoto University, Katsura, Nishikyo-ku, Kyoto , Japan.

A pentose bisphosphate pathway for nucleoside degradation in Archaea. Engineering, Kyoto University, Katsura, Nishikyo-ku, Kyoto , Japan. SUPPLEMENTARY INFORMATION A pentose bisphosphate pathway for nucleoside degradation in Archaea Riku Aono 1,, Takaaki Sato 1,, Tadayuki Imanaka, and Haruyuki Atomi 1, * 7 8 9 10 11 1 Department of Synthetic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11419 Supplementary Figure 1 Schematic representation of innate immune signaling pathways induced by intracellular Salmonella in cultured macrophages. a, During the infection Salmonella

More information

Supplementary Information for. Single-cell dynamics of the chromosome replication and cell division cycles in mycobacteria

Supplementary Information for. Single-cell dynamics of the chromosome replication and cell division cycles in mycobacteria Supplementary Information for Single-cell dynamics of the chromosome replication and cell division cycles in mycobacteria Isabella Santi 1 *, Neeraj Dhar 1, Djenet Bousbaine 1, Yuichi Wakamoto, John D.

More information

Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex

Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin

More information

Cryo-EM data collection, refinement and validation statistics

Cryo-EM data collection, refinement and validation statistics 1 Table S1 Cryo-EM data collection, refinement and validation statistics Data collection and processing CPSF-160 WDR33 (EMDB-7114) (PDB 6BM0) CPSF-160 WDR33 (EMDB-7113) (PDB 6BLY) CPSF-160 WDR33 CPSF-30

More information

Identifying Interaction Hot Spots with SuperStar

Identifying Interaction Hot Spots with SuperStar Identifying Interaction Hot Spots with SuperStar Version 1.0 November 2017 Table of Contents Identifying Interaction Hot Spots with SuperStar... 2 Case Study... 3 Introduction... 3 Generate SuperStar Maps

More information

Topic 4 Correlation and Regression. Transformed Variables

Topic 4 Correlation and Regression. Transformed Variables Topic 4 Correlation and Regression Transformed Variables 1 / 13 Outline Worldwide Oil Production Lineweaver-Burke double reciprocal plot 2 / 13 Worldwide Oil Production Example. The modern history of petroleum

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Methods A total of 18 denitrifying species were isolated (Suppl. Table S3) and stored in ready to use aliquots at -80 C. In preparation for each experiment (Suppl. Fig. S1), the strains were

More information

Predictor Assay Setup Guide on the Tecan Safire 2 Microplate Reader

Predictor Assay Setup Guide on the Tecan Safire 2 Microplate Reader Page 1 of 16 Predictor Assay Setup Guide on the Tecan Safire 2 Microplate Reader NOTE: The Tecan Safire 2 Microplate Reader was tested for compatibility with Invitrogen's Predictor herg FP Assay (PV5365)

More information

Does toxicity of aromatic pollutants increase under remote atmospheric conditions?

Does toxicity of aromatic pollutants increase under remote atmospheric conditions? Supplementary Information for Does toxicity of aromatic pollutants increase under remote atmospheric conditions? Ana Kroflič 1,*, Miha Grilc 2 & Irena Grgić 1 1 Analytical Chemistry Laboratory, National

More information

where a + b = 2 (this is the general case) These all come from the fact that this is an overall second order reaction.

where a + b = 2 (this is the general case) These all come from the fact that this is an overall second order reaction. Chapter 7 Problems Page of 6 //007 7. Hydrolysis of ethyl acetate is as follows: EtAc + OH - Ac - + EtOH. At 5 ºC, the disappearance of OH - is used to determine the extent of the reaction, leading to

More information

over K in Glial Cells of Bee Retina

over K in Glial Cells of Bee Retina Online Supplemental Material for J. Gen. Physiol. Vol. 116 No. 2 p. 125, Marcaggi and Coles A Cl Cotransporter Selective for 4 over K in Glial Cells of Bee Retina Païkan Marcaggi and Jonathan A. Coles

More information

ATP Fluorometric/Colorimetric Assay Kit

ATP Fluorometric/Colorimetric Assay Kit ATP Fluorometric/Colorimetric Assay Kit Catalog No. KM0028 Detection and Quantification of ATP Concentrations in Biological Samples. Research Purposes Only. Not Intended for Diagnostic or Clinical Procedures.

More information

Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2.

Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2. Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice. Percentage of marginal zone B cells in the spleen of wild-type mice (+/+), mice homozygous for cpm or pri

More information

Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring

Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring Current Biology Supplemental Information Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring Caroline Laplante, Julien Berro, Erdem Karatekin,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.108/nature0608 a c pmol L-[ H]Leu / mg LeuT pmol L-[ H]Leu / min / mg LeuT 900 50 600 450 00 150 200 150 100 0 0.0 2.5 5.0.5 10.0.5 50 N Cl CMI IMI DMI H C CH N N H C CH N Time (min) 0 0 100 200

More information

Modeling the Immune System W9. Ordinary Differential Equations as Macroscopic Modeling Tool

Modeling the Immune System W9. Ordinary Differential Equations as Macroscopic Modeling Tool Modeling the Immune System W9 Ordinary Differential Equations as Macroscopic Modeling Tool 1 Lecture Notes for ODE Models We use the lecture notes Theoretical Fysiology 2006 by Rob de Boer, U. Utrecht

More information

Lowell High School AP Chemistry Spring 2009 REACTION KINETICS EXPERIMENT

Lowell High School AP Chemistry Spring 2009 REACTION KINETICS EXPERIMENT Lowell High School AP Chemistry Spring 2009 REACTION KINETICS EXPERIMENT Complete the following for Pre-Lab on a clean sheet of paper: (1) In your own words, explain the following: a. why the I 2 concentration

More information

TitleCoupled Nosé-Hoover Equations of Mo.

TitleCoupled Nosé-Hoover Equations of Mo. TitleCoupled Nosé-Hoover Equations of Mo Author(s) Fukuda, Ikuo; Moritsugu, Kei Citation Issue 15-8-18 Date Text Version author UL http://hdl.handle.net/119/56 DOI ights Osaka University Supplemental Material:

More information

of the Guanine Nucleotide Exchange Factor FARP2

of the Guanine Nucleotide Exchange Factor FARP2 Structure, Volume 21 Supplemental Information Structural Basis for Autoinhibition of the Guanine Nucleotide Exchange Factor FARP2 Xiaojing He, Yi-Chun Kuo, Tyler J. Rosche, and Xuewu Zhang Inventory of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved

More information

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-

More information

Table S1. Shimakawa et al.

Table S1. Shimakawa et al. Supplemental Table S1. Effects of ᴅ-glucose on photosynthesis in secondary algae Control 10 min in ᴅ-glucose Control 10 min in ᴅ-glucose E. gracilis O 2 evolution rate / µmol O 2 (mg Chl) 1 h 1 Relative

More information

A First Course on Kinetics and Reaction Engineering. Class 9 on Unit 9

A First Course on Kinetics and Reaction Engineering. Class 9 on Unit 9 A First Course on Kinetics and Reaction Engineering Class 9 on Unit 9 Part I - Chemical Reactions Part II - Chemical Reaction Kinetics Where We re Going A. Rate Expressions - 4. Reaction Rates and Temperature

More information

D-Lactate Fluorometric/Colorimetric Assay Kit

D-Lactate Fluorometric/Colorimetric Assay Kit D-Lactate Fluorometric/Colorimetric Assay Kit Catalog No. KM0096 Detection and Quantification of D-Lactate Concentrations in Biological Samples. Research Purposes Only. Not Intended for Diagnostic or Clinical

More information

CH2351 Chemical Engineering Thermodynamics II Unit I, II Phase Equilibria. Dr. M. Subramanian

CH2351 Chemical Engineering Thermodynamics II Unit I, II   Phase Equilibria.   Dr. M. Subramanian CH2351 Chemical Engineering Thermodynamics II Unit I, II Phase Equilibria Dr. M. Subramanian Associate Professor Department of Chemical Engineering Sri Sivasubramaniya Nadar College of Engineering Kalavakkam

More information

Supplement of Total sulfate vs. sulfuric acid monomer concenterations in nucleation studies

Supplement of Total sulfate vs. sulfuric acid monomer concenterations in nucleation studies Supplement of Atmos. Chem. Phys., 15, 3429 3443, 2015 http://www.atmos-chem-phys.net/15/3429/2015/ doi:10.5194/acp-15-3429-2015-supplement Author(s) 2015. CC Attribution 3.0 License. Supplement of Total

More information

(16 µm). Then transferred to a 250 ml flask with culture medium without nitrate, and left in

(16 µm). Then transferred to a 250 ml flask with culture medium without nitrate, and left in Oikos OIK-04046 Barreiro, A., Roy, S. and Vasconcelos, V. M. 2017. Allelopathy prevents competitive exclusion and promotes phytoplankton biodiversity. Oikos doi: 10.1111/oik.04046 Appendix 1 Parameterization

More information

Supplementary Information. Overlap between folding and functional energy landscapes for. adenylate kinase conformational change

Supplementary Information. Overlap between folding and functional energy landscapes for. adenylate kinase conformational change Supplementary Information Overlap between folding and functional energy landscapes for adenylate kinase conformational change by Ulrika Olsson & Magnus Wolf-Watz Contents: 1. Supplementary Note 2. Supplementary

More information

Phospholipase C Fluorometric/Colorimetric Assay Kit

Phospholipase C Fluorometric/Colorimetric Assay Kit Phospholipase C Fluorometric/Colorimetric Assay Kit Catalog No. KM0129 Detection and Quantification of Phospholipase C Concentrations in Biological Samples. Research Purposes Only. Not Intended for Diagnostic

More information

Measuring Mitochondrial Membrane Potential with JC-1 Using the Cellometer Vision Image Cytometer

Measuring Mitochondrial Membrane Potential with JC-1 Using the Cellometer Vision Image Cytometer Measuring Mitochondrial Membrane Potential with JC-1 Using the Cellometer Vision Image Cytometer Nexcelom Bioscience LLC. 360 Merrimack Street, Building 9 Lawrence, MA 01843 T: 978.327.5340 F: 978.327.5341

More information

λmax = k d Supplementary Figures

λmax = k d Supplementary Figures Supplementary Figures a b HQ CCD Transmission Grating Beam splitting lens Color CCD Objective Sample Dark-field Condenser Raw data Gaussian fit c λmax = k d k = 1.733 nm/pixel 53 nm 307 pixels d Supplementary

More information

Waithe et al Supplementary Figures

Waithe et al Supplementary Figures Waithe et al Supplementary Figures Supplementary Figure 1 Expression and properties of WT and W391A mutant YFP- Ca V 2.2. A Immunoblot using Ca V 2.2 Ab for untransfected cells (UT, lane 1), YFP-Ca V 2.2

More information

Discovery of TeV Gamma-ray Emission Towards Supernova Remnant SNR G Last Updated Tuesday, 30 July :01

Discovery of TeV Gamma-ray Emission Towards Supernova Remnant SNR G Last Updated Tuesday, 30 July :01 Background-subtracted gamma-ray count map of SNR G78.2+2.1 showing the VERITAS detection (VER2019+407). For details, see Figure 1 below. Reference: E. Aliu et al. (The VERITAS Collaboration), Astrophysical

More information

type GroEL-GroES complex. Crystals were grown in buffer D (100 mm HEPES, ph 7.5,

type GroEL-GroES complex. Crystals were grown in buffer D (100 mm HEPES, ph 7.5, Supplementary Material Supplementary Materials and Methods Structure Determination of SR1-GroES-ADP AlF x SR1-GroES-ADP AlF x was purified as described in Materials and Methods for the wild type GroEL-GroES

More information

vapour deposition. Raman peaks of the monolayer sample grown by chemical vapour

vapour deposition. Raman peaks of the monolayer sample grown by chemical vapour Supplementary Figure 1 Raman spectrum of monolayer MoS 2 grown by chemical vapour deposition. Raman peaks of the monolayer sample grown by chemical vapour deposition (S-CVD) are peak which is at 385 cm

More information

Supplemental materials

Supplemental materials Supplemental materials Table S1: Alternative options for anti-toxoplasma SAR-based optimization studies a Compound *MW *AlogP Anti-Toxoplasma TS-4 b IC 50 T. gondii (µm) c CC 50 HFF (µm) MMV007273 480.57746

More information

Lecture 13: Data Analysis for the V versus [S] Experiment and Interpretation of the Michaelis-Menten Parameters

Lecture 13: Data Analysis for the V versus [S] Experiment and Interpretation of the Michaelis-Menten Parameters Biological Chemistry Laboratory Biology 3515/Chemistry 3515 Spring 2018 Lecture 13: Data Analysis for the V versus [S] Experiment and Interpretation of the Michaelis-Menten Parameters 20 February 2018

More information

downstream (0.8 kb) homologous sequences to the genomic locus of DIC. A DIC mutant strain (ro- 6

downstream (0.8 kb) homologous sequences to the genomic locus of DIC. A DIC mutant strain (ro- 6 A B C D ts Figure S1 Generation of DIC- mcherry expressing N.crassa strain. A. N. crassa colony morphology. When a cot1 (top, left panel) strain is grown at permissive temperature (25 C), it exhibits straight

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1

More information

Supplementary information

Supplementary information Electronic Supplementary Material (ESI) for Metallomics. This journal is The Royal Society of Chemistry 2018 Bütof et al., page 1 Supplementary information Supplementary Table S1. Metal content of C. metallidurans

More information

AMS-MAA-MER Special Session: David Bressoud Macalester College, St. Paul, MN New Orleans, January 8, 2007

AMS-MAA-MER Special Session: David Bressoud Macalester College, St. Paul, MN New Orleans, January 8, 2007 AMS-MAA-MER Special Session: David Bressoud Macalester College, St. Paul, MN New Orleans, January 8, 2007 This PowerPoint presentation is available at www.macalester.edu/~bressoud/talks Our problems with

More information

Problem Set 5 Question 1

Problem Set 5 Question 1 2.32 Problem Set 5 Question As discussed in class, drug discovery often involves screening large libraries of small molecules to identify those that have favorable interactions with a certain druggable

More information

(Supplementary Information)

(Supplementary Information) (Supplementary Information) Peptidomimetic-based Multi-Domain Targeting Offers Critical Evaluation of Aβ Structure and Toxic Function Sunil Kumar 1*, Anja Henning-Knechtel 2, Mazin Magzoub 2, and Andrew

More information

Rate Properties of an Iodide Oxidation Reaction

Rate Properties of an Iodide Oxidation Reaction Rate Properties of an Iodide Oxidation Reaction GOAL AND OVERVIEW The rate law for the reduction reaction of peroxodisulfate (PODS) by iodide: S 2 O8 2 (aq) + 2 I (aq) I 2 (aq) + 2 SO4 2 (aq) will be determined.

More information

Nature Protocols: doi: /nprot Supplementary Figure 1

Nature Protocols: doi: /nprot Supplementary Figure 1 Supplementary Figure 1 Photographs of the 3D-MTC device and the confocal fluorescence microscopy. I: The system consists of a Leica SP8-Confocal microscope (with an option of STED), a confocal PC, a 3D-MTC

More information

Quantification of Protein Half-Lives in the Budding Yeast Proteome

Quantification of Protein Half-Lives in the Budding Yeast Proteome Supporting Methods Quantification of Protein Half-Lives in the Budding Yeast Proteome 1 Cell Growth and Cycloheximide Treatment Three parallel cultures (17 ml) of each TAP-tagged strain were grown in separate

More information

Supporting Information. Direct n- to p-type Channel Conversion in Monolayer/Few-Layer WS 2 Field-Effect Transistors by Atomic Nitrogen Treatment

Supporting Information. Direct n- to p-type Channel Conversion in Monolayer/Few-Layer WS 2 Field-Effect Transistors by Atomic Nitrogen Treatment Supporting Information Direct n- to p-type Channel Conversion in Monolayer/Few-Layer WS 2 Field-Effect Transistors by Atomic Nitrogen Treatment Baoshan Tang 1,2,, Zhi Gen Yu 3,, Li Huang 4, Jianwei Chai

More information

A First Course on Kinetics and Reaction Engineering Example 9.4

A First Course on Kinetics and Reaction Engineering Example 9.4 Example 9.4 Problem Purpose This problem illustrates the use of a Lineweaver-Burk plot to determine the values of the constants in a Michaelis-Menten rate expression. Problem Statement Suppose the enzyme-catalyzed

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.

More information

Supporting Information. Designing porphyrinic covalent organic frameworks for the photodynamic inactivation of bacteria Řež, Czech Republic

Supporting Information. Designing porphyrinic covalent organic frameworks for the photodynamic inactivation of bacteria Řež, Czech Republic Supporting Information Designing porphyrinic covalent organic frameworks for the photodynamic inactivation of bacteria Jan Hynek, a,b Jaroslav Zelenka, c Jiří Rathouský, d Pavel Kubát, d Tomáš Ruml, c

More information

Neuronal Cell Health Assays. Real-time automated measurements of neuronal cell viability and neurite dynamics inside your incubator.

Neuronal Cell Health Assays. Real-time automated measurements of neuronal cell viability and neurite dynamics inside your incubator. I N C U C Y T E L I V E - C E L L A N A LY S I S S Y S T E M Neuronal Cell Health Assays Real-time automated measurements of neuronal cell viability and neurite dynamics inside your incubator. See what

More information

A redundant function for the N-terminal tail of Ndc80 in kinetochore-microtubule interaction in Saccharomyces cerevisiae.

A redundant function for the N-terminal tail of Ndc80 in kinetochore-microtubule interaction in Saccharomyces cerevisiae. Genetics: Published Articles Ahead of Print, published on July 30, 2012 as 10.1534/genetics.112.143818 A redundant function for the N-terminal tail of Ndc80 in kinetochore-microtubule interaction in Saccharomyces

More information

Chemical kinetics and catalysis

Chemical kinetics and catalysis Chemical kinetics and catalysis Outline Classification of chemical reactions Definition of chemical kinetics Rate of chemical reaction The law of chemical raction rate Collision theory of reactions, transition

More information

NNIN Nanotechnology Education

NNIN Nanotechnology Education NNIN Nanotechnology Education Name: Date: Class: Nanoparticle (circle one): Au Ag Group role (circle one): nanoparticle synthesis dilution Exposure conditions (circle two): a b c d e f Student Worksheet

More information

Switch. R 5 V Capacitor. ower upply. Voltmete. Goals. Introduction

Switch. R 5 V Capacitor. ower upply. Voltmete. Goals. Introduction Switch Lab 9. Circuits ower upply Goals + + R 5 V Capacitor V To appreciate the capacitor as a charge storage device. To measure the voltage across a capacitor as it discharges through a resistor, and

More information

Fluoro NADP/NADPH Fluorescent NADP/NADPH Detection Kit

Fluoro NADP/NADPH Fluorescent NADP/NADPH Detection Kit Fluoro NADP/NADPH Fluorescent NADP/NADPH Detection Kit Contact Information Address Telephone Toll Free Fax General Information Sales Technical Questions Website Cell Technology Inc 950 Rengstorff Ave Suite

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/1/9/e1500511/dc1 Supplementary Materials for Contractility parameters of human -cardiac myosin with the hypertrophic cardiomyopathy mutation R403Q show loss of

More information

The Diffusion Coefficient for PGK Folding in Eukaryotic Cells

The Diffusion Coefficient for PGK Folding in Eukaryotic Cells Biophysical Journal, Volume 99 Supporting Material The Diffusion Coefficient for PGK Folding in Eukaryotic Cells Apratim Dhar, Simon Ebbinghaus, Zhen Shen, Tripta Mishra, and Martin Gruebele 1 Supplementary

More information

Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases

Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3

More information

Microbial growth. Steve Zinder MBL June 11, 2013

Microbial growth. Steve Zinder MBL June 11, 2013 Microbial growth Steve Zinder MBL June 11, 2013 The obvious goal of any bacterium is to become bacteria. In e-mail signature of: Lizzie Wilbanks UC Davis Course student 10, TA 11 Queen of the berries Plos

More information

Nature Structural & Molecular Biology doi: /nsmb Supplementary Figure 1. CRBN binding assay with thalidomide enantiomers.

Nature Structural & Molecular Biology doi: /nsmb Supplementary Figure 1. CRBN binding assay with thalidomide enantiomers. Supplementary Figure 1 CRBN binding assay with thalidomide enantiomers. (a) Competitive elution assay using thalidomide-immobilized beads coupled with racemic thalidomide. Beads were washed three times

More information

Bioengineering Laboratory I. Enzyme Assays. Part II: Determination of Kinetic Parameters Fall Semester

Bioengineering Laboratory I. Enzyme Assays. Part II: Determination of Kinetic Parameters Fall Semester Bioengineering Laboratory I Enzyme Assays Part II: Determination of Kinetic Parameters 2016-2017 Fall Semester 1. Theoretical background There are several mathematical models to determine the kinetic constants

More information

BRIEF ARTICLE THE AUTHOR

BRIEF ARTICLE THE AUTHOR BRIEF ARTICLE THE AUTHOR 1 2 THE AUTHOR S Pd K Pd S mantle OC IC CMB Figure 1 Figure 1. Illustration of the SPdKS / SKPdS ray-paths with sub-segments labeled. SPdKS is an SKS that intersects the source-side

More information

Killing of Bacillus Spores by High-Intensity Ultraviolet Light

Killing of Bacillus Spores by High-Intensity Ultraviolet Light Killing of Bacillus Spores by High-Intensity Ultraviolet Light STUDY ON EFFECTS OF PULSED LIGHT Abraham L. Sonenshein, PhD Professor and Deputy Chair Department of Molecular Biology and Microbiology Tufts

More information

Supplements to : Isotropic stress reduces cell proliferation in tumor spheroids

Supplements to : Isotropic stress reduces cell proliferation in tumor spheroids Supplements to : Isotropic stress reduces cell proliferation in tumor spheroids Fabien Montel 1, Morgan Delarue 1,4, Jens Elgeti 1, Danijela Vignjevic 2, Giovanni Cappello 1, Jacques Prost 1,3 1 UMR 168,

More information

it is assumed that only EH and ESH are catalytically active Michaelis-Menten equation for this model is:

it is assumed that only EH and ESH are catalytically active Michaelis-Menten equation for this model is: initial rates for many enzymatic reactions exhibit bell-shaped curves as a function of ph curves reflect the ionizations of certain amino acid residues that must be in a specific ionization state for enzyme

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Comparing rotated- and nonrotated-state lifetimes among mrna m 6 A modifications in different codon contexts. a. mrna sequences used for each experiments, as same as shown in Figure

More information

Nanosized metal organic framework of Fe-MIL-88NH 2 as a novel peroxidase mimic and used for colorimetric detection of glucose

Nanosized metal organic framework of Fe-MIL-88NH 2 as a novel peroxidase mimic and used for colorimetric detection of glucose Supplementary Information for Nanosized metal organic framework of Fe-MIL-88NH 2 as a novel peroxidase mimic and used for colorimetric detection of glucose Ya Li Liu, a Xi Juan Zhao, a Xiao Xi Yang b and

More information

ab Caspase 3, Caspase 8 and Caspase 9 Multiplex Activity Assay Kit (Fluorometric)

ab Caspase 3, Caspase 8 and Caspase 9 Multiplex Activity Assay Kit (Fluorometric) Version 1 Last updated 6 April 2017 ab219915 Caspase 3, Caspase 8 and Caspase 9 Multiplex Activity Assay Kit (Fluorometric) For monitoring multiple caspase activation in live cells. This product is for

More information

Application Note: A TD-700 Laboratory Fluorometer Method for Alkaline Phosphatase Fluorescence

Application Note: A TD-700 Laboratory Fluorometer Method for Alkaline Phosphatase Fluorescence 1. INTRODUCTION Because of their critical functions in eukaryotic cells, methods for measuring protein phosphatases were established at least as early as 1953 1. In 1965 Fernley and Walker 2 decribed the

More information

7.06 Problem Set #4, Spring 2005

7.06 Problem Set #4, Spring 2005 7.06 Problem Set #4, Spring 2005 1. You re doing a mutant hunt in S. cerevisiae (budding yeast), looking for temperaturesensitive mutants that are defective in the cell cycle. You discover a mutant strain

More information

Supplementary Material (ESI) for Chemical Communications This journal is (c) The Royal Society of Chemistry 2010

Supplementary Material (ESI) for Chemical Communications This journal is (c) The Royal Society of Chemistry 2010 Synthesis of substrates 2,2-[ 2 H 2 ]-Decanoyl-CoA (3) was synthesised using an extension of the method previously described by us. 1 Thus, diethyl malonate 7 (Scheme 1) was deprotonated and the resulting

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09450 Supplementary Table 1 Summary of kinetic parameters. Kinetic parameters were V = V / 1 K / ATP and obtained using the relationships max ( + m [ ]) V d s /( 1/ k [ ATP] + 1 k ) =,

More information

Kinetics of an Iodine Clock Reaction

Kinetics of an Iodine Clock Reaction Kinetics of an Iodine Clock Reaction Introduction: In this experiment, you will determine the rate law for a reaction and the effect of concentration on the rate of the reaction by studying the initial

More information

Reconfigurable DNA Origami Nanocapsule for ph- Controlled Encapsulation and Display of Cargo

Reconfigurable DNA Origami Nanocapsule for ph- Controlled Encapsulation and Display of Cargo Supporting Information Reconfigurable DNA Origami Nanocapsule for ph- Controlled Encapsulation and Display of Cargo Heini Ijäs, Iiris Hakaste, Boxuan Shen, Mauri A. Kostiainen, and Veikko Linko* Biohybrid

More information