!" #$ $ #%$ $!" #$%& '(& )*""" & #'$

Transcription

1 !" #$ $ #%$ $!" #$%& '(& )*""" & #'$ specificprimer primers +,'(&$$-.%&Capsidproteinprecursor!primer Taul/F"#Taul/R+,+ 0''+1-$&2'(3&&4#51#5-'RT/PCR 6$&2# 7$%&'(3&&4#51 +$$$$50- '1#5-.primer Taul/F Taul/R2.+ $8$ 2&4#51 7+,2-19 '':$4#$;<== * '&'4:=> > '&'4:052$$ 5 ' $2.09.%&$5&#Phenylalanine +,2-'(3&1 7119$.$ 2 7':$4#$+,'?$5&#Leusine<+'?115.'(3&& 4#51 - &.$$50%&1+,&2 3+3+$19 $5&2 ;-$& 2'(3&&4#5#5$@+5'%$'(3&$$50%5A/> $ 5 1 +,$15$$$50B2.$5&95C-'D 9 $15 2'(3&1.2$ %&$-$.+,1.15 2'(3&6$&2( $5'(3&1 -$5&#5-'RT/ PCR 2.$5'(3&&4#51 $$. &.$$503.'5(&$C 7;<'5(& E8C F!*)#5-.primerTaul/FTaul/R-'%(3+, 9 5@'' G 9 5$ '2+2 $$505'(3&5&$B5#&4<, $8&$%&#$. $ 1'(3&1 +,2.-9H. $2-$.&F"IA" +,'+3-2.&5#5 &.$B-(3+,':,0 $2 $8'?&'JK&+502''(&$$B+,' ':2..-9H.+ $855+%2''(&$ ($)$$$50&4#5#7$1TSVprimers

2 F STUDY ON TAURA SYNDROME AND SEQUENCES OF TAURA SYNDROME VIRUS IN BLACK TIGER SHRIMP (Penaeus monodon) IN THAILAND Chaiwud Sudthongkong Samutsakhon Coastal Fisheries Research and Development Center, P.O. Box 50, Samutsakhon 74000, Thailand ABSTRACT Taura syndrome virus of black tiger shrimp (TSV-BT) isolates were classified using the Taul-F and Taul-R which was developed as a new primer set generated from the capsid protein precursor of taura syndrome virus. The new primer set showed high sensitivity and specificity to TSV-BT. The homology of nucleotide sequences indicated that TSV-BT strains were 99.4 % similarity to TS sequenced from Taiwan TSV and 98.8% to Mexico TSV. Alignment of amino acid sequences in taura syndrome virus strains from Thailand and Taiwan were different from Mexico strains in the same position of 1 amino acid residue found as Phenylalanine for Thailand and Taiwan strains and Leusine for Mexico strains. Therefore, the possibility of TSV isolated from TSV-BT is originated from Taiwan TSV. Taura syndrome virus isolated from black tiger shrimp were challenged to 6-8 gram shrimp by injection. Hundred percent mortality was found 3-day after injection, while no mortality was found in control group. The challenged samples were confirmed by RT-PCR technique. The results showed all samples were infected with TSV-BT. During February to May 2004, shrimp samples were collected from Chachoengsao, Ratchaburi, Nakron-Pathom, Samutprakarn, Samutsakhon, Samutsongkhram and Petchaburi provinces. Infections of TSV were found in black tiger shrimp in all provinces. Symptom and lesion of diseased shrimps were different depended on the levels of infection by TSV. TSV mostly infected shrimp between days in grow-out pond rearing in low water salinity, showing as multiple melanized on shell, but in high salinity water white spotted on shell was observed. Keywords: black tiger shrimp, Taura syndrome virus, sequences, TSV primers

3 D $ $ #&5'?#+,0'+9.&'8G$$''+3$%LPenaeusvannamei '?&.#5+$23$-M'+3$-$$2$.30& %&&. Guayaquil ''&$5&'(,&'5(&; F!D! '''#'2+ 'N&5#&1N#NN'9G&'$$$<$8;<'9$%&$+,6. -9O 5 F!D)/F!D> 15'9$%&$.'$5$$5'(3&1+,(,&. &4#51 LTaura syndrome virusp 4<,3(,&9.+,2$.25-3$ LLightner et al Q R==!P 3. F!D!/FDD> &4# M'+3$. -9H.-&'$ #5$%.$$#.&/.7$+,5'(3&&4#51 LOIE Q F""DP 9$315+$'$5#25+,+ $8'5+$+,G':$4 '9G&'$ 3.$'5(&E8C;<'5(&; F!D>;<$25%&#&+,0-9$%-2.& '+3%&''&;< >"S/="S 15+%&8G;<'9$.25%&&4#5 1 LTSVP.+'?115.'$5$$0'%$%7$N '+3'?.&/.7 $$7$1-+,.O &.1$: 15+$.&/.7$% -#'M$-'$ N1.2$5'(3&&4#51$.&$'$5#25-G':$4 LOIEQ F""DP.&-'5(& $$T F!D> 15+$$%& Texas Department of Park and Wildlife ;<$5'(3&& 4#51-$%7-&.':$4#$ G':$4.1.$2.&'(,&,-C%& $%7-&.':$4#$-.$ 4<,.&15+$5'(3&&4#51-$%- '&'+ +,0'%$9.''+3$% -C-%&G':$4 4<,&'?5',%&$.25%& &4#51-'&'+4<,;<'H+,B+'$19LJohnsonQR==!P $H9%&$'+3$$50-'19U+,6.+3H9#$#$ $$50$,00-9'$8$9&&$#5$0$%'+3'(,&$$%+$ 5 7#':+.&9,00-9'$8$-9-'+3',$%<3-.R/F U+,6. 66$$505+$',%&66$%$%<32.-2(3+,'+,'+3$% $$.>" '&'4:L;$$''+3 30VQ F!*)P '?6-9 &$$ 7$%',$%<3&.5':$&2$ 2-.$.&UF!*A G291.0'%.&. 7$%0-9+$ $&20'%.&/. 7$$%4<,.&. 7$%5 $ $9'(3&1$.&$'7 &4#51 LTaura syndrome virusp 4<,5'? RNAW single/stranded LssRNAP virus +,+ = $#'2 LKbP LBonamietal R==)P 2.+$25-4+$#$ $LLightneretal QR==!P.25'%-'&'+#5'@-+'$19 <'? '99<,+,0-9#+3.25-'1&.5': 2$@#&-$' 5' RT/PCR -9.%&$#5'@$+1.'+&.&$-92$'$8$

4 * ;<.-.-$+,.&%'(,&'+2$ 2$1 55%5' PCR &'. 0-9+&.$.'%+,9&X2$ PCR '?0$ $8 &.$-'&7& <,23&-'$$. R 59 ;<C%&'&7&+,'$8$ --$'$:2 $8 &.$&+C,0 0-96$&2'(3&1 #5'@'(3&&4#51 LTSVP +,'?RNAvirusH91.;15#5-5PrimerL55+'&:'&22-$'9 5+'&:'&'Y9P+,15$.(&&2#%&OIELprimer=R=!===FP#5'@$ &4#51 -$$50 2.&3+,$ '$ $8C&$%&$B 9(&$+,'$:2 $8 -'&7& + $8$ L+,+$$5'(3&&4#51.6$&25' RT/PCR#5-Primer=R=!===F-96$1.5'$&2$2+.TSV+,2- '1'? 7-9.+,$ 7$'51 LFlegel et al Q F""DP 0-90'?&+$ 5&21 %<3-9. #5'@$9 Primer.+,'9+1-$9 7$%&'(3&&4#51 +,2-$$50%&15 3'(,&$@ #+,'$5$ &4#51-$$ $,%<3 #5;<$<$8&$5'(3& $. 25%&'(3& &5$0$71 TSV <0'?&. RT/PCR Primer 092 9'(3&&4#51 ;<.&.3+7$%&1-'%%,0 #5'@$5'(3&%&$$# 3+3 '(,&Y&$.25%&#1$2$$+,01 '+3-(3+,,' *+",$ R &&$22Oligonucleotideprimers0927+$&222one/stepRT/PCR+,+1 0''.&7$%&'(3&&4#51 F <$8 $87$%&&4#51+,$15$$$50+,5&$B'(,&-'? %&(3G-$(29;<9.+,%&'(3& #5$'+2'+26%& primer +,6%<3$2 primer=r=!q===f+,oie$- D '(,&<$8$&2'(3&&4#51-$$50 $8&$&$%&$. "-,./$ $ 01$&&$Primer$$ $&&$22Specificprimer092TSV+%3&5.&1+3 R <$8%&57$%&&4#51$G%&- NCBI $&&$22primer$'97$

5 ! F &&$225 Primer +,+10''.&7$-'(3&&4#51 #5-G%&#$$&&$22$GenBankdatabase D $5RNA$&.$$50#5-Tri/zol Z ReagentLGibcoBRLP7+%&ArnoSewall SharonMcRaeQTechnicalServicesLifeTechnologiesQInc RockvilleMaryland * '(&$. RT/PCR primer +,+10''.&7$%&'(3&&4#5 1$+,5--$<$8$5'(3&&4#51-$$50&.#5&9 $$(& / '(&$09.%&primer+,hybridizes$2Rexon+,09.%&D[&+$<,9<, %&!['(,&.&$2exon09.%&primer+,'(&$+&.&Rintron / MeltingtemperatureLT m P1.,0$.&9C-.Reverse/transcriptionreaction#5 015$T m \FCxLA]TP]*CxLG]CP / +GCcontent$$.!"'&'4: / 9+$'+,Primer+,'$5Secondarystructure / 9+$'+,complementary 3.F'2LbasesP +,09.%&D[ %&3F''(,& Y&$$'$5primer/dimer / Primer+R>/D"nucleotides! 0RNA +,$ 515&27C$-#5-7$%&'(3&&/ 4#51 5'RT/PCR.$ 2'&14SuperScript TM IIIOne/stepRT/PCRwith Platinum Z TaqkitLInvitrogen TM P#5-.primer5-9.+,&&$22-9+0'' -.%&Capsidproteinprecursor%&&4#51 0R.(&TauR/FTauR/R '+2'+2$ 2.primer =R=! ===F-.(&# %&OIE LF""DP$5&2- '(,&', 7$$LThermalcyclerP$+,9&APOLLO.ATC*"RIdaho. Rapidcycler A 0PCR products +,156#5-'gel electrophoresis.&5;2dna C-UV 21$-3. $ R15'(&$PCRproducts+,+DNA5$%& '!!('&('"')*+,* $% (-.(!'/012(34/565) L:#( '$-; '- ' ' ("#'$<+,2'(3&&4#5 1-$$50 $5 DNA $ Agarose gel #5-5$5 DNA Gel Extraction Kit LMilliporePcloningDNA7+G-Molecularcloningalaboratorymanual $3.&. DNA +,15$$ cloning Lplasmid DNAP 1$7$ #5- DNAsequencerABIPRISMmodelDR""$ F '+2'+2 $87$+,$15(& $'+052+#&15$5&#%&&/ 4#51 LAlignment of nucleotide and amino acid sequences of Taura syndrome virusp;<'&'4:$$2%&-genbank

6 A 41$ &#& $ D R$$'+'(3&&4#51$ 5'(&$$$50.+,5&$B$#& +, (&5%$&. '(&$$95 95@'' 025-#$.25 LHomogenizerP +,+ &9'+3'4 L/R! medium $30$$&'(3&'(,& 55'&.-$& 6.membranefilter%5" F^m '(,&--$5& D F$'+&.$5& $.+,'+3-2.&5-'% 9 5&$'+3*!. &.1$ &5'(3&TSV 5'RT/PCR #5-.Primer +,&&$22%<3-9.0$'+3-; %5F -9&9':5 F(3&-9&$',31D -9$ 2 '%$ 2C-9&X2 $< 01@+5&9'+3'4L/R!medium+,+'(3&TSV'%$'(3&&+,A#5@+5 " RS %&309 $ 2.-.5&+,+%5F"! -.30'':!. 0R"0D430.$.2@+5&9'+3'4L/R! medium+,1.+'(3& TSV " RS%&309 $ 2.-.! 0D430-9.$5&+$-9&9':5 F355$&$ $ 5 $ 01$&&$Primer$ =" RT>PCR Primer!?!2%(?&$"###(?!@( Capsid proteinprecursor@( $%&!('&('"$%624($A! $@ 77)bp?&%!TauA>F"#TauA>R2%( (==(!(@(Primers &?-$%A PrimerTauF TauR! " capsidproteinprecursor #$%&'()*"

7 ) Primer (-. &"#C(? "#"0" B7-1C1 A!$? + PCRproducts &'()*" M, DNA marker- P, TauF.TauR /00+ bp1-oie/+2bp1, 678$Negative$control 3 &43agarosegelelectrophoresis 2156!78&'()*" ="( &((0' -$$@& "? GenBank!( &(( 0'@( $%&'&('" DTSV>BTE Taura syndrome virus>black tigershrimp<7abbp"#-"( -F#Daminoacid<A9Gaminoacidresidues "&( &((0'?!@(coatproteinDcapsidproteinprecursor<$%? $%&'&('" DGenBank acc AYG77G*BE Chang et al5h )**8< '&(# Metapenaeus ensis DGenBank acc AYG77GA*E Chang et al5h)**8< "#'&(@ P vannamei GenBank acc AYG77GAA DChang et al5h)**8< $%"$(#& 2('&(@$%"$(?-#6 C GenBank acc AF)99G9I DRobles>Sikisaka et al5h)**a< "# GenBank acc AF)99,97 DMari et al5h)**)< 2( BB58-1C1H BB58-1C1H BB -1C1H BI5I -1C1 "# BI59-1C1"?@J#$%#!BB58-1C1HBB58-1C1HBI5I-1C1HBI5I -1C1 "# BI5I -1C1 " $(""$1"## Dnucleotide and amino acid alignments<?!@( coat protein $%? TSV>BT -$$@& "? GenBank #!($% AAI Histidine!( 0'1@( GenBank acc

8 > AYG77G*B DTaiwan>BT<H GenBank acc AYG77GA* DTaiwan>Meta<H GenBank acc AYG77GAA DTaiwanVannamei<HGenBankaccAF)99G9IDMexico>Vannamei<"#GenBankaccAF)99,97 0'1TaiwanVannamei!( 0'1%(!($%A)7Cytosine-FArginine"# 0'1 MexicoGenBankaccAF)99G9IDMexico>Vannamei<"#GenBankaccAF)99,97DMexico> Complete< $!((0' TSV>BTH Taiwan>Meta "# Taiwan>Vannamei?"$1!($%A98D#!($%AAI<Phenylalanine-F LeusineD-$%7< $(""$1"##-"$%-"( Silent Silent $%:#? 0'1 TSV>BT "#Mexico$%!(9)"#GG,D-$%7< TSV-BT tttttacaaggagcattgtggctgtggaataagatgaatgctaagcagacatcaattatt F L Q G A L W L W N K M N A K Q T S I I Taiwan-BT F L Q G A L W L W N K M N A K Q T S I I Taiwan-Meta F L Q G A L W L W N K M N A K Q T S I I Taiwan-Vannamei F L Q G A L W L W N K M N A K Q T S I I Mexico-Vannamei F L Q G A L W L W N K M N A K Q T S I I Mexico-complete F L Q G A L W L W N K M N A K Q T S I I TSV-BT cgacgcactctcacagaacacctacgctctattacatcatttcctggcattgagatgaac R R T L T E H L R S I T S F P G I E M N Taiwan-BT cac Taiwan-Meta R R T L T E H L R S I T S F P G I E M N cac R R T L T E H L R S I T S F P G I E M N Taiwan-Vannamei cac R R T L T E H L R S I T S F P G I E M N Mexico-Vannamei tac R R T L T E H L R S I T S F P G I E M N Mexico-complete tac R R T L T E H L R S I T S F P G I E M N TSV-BT ttgcagtctgaagctcgagctattactctttcgattccttatactagtgagtttcaggtt L Q S E A R A I T L S I P Y T S E F Q V Taiwan-BT L Q S E A R A I T L S I P Y T S E F Q V Taiwan-Meta L Q S E A R A I T L S I P Y T S E F Q V Taiwan-Vannamei L Q S E A R A I T L S I P Y T S E F Q V Mexico-Vannamei ttg L Q S E A R A I T L S I P Y T S E L Q V Mexico-complete ttg L Q S E A R A I T L S I P Y T S E L Q V

9 TSV-BT tttaaccccagaaatgtgaataacctaaattctattcggctttccgttctgagtcaattg F N P R N V N N L N S I R L S V L S Q L Taiwan-BT F N P R N V N N L N S I R L S V L S Q L Taiwan-Meta F N P R N V N N L N S I R L S V L S Q L Taiwan-Vannamei F N P R N V N N L N S I R L S V L S Q L Mexico-Vannamei F N P R N V N N L N S I R L S V L S Q L Mexico-complete F N P R N V N N L N S I R L S V L S Q L = TSV-BT caaggtcctgaagatgtagaatccgcatcttattctatttatggcaggttgaaaaacatc Q G P E D V E S A S Y S I Y G R L K N I Taiwan-BT Q G P E D V E S A S Y S I Y G R L K N I Taiwan-Meta Q G P E D V E S A S Y S I Y G R L K N I Taiwan-Vannamei Q G P E D V E S A S Y S I Y G R L K N I Maxico-Vannamei Q G P E D V E S A S Y S I Y G R L K N I Maxico-complete Q G P E D V E S A S Y S I Y G R L K N I TSV-BT aagctatatgggcatgccccatctgtgacatcttctgtatatccgtctactcattccgga K L Y G H A P S V T S S V Y P S T H S G Taiwan-BT cag K L Y G H A P S V T S S V Y P S T Q S G Taiwan-Meta cag K L Y G H A P S V T S S V Y P S T Q S G Taiwan-Vannamei ccag K L Y G H A P S V T S S V Y P S T Q S G Maxico-Vannamei aaatcacag K L Y G H A P S V T S S V Y P S T Q S G Maxico-complete gcgtcacag K L Y G H A P S V T S S V Y P S T Q S G TSV-BT tatgatgatgattgtcccatcgtgcatgcgggaactgatgaggattcttctaaacagggg Y D D D C P I V H A G T D E D S S K Q G Taiwan-BT att Y D D D C P I V H A G T D E D S S K Q G Taiwan-Meta att Y D D D C P I V H A G T D E D S S K Q G Taiwan-Vannamei cgtatt Y D D D R P I V H A G T D E D S S K Q G Maxico-Vannamei att Y D D D C P I V H A G T D E D S S K Q G Maxico-complete att Y D D D C P I V H A G T D E D S S K Q G TSV-BT attgtctcaagggttgcagacaccgttggtgcggtggcaaatgtagtagatggggtagga I V S R V A D T V G A V A N V V D G V G Taiwan-BT I V S R V A D T V G A V A N V V D G V G Taiwan-Meta I V S R V A D T V G A V A N V V D G V G Taiwan-Vannamei I V S R V A D T V G A V A N V V D G V G Maxico-Vannamei I V S R V A D T V G A V A N V V D G V G Maxico-complete I V S R V A D T V G A V A N V V D G V G

10 TSV-BT gtacctattctatccacaattgccaagcctgtttcctgg V P I L S T I A K P V S W Taiwan-BT V P I L S T I A K P V S W Taiwan-Meta V P I L S T I A K P V S W Taiwan-Vannamei V P I L S T I A K P V S W Maxico-Vannamei V P I L S T I A K P V S W Maxico-complete V P I L S T I A K P V S W TSV/BT\7$%&&4#51+,$15$$$50+,'+3-'1 Taiwan/BT\7$%&&4#51+,$15$$$50+,'+3-19 Taiwan/Meta\7$%&&4#51+,$15$$$5+,'+3-19 Taiwan/Vannamei\7$%&&4#51+,$15$$%+,'+3-19 Maxico/Vannamei\7$%&&4#51+,$15$$%+,'+3-'':$4#$ Maxico/complete\7$%&&4#51+,$15$$%+,'+3-'':$4#$ R" 0 9)'(*)3 )'( #$%&'()*" /Alignment of nucleotide and amino acid sequences of Taura syndrome virus1 :") ")'(*)3 )'( "9!783$; 2<9 #$%&'()*"88) "($%& TSV :$@&"&"(& TSV?##" "($%!@('&(?"'!'"##"9@("( 55($%A * /9$0$ /9*#:&$TSV$#;/ 9$2 0$.L430!P TSVLP $.2'(3& $ ,RQFQD 430+,RQFQD R RQRQF "Q"Q" F FQFQR "Q"Q" D FQFQF "Q"Q" * "Q"Q" "Q"Q"! "Q"Q" "Q"Q" A "Q"Q" "Q"Q" ) "Q"Q" "Q"Q" $+,LP!Q!Q! "Q"Q"

11 RR 28)")/=#%188)>9)9(?8)/=#%188)>9)9( "8 '63 =" Taul-F "#Taul-R$%$? @( '&('"?-#6%&Flegel LF""DP -F '2%($%?& &RT/PCR &! primer #"#$ -# -#J9*>B*-1C1$'?!$?&?"'&('"## ="( "?GenBank!( &( $%&!('&('"DTSV>BT<$% (-.& '!C(!(K(!'/012(34/565)789 7ABbp D#A9Gamino acid residues<"&( protein precursor$%??&"#-#6c (2(BB58IBB -1C1 "# BI59>BI5I-1C1""#(#!($%AAID"$1!($%A98<

12 RF -FLeusineD -$%7<(2($-F&$% "$1(-"$%-"(-!%-"( 0'(!-F# 2%( (?&C! @& 0'1!'&('"&%( $-FRNA virus 2%($?"0'1& (2%( LR==)P +,$..RNA virus -F$%$""(0'$"4J#!64$ "0'1$% (2($%!(C( $% $#"0'1!(!%("#!#-%-#6&("#2(4= &"$('&((!C2( "($$%4= (2(C$624 '&(-.'&($%%( ( ="624!('&('" '!C!('&('"$%"$(?( '(@(!'&(($"4J#"&'&(@ $#!-"!"#" L+,DP2%(-F"4J#%-$%bacteria shell DABB,<!'&(@$%?!(#!("$(!!("4J#!$?$%"$('&(?#C%2('&(-.($%'($% $@L+,*P2%(4?($%

13 RD $$!_($`"&( (> 2%(C!("# "&( &(-RPCR&"( (!-L)78, (?"0'1'&('"!"("$(2(-F(2%( #-F="?& %K$%! &"0'1"#!# &( $!' 86 '"6$"#'J 0S-TU&&&$%" 1 6 1"#-#(NVU( ' $%!"?( "' Bonami, J.-R., Hasson, K.W., Mari, J., Poulos, B.T. and Lightner, D.V Taura syndrome of marine penaeid shrimp: characterization of the viral agent. Journal of General Virology 78: Chang,Y.S., Peng, S.E., Yu, H.T., Liu, F.C., Wang,C.H., Lo,C.F. and Kou,G.H Genetic and phenotypic variations of isolates of shrimp Taura syndrome virus found in Penaeus monodon and Metapenaeus ensis in Taiwan.. Gen. Virol. 85, Domingo, E., Holland JJ RNA virus mutations and fitness for survival. Annu Rev Microbiol. 1997;51: Flegel, T.W., Nielesen L., Sang-oum W Outbreak of Taura Syndrome Virus (TSV) with exotic Panaeus vannamei cultured in Thailand. JSPS-NRCT international symposium on Fac. of Fisheries, Kasetsart Univ. BKK. Thailand 8pp. Johnson, S.K Taura virus hits Texas. World Aquaculture 26: Lightner, D.V. and R.M. Redman New and emerging infectious and non-infectious diseases in commercial shrimp culture. International Symposium on Aquatic Animal Health (Seattle, 4-8 September ), p. V-3.

14 R* Lightner, D.V., Redman RM., Hasson KW., Pantoja CR1995 Taura syndrome in Penaeus vannamei (Crustacea: Decapoda): gross signs, histopathology and ultrastructure Dis AquatOrg 21: Lightner, D.V A Handbook of shrimp Pathology and Diagnostics Procedures for Disease of Culture Penaeid Shrimp. World Aquaculture Society, Baton Rouge. Mari, J., Poulos, B.T., Lightner, D.V. and Bonami, J.R Shrimp Taura syndrome virus: genomic characterization and similarity with members of the genus Cricket paralysislike viruses. J. Gen. Virol. 83 (Pt 4), OIE, Office International de Epizooties Diagnostic Manual for Aquatic Animals Diseases. Office International de Epizooties, Paris. Robles-Sikisaka, R., Garcia, D.K., Klimpel,K.R. and Dhar, A.K. 2001Nucleotide sequence of 3'-end of the genome of Taura syndrome virusof shrimp suggests that it is related to insect picornavirusesarch. Virol. 146 (5), Shaun, M. Moss, Brad J. Argue, Frank L. Castille, Steve M. Arce, Jeffrey M. Lotz, Verlee M. Breland, Donald V. Lightner, Brenda L. White, Craig L. Browdy, Sarah Y. Prior, Addison L. Lawrence, Harold Bowers, and Robert A Family Survival of Pacific White Shrimp Litopenaeus vannamei to Taura Syndrome Virus in Field and Laboratory Challenges, Bullis. Oceanic Institute, Waimanalo, Hawaii. World Aquaculture Society.