ASSOCIATION OF CANDIDATUS LIBERIBACTER SOLANACEARUM WITH THE DECLINE OF TOMATO (SOLANUM LYCOPERSICUM L.)

Transcription

1 Journal of Plant Pathology (2016), 98 (2), Edizioni ETS Pisa, ASSOCIATION OF CANDIDATUS LIBERIBACTER SOLANACEARUM WITH THE DECLINE OF TOMATO (SOLANUM LYCOPERSICUM L.) R.I. Rojas-Martínez 1, E. Zavaleta-Mejía 1, D.L. Ochoa-Martínez 1, I. Alanís-Martínez 2 and F. García-Tapia 3 1 Postgrado en Fitosanidad-Programa de Fitopatología, Colegio de Postgraduados, Montecillo, Texcoco, Edo. de México, México 2 Estación Nacional de Epidemiología, Cuarentena y Saneamiento Vegetal, SENASICA, México 3 Dirección General de Inspección Fitosanitaria, SENASICA, México SUMMARY Among the problems affecting the tomato crop (Solanum lycopersicum L.) are those induced by pests and diseases that have caused a reduction in the cultivated area. Since 1998, the insect Bactericera cockerelli has caused phytosanitary problems in many solanaceous crops, such as tomatillo (Physalis ixocarpa), potato (Solanum tuberosum), eggplant (S. melongena), chilli (Capsicun annum) and tomato (S. lycopersicum). The insect is present in all tomatoproducing areas of Mexico. In recent years in the United States, a new disease known as Tomato decline has been detected in tomato; the symptoms include chlorosis of apical shoots, lanceolate leaflets with epinasty and margins with purple coloration, necrosis and abortion of flowers, mature leaves brittle and rolled up, reduced internodes and reduced growth. In Mexico, a similar disease is present in tomatoes and it has been postulated that B. cockerelli is the vector of a phytoplasma inducing such symptoms. Some evidence suggests that the decline could be induced by Candidatus Liberibacter solanacearum. Therefore, the aim of this study was to determine if the bacterium is associated with the decline of tomato. The positive detection of Candidatus Liberibacter solanacearum by qpcr in grafted tomato plants, or those exposed to B. cockerelli carrying the bacterium and its presence in the phloem of infected plants, confirmed that the bacterium is associated with this disease. Key words: Bacteria limited to the phloem, real time PCR, psyllids of tomato. Corresponding author: R.I. Rojas-Martínez Fax: ext rojas@colpos.mx INTRODUCTION The bacterium Candidatus Liberibacter solanacearum was reported for the first time in a crop of tomatoes in New Zealand, causing mottling, yellowing, deformation of the leaf lamina and sudden death of the plant (Liefting et al., 2008). This bacterium was recently assigned the name Candidatus Liberibacter solanacearum (CLso) (Liefting et al., 2008, 2009). Its vector Bactericera cockerelli (Liefting et al., 2008) transmits the causal agent of the disease known as Zebra chip (ZC) in the potato crop in the United States (Abad et al., 2009), New Zealand (Liefting et al., 2008) and Mexico (Munyaneza et al., 2010). CLso affects species of the family Solanaceae, from which it gets its name. However, it was found affecting carrots in Finland in 2010 (Munyaneza et al., 2010), in Sweden and Norway in 2011 (Munyaneza et al., 2012a, 2012b), and in Spain in 2012 (Alfaro-Fernández et al., 2012). Recently, it was also reported in France on the same crop (Loiseau et al., 2014). In tomatoes, it causes rolling and yellowing of the leaves, and stunting and deformation of the fruit in some varieties. Liefting et al. (2008, 2009) mention that, in chili, the symptoms show as deformed leaves that are pale green or yellow with short petioles, loss of flowers and sudden death of different parts of the plant. On the other hand, Camacho-Tapia et al. (2011) indicate that in Mexico the symptoms induced by the bacterium in chili are chlorotic veins, deformation of the leaf lamina and pale and variegated fruit. In potato, the disease caused by this bacterium induces chlorosis of the leaves, deformation of the stems often in a zigzag form, development of aerial tubers, blackening of the vascular system and folded or wilted leaves. However, only the presence of necrotic medullary rays throughout the tuber are considered typical symptoms for diagnosis of ZC disease (Munyaneza et al., 2007). Secor et al. (2009) describe the extensive brown coloration of the vascular ring and medullary rays throughout the entire length of the tuber as the diagnostic symptom that separates it from other known diseases of potato. In carrots, the symptoms consist of yellowing, chlorosis and deformation of the leaves, reduction of plant size and proliferation of secondary roots (Munyaneza et al., 2010). Because the feeding of nymphs of B. cockerelli on the plant causes yellowing, it has been speculated that they

2 192 Candidatus Liberibacter solanacearum in Solanum lycopersicum A Journal of Plant Pathology (2016), 98 (2), B Fig. 1. Tomato plants (Solanum lycopersicum L.) with decline. A) Symptoms of chlorosis, lanceolate leaves with epinasty and purple margins, necrosis and reduced growth; B) leaves with yellowing and mosaic. inject a toxin that is the primary cause of the symptoms, but this hypothesis has not been confirmed (Eyer, 1937 cited by Kikushima, 2005; Ferguson and Fraser, 2003). Garzón et al. (2009) reported a new disease of tomato named permanente del tomate. It was associated with B. cockerelli and they mention that the insect is able to act as vector of a bacterium, with a transmission efficiency of 20% when the periods of acquisition and transmission are of at least 15 min, whilst with feeding periods of 2 to 24 h transmission efficiency is 40%. A syndrome similar to permanente del tomate but of unknown etiology had already been reported in the Imperial Valley of the United States, causing annual damage of 45% over approximately 20,000 hectares (Kikushima, 2005). It has been suggested that this problem is caused by phytoplasmas, but the results of tests intended to confirm this have not been conclusive (García-Tapia, 2007). The symptoms of permanente del tomate consist of chlorosis of apical shoots, lanceolate leaves showing epinasty, necrosis and abortion of flowers, fragile mature leaves that roll upwards, and reduced plant growth. Recently, a disease of tomato known as decline has been found in Mexico, with symptoms very similar to those described for permanente del tomate, except that the leaves also show purple coloration on their margins. On the basis of the above, the objectives of the present study were to determine whether an association exists between decline of tomato and Candidatus Liberibacter solanacearum through grafting, bacterial transmission, electron microscopy and detection of the organism by PCR of tissue from diseased tomato plants. MATERIALS AND METHODS Collection of plant material, grafting and transmission by B. cockerelli. In commercial tomato glasshouses located in Ixtlahuaca in Estado de Mexico, leaves and shoots were collected from tomato plants showing symptoms of chlorosis, lanceolate leaves with epinasty and purple margins, necrosis and reduced growth (Fig. 1 A, B). The shoots were grafted onto 25 healthy tomato plants (one shoot/ plant) by making a diagonal cut in an axil and securing the shoot with parafilm; the grafted plants were covered with a plastic bag for 7 days to maintain the humidity and kept in a glasshouse with a diurnal temperature of 25 to 30 C. The symptoms that appeared on grafted plants were recorded weekly. As controls, there were 10 healthy nongrafted plants. From the same commercial glasshouses, adults of B. cockerelli were collected from tomato plants showing the symptoms previously described. One hundred insects were analyzed by PCR to check whether they were carrying the bacterium. From the other insects, fifty individual adults of B. cockerelli were transferred to a cage covered with tricot fabric and containing 20 healthy tomato plants with ten green leaves, where they were kept for 60 days, over which period there were several generations of insects. As controls, 20 healthy plants without insects were kept in another cage. DNA extraction. DNA was extracted from tomato plants showing symptoms by the method suggested by Doyle and Doyle (1990), with some modifications: 0.1 g of tissue was macerated with 1 ml of buffer TE 1 (TrisHCl 100 mm, ph 8, EDTA 50 mm, ph 8.0, NaCl 100 mm, β-mercaptoethanol 0.3%). The samples were centrifuged at 14,000 rpm for 8 min. The supernatant was decanted, 800 μl of extraction buffer (Tris-HCl 100 mm, ph 8, NaCl 1.5 M, EDTA 20 mm, ph 8, CTAB 3%, PVP 40 4%, β-mercaptoethanol 0.3%) were added and the tubes were incubated for 40 min at 65 C. Afterwards, 700 µl of chloroform:isoamyl alcohol (24:1) were added, mixed and centrifuged for 8 min at 14,000 rpm. The supernatant was

3 Journal of Plant Pathology (2016), 98 (2), Rojas-Martínez et al. 193 A B C D E Fig. 2. Symptoms of decline in tomato plants exposed to Bactericera cockerelli. A) Leaves in the shape of a spoon; B) reduction of leaf lamina; C) leaves with violet borders and D) yellowing; E) insects feeding on and colonizing tomato plants. transferred to a new tube containing 800 µl of absolute ethanol and the DNA was allowed to precipitate for 1 h at 20 C. The quality of the DNA was verified on a 1% agarose gel and the concentration determined with a spectrophotometer (Nanodrop ND-1 V 3.2.1) at an absorbance of 260 nm. Detection of Candidatus Liberibacter solanacearum in Bactericera cockerelli by real time PCR. The extraction of DNA from the psyllids and plants was made with 3% CTAB after Doyle and Doyle (1990). The real time PCR reactions were carried out in a thermocycler CFX-96 (Bio Rad ). The primers and probe reported by Li et al. (2009) were used: LSOf (GTCGAGCGCTTATTTTTA- ATAGGA), HLBr (GCGTTATCCCGTAGAAAAAGG- TAG), HLBp (FAM/AGA CGG GTG AGT AAC GCG/ BHQ-1), and the primers and probe reported by Wen et al. (2009) Lps-F (GAGCGATAAGCTCAAGAAAAGAA), Lps-R (CTCAAATGACCCCATCAACC) and LpsP (FAM- AAGTTCTAA GGGATCGCCGT-BHQ1). For both psyllids and plants, the reactions were carried out in a final volume of 25 μl, with the following concentrations: 6 μm of each primer, 3 μm of the probe, 1 PCR buffer, 6.0 mm MgCl 2, 0.24 mm dntp, one unit of Taq Platinum (5 U/µl, Invitrogen) and 2 μl of DNA. The amplification program was: one cycle of 20 s at 95 C, 40 cycles of 95 C for 1 s, T 58 C for 40 s (to read the plate). Negative controls (water) were included in the reactions. Electron microscopy. Samples of tissue (stalks and main veins) from leaves of tomato showing the symptoms described above were cut into longitudinal pieces of 1 to 1.5 cm. These were cut through the center to expose the phloem and fixed for 24 h in 3.0% glutaraldehyde in phosphate buffer of 0.1 M ph 7.2 (70 mm NaH 2 PO 4, 30 mm KH 2 PO 2 ). Afterwards, the samples were processed and mounted for observation under the scanning electron microscope according to Chen (2012). The ultrathin sections were observed in a scanning electron microscope JOEL JSM RESULTS Fifteen days after making the grafts of shoots from plants with symptoms of decline, yellowing of leaves and violet coloration of apical buds was observed in the previously healthy stocks. In the plants exposed to B. cockerelli, symptoms became evident 21 days after introduction of the insects. The symptoms observed were a delay in growth of the plants, shortened internodes, yellowing and rolling upwards of the leaves, violet coloration, chlorosis and occasionally albinism (Fig. 2). The presence of CLso in the insects contained in the cages (Table 1) and in the grafted plants (Table 2) was confirmed by qpcr. The control plants did not show symptoms and the bacterium was not detected in them.

4 194 Candidatus Liberibacter solanacearum in Solanum lycopersicum Journal of Plant Pathology (2016), 98 (2), Table 1. Values of Ct obtained in real time PCR for the detection of Candidatus Liberibacter solanacearum in Bactericera cockerelli. Sample ID FAM Std/Res FAM Ct Candidatus solanacearum 1 POS Candidatus solanacearum 2 POS Candidatus solanacearum 3 POS Candidatus solanacearum 4 POS Candidatus solanacearum 5 POS Candidatus solanacearum 8 POS Candidatus solanacearum 9 POS Candidatus solanacearum 10 POS Candidatus solanacearum 11 POS Candidatus solanacearum Control 3 NEG 0 Candidatus solanacearum Control 3 NEG 0 Candidatus solanacearum Control 3 NEG 0 Candidatus solanacearum Positive Clon C112 2 POS Candidatus solanacearum Positive Clon C112 2 POS Candidatus solanacearum Water 1 NEG 0 1 Water; 2 Positive Bacteria Control and 3 Healthy insect. Electron microscopy. In the phloem of the pieces of stalks a range of bacterial cell forms were observed after processing for electron microscopy; bacterial cells of the coccus form and some pleomorphs were observed (Fig. 3). These bacterial cells were found equally in stalks from symptomatic grafted plants and symptomatic plants that were in contact with the insects. DISCUSSION The detection of Ca. Liberibacter solanacearum through qpcr in grafted plants and plants exposed to insects carrying the bacterium, as well as its presence in the phloem of grafted plants and plants exposed to insects carrying the bacterium (Fig. 3), confirm the association of this phytopathogen with decline of tomato. Chen (2012) observed preparations under the scanning electron microscope and reported the presence of bacterial cells in bacillus, coccus and pleomorphic forms in the phloem of tomato plants infected with CLso, corresponding to different life cycle stages of this bacterium. In our study we observed mainly bacterial cells of the coccus form, although we also found bacilliform cells showing branching or protuberances (Fig. 3) similar to those found by Chen (2012). The symptoms were observed as consistently in grafted plants as in those fed on by psyllids, whilst the control plants showed no changes. Also, the symptoms observed in the grafted plants and those fed upon by insects do not correspond entirely with those observed in the field, possibly due to the presence of other phytopathogenic microorganisms in the field and to differences in environmental conditions. The transmission of CLso to grafted tomato plants suggests the infectious nature of the disease. The symptomatology observed by us was different to that reported by Table 2. Values of Ct obtained in real time PCR for the detection of Candidatus Liberibacter solanacearum in tomato plant. Sample ID FAM Std/Res FAM Ct Candidatus solanacearum Water 1 NEG 0 Candidatus solanacearum 1 POS Candidatus solanacearum 2 POS Candidatus solanacearum 3 POS Candidatus solanacearum 4 POS 31.1 Candidatus solanacearum 5 POS 31.8 Candidatus solanacearum 8 POS Candidatus solanacearum 9 POS Candidatus solanacearum b NEG 0 Candidatus solanacearum Control 2 NEG 0 Candidatus solanacearum Positive Clon C112 3 POS DNA from Candidatus Liberibacter solanacearum in grafted tomato plants and healthy plants 1 Negative Control; 2 DNA from healthy plants and 3 Positive Bacteria Control. Liefting et al. (2008, 2009), who mentioned that in solanaceous plants Ca. Liberibacter causes deformed leaves of pale green or yellow color, shortened stems, loss of flowers and sudden death of different parts of the plant. It is feasible that variations in the symptomatology could be explained by the phenological state of the host plant when it is infected. Other factors, such as environmental conditions, the species and variety of plant, or even the presence of haplotypes generated by discrete genetic changes in the bacterium, may affect the parasitic capability of the bacterium in the plant (Warrick et al., 2012). In México in 1948 a disease known as potato purple top was reported, more recently named Zebra chip (Munyaneza et al., 2007) and permanente del tomate (Munyaneza et al., 2009), and has been associated with CLso. It is possible that the bacterium was originally found on wild Solanaceae and afterwards spread to potato, tomato and chili by B. cockerelli. At first, Zebra chip in potato and permanente del tomate were attributed to phytoplasmas or viruses; but now it has been established that these diseases are associated with Ca. Liberibacter (Munyaneza et al., 2007; Abad et al., 2009). It is very probable that the bacterium has been present in various Solanaceae for a long time and it was simply that adequate methods for its detection did not exist. As the vector of the bacterium is B. cockerelli, the host range of Liberibacter includes other plants of the Solanaceae, due to the strong preference of the insect to feed on these species; in fact, there is a report of the presence of the bacterium in solanaceous weeds, such as goji berry (Lycium barbarum) and West Indian nightshade (Solanum ptychanthum). The information on genetic diversity, structure, adaptation and epidemiological relations of this bacterium in different geographic regions, and host plants is limited, for which reason it is important to generate basic information in order to ensure development of management strategies for this new pathogen. Positive detection of Ca. Liberibacter solanacearum through qpcr in grafted tomato plants or plants exposed

5 Journal of Plant Pathology (2016), 98 (2), Rojas-Martínez et al. 195 X P Ba Co A B Ra Ra Fig. 3. Scanning electron photomicrographs which show the presence of bacteria in the phloem of tomato plants with symptoms of decline. A) Phloem of grafted tomato plants: X, xylem tissue, P, sieve tube element; B) Enlargement of the central part of Fig. 3A; Co is the coccus form of Candidatus Liberibacter solanacearum, Ra, bacilliform cells; C) Ra, bacilliform cells in the phloem of tomato plants on which individuals of Bactericera cockerelli caught in the field have fed; Candidatus Liberibacter solanacearum in branching growing. C to individuals of B. cockerelli carrying the bacterium, and the presence of it in the phloem of symptomatic plants, confirmed that the bacterium is associated with decline of tomato. ACKNOWLEDGEMENTS We thank Dr. Ken Evans, Retired Professor of Rhotamsted Experiment Station, UK, for the revision of English. REFERENCES Abad J.A., Bandla M., French-Monar R.D., Liefting L.W., Clover G.R.G., First report of the detection of Candidatus Liberibacter species in zebra chip disease infected potato plants in the United States. Plant Disease 93: 108. Alfaro-Fernández A., Siverio F., Cebrián M.C., Villaescusa F.J., Font M.I., Candidatus Liberibacter solanacearum associated with Bactericera trigonica-affected carrots in the Canary Islands. Plant Disease 96: 581. Camacho-Tapia M., Rojas-Martínez R.I., Zavaleta-Mejía E., Hernández-Deheza M.G., Carrillo-Salazar J.A., Rebollar- Alviter A, Ochoa-Martínez D.L., Aetiology of chili pepper variegation from Yurécuaro, México. Journal of Plant Pathology 93: Chen J., Scanning Electron Microscopy of Candidatus Liberibacter solanacearum in Infected Tomato Phloem Tissue. In: Workneh F., Rashed A., Rush C.M. (eds). Proceedings of the 12th Annual Scri Zebra Chip Reporting Session. San Antonio, Texas. 1989: Doyle J.J., Doyle J.L., Isolation of plant DNA from fresh tissue. Focus 12: EPPO (European and Mediterranean Plant Protection Organization), First report of Candidatus Liberibacter solanacearum on carrots and celery in Spain, in association with Bactericera trigonica. EPPO Reporting Service Pests and Diseases 6: 4-5. Ferguson G., Fraser H., Potato psyllid - A new pest in greenhouse tomatoes and peppers. Ministry of Agriculture and Food. Ontario, Canada. Food and Rural Affairs. Available at: García-Tapia F., Relación de fitoplasmas, Bactericera cockerelli y geminivirus con el síndrome del declinamiento del jitomate. Tesis de Maestría en Ciencias Thesis. Colegio de Postgraduados. Montecillo, México. Garzón J.A., Cárdenas O.G., Bujanos R., Marín A., Becerra A., Velarde S., Reyes C., González M., Martínez J.L., 2009.

6 196 Candidatus Liberibacter solanacearum in Solanum lycopersicum Journal of Plant Pathology (2016), 98 (2), Asociación de Hemiptera: Triozidae con la enfermedad Permanente del tomate en México. Agricultura Técnica en México 35: Kikushima T.J.M., El psílido del tomate Bactericera cockerelli (Sulc) (=Paratrioza cockerelli) una nueva plaga de importancia económica en el norte de Sinaloa. Tesis de Licenciatura. Universidad Autónoma Chapingo, México. Li W., Abad J.A., French-Monar R.D., RascoeJ., Wen A., Gudmestad N.C., Secor G.A., Lee I-M., Duan Y., Levy L., Multiplex real-time PCR for detection, identification and quantification of Candidatus Liberibacter solanacearum in potato plants with zebra chip. Journal of Microbiological Methods 78: Liefting W.L., Pérez-Egusquiza C.Z., Clover G.R.G., Anderson J.A.D., A new Candidatus Liberibacter species in Solanum tuberosum in New Zealand. Plant Disease 92: Liefting W.L., Sutherland W.P., Ward I.L., Paice L.K., Weir S.B., Clover G.G., A new Candidatus Liberibacter species associated with diseases of solanaceous crops. Plant Disease 93: Loiseau M., Garnier S., Boirin V., Merieau M., Leguay A., Renaudin I., Renvoisé J.P., Gentit P., First Report of Candidatus liberibacter solanacearum in Carrot in France. Plant Disease 98: 839. Munyaneza J.E., Crosslin J.M., Upton J.E., Association of Bactericera cockerelli (Homoptera: Psyllidae) with Zebra Chip, a new potato disease in Southwestern United States and Mexico. Journal of Economic Entomology 100: Munyaneza J.E., Sengoda G.V., Crosslin J.J., Garzon T., Cardenas G.V., First report of Candidatus Liberibacter solanacearum in tomato plants in Mexico. Plant Disease 93: Munyaneza J.E., Fisher W.J., Sengoda G.V., Garczynski F., First report of Candidatus Liberibacter solanacearum associated with psyllid affected carrots in Europa. Plant Disease 94: 639. Munyaneza J.E., Sengoda V.G., Stegmark R., Arvidsson A.K., Anderbrant O., Yuvaraj J.K., Ramert B., Nissinen A., 2012a. First report of Candidatus Liberibacter solanacearum associated with psyllid-affected carrots in Sweden. Plant Disease 96: 453. Munyaneza J.E., Sengoda V.G., Sundheim L., Meadow R., 2012b. First report of Candidatus Liberibacter solanacearum associated with psyllid-affected carrots in Norway. Plant Disease 96: 454. Secor G.A., Rivera V.V., Abad J.A., Lee I.-M., Clover G.R.G., Liefting L.W., Li X., Boer S.H.D., Association of Candidatus Liberibacter solanacearum with zebra chip disease of potato established by graft and psyllid transmission, electron microscopy, and PCR. Plant Disease 93: Warrick E, Sengoda V.G., Alfaro-Fernandez A.O., Font I.M, Crosslin J.M., Munyaneza J.E., A new haplotype of Candidatus Liberibacter solanacearum identified in the Mediterranean region. European Journal of Plant Pathology DOI /s Wen A., Mallik I., Alvarado V.Y., Pasche J.S., Wang X., Li W., Levy L., Lin H., Scholthof H.B., Mirkov T.E., Rush C.M., Gudmestad N.C., Detection, distribution, and genetic variability of Candidatus Liberibacter species associated with zebra complex disease of potato in North America. Plant Disease 93: Received March 8, 2015 Accepted September 21, 2015