phylogeny of land plants

Transcription

1 The EMBO Journal vol.15 no.6 pp , 1996 RNA editing in bryophytes and a molecular phylogeny of land plants Olaf Malek, Kathrin Lattig1, Rudolf Hiesell, Axel Brennicke and Volker Knoop2 Allgemeine Botanik, Universitat Ulm, Albert-Einstein-Allee, D Ulm and 'Institut fur Genbiologische Forschung, Ihnestrasse 63, D Berlin, Germany 2Corresponding author RNA editing has been observed to date in all groups of vascular plants, but not in bryophytes. Its occurrence was therefore assumed to correlate with the evolution of tracheophytes. To gain more insight into both the phylogeny of early land plants and the evolution of mitochondrial RNA editing we have investigated a number of vascular and non-vascular plant species. Contrary to the belief that editing is absent from bryophytes, here we report mitochondrial RNA editing in cox3 mrna of the liverwort Pellia epiphylla, the mosses Tetraphis pellucida and Ceratodon purpureus and the hornwort Anthoceros crispulus. RNA editing in plants consequently predates the evolution of tracheophytes. Editing is also found in the eusporangiate ferns Ophioglossum petiolatum and Angiopteris palmiformis, the whisk fern Tmesipteris elongata and the gnetopsid Ephedra gerardiana, but was not detected in Gnetum gnemon. cox3 mrna of the lycopsid Isoetes lacustris shows the highest frequency of RNA editing ever observed in a plant, with 39% of all cytidine residues converted to uridines. The frequency of RNA editing correlates with the genomic GC content rather than with the phylogenetic position of a species. Phylogenetic trees derived from the slowly evolving mitochondrial sequences find external support from the assessments of classical systematics. Keywords: land plant phylogeny/mitochondria/molecular evolution/rna editing Introduction Plant mitochondrial RNA editing was initially found in monocotyledonous (Covello and Gray, 1989; Gualberto et al., 1989) and dicotyledonous (Hiesel et al., 1989) angiosperm species. Mostly cytidine to uridine and occasionally reverse exchanges modify the coding regions of virtually all mrnas in plant mitochondria (Bonnard et al., 1992). The unedited hybrid reading frame URF13 in male sterile maize T-cytoplasm (Ward and Levings, 1991) is a unique exception to this rule. RNA editing as manifested by cytidine-uridine exchange has also been found in chloroplasts, albeit at much lower frequency (Hoch et al., 1991). Editing events in plant mitochondria are clustered in coding regions, but have also been described for 5' and 3' non-coding regions, for introns and for trnas (Marechal-Drouard et al., 1993; Binder et al., 1994). Mitochondrial RNA editing has been found in all angiosperm species investigated. The complete sequence of the liverwort Marchantia polymorpha mitochondrial DNA (Oda et al., 1992), however, strongly suggests that RNA editing does not occur in this species; conserved amino acid positions are genomically encoded and editing events analogous to those in vascular plants are not observed in cdna analysis of Marchantia (Ohyama et al., 1993). Likewise, in the moss Physcomitrella patens conserved amino acids are encoded in the mitochondrial cox3 reading frame at the genomic level (Marienfeld et al., 1991). The mitochondrial cox3 gene is, however, heavily edited in angiosperms and was therefore chosen to investigate the occurrence of RNA editing in the plant kingdom. A survey of major groups of land plants has started to bridge the large gap between the primitive non-vascular plants mentioned above and angiosperms (Hiesel et al., 1994a). This work has shown that RNA editing is present in all vascular plants, including the 'fern allies' club mosses (Lycopsida), whisk ferns (Psilotopsida) and horsetails (Sphenopsida), the 'true' ferns (Filicopsida) and gymnosperms (Cycadopsida, Coniferopsida and Ginkgopsida). These groups are here regarded as classes for reasons of clarity, but are occasionally treated as separate divisions by some systematicists. RNA editing was not found in either green algae (Coleochaete, Stichococcus) or in the primitive moss Sphagnum palustre. Gymnosperm species, however, generally show an even higher frequency of RNA editing than has been found for the cox3 gene in angiosperms. It was considered significant that a primitive tracheophyte, the club moss Lycopodium squarrosum, showed only one editing site in the 381 bp region of the cox3 gene under investigation. Taken together, the findings led to speculation about the establishment of RNA editing along with the emergence of tracheophytes in land plant evolution (Hiesel et al., 1994a). The set of homologous mitochondrial sequences obtained during these studies yielded phylogenetic trees of considerable evolutionary depth (Hiesel et al., 1994b). According to classical systematics a major group of land plants, the hornworts, was not represented in the set of species under investigation and the extended significance of the derived phylogenies depends upon inclusion of additional key species. We have now investigated Anthoceros crispulus as a hornwort species, as well as other representatives of early branches in land plant phylogeny. The surprising results obtained from these studies include evidence for RNA editing in the hornwort A.crispulus, the liverwort Pellia epiphylla and the two moss species Ceratodon purpureus and Tetraphis pellucida. Mitochondrial RNA editing in plants is therefore evolutionarily older than previously assumed. The highest frequency of Oxford University Press 1403

2 O.Malek et al. Fig. 1. Schematic representation of the mitochondrial co.x gene regions under investigation in this work. Arrowheads indicate oligonucleotide primers (for sequences see Materials and methods) used to amplify an upstream region (381 bp) and a downstream region (248/254 bp) of the reading frame (excluding primers). Each of these regions contains a group II intron (grey triangles) in the liverwort M.pol/vnorpha (Oda et Col., 1992). Homologous introns are also present at identical sites in Pepipulh vla (not shown) and the upstream intron is also present in L.squarrosuin (Hiesel et al a). RNA editin- sites are deduced from comparison of cdna and genomic sequences after PCR amplification, cloning and dideoxy sequencing. RNA editing ever observed in a plant was found for the lycopod Isoetes lacustris cox3 transcript. Phylogenetic trees constructed from a set of 28 species representing the entire spectrum of extant land plants confirm the highly informative potential of mitochondrial sequences for evolutionary analyses. Results Occurrence of RNA editing in different land plant lineages To define the occurrence of mitochondrial RNA editing at the bryophyte-tracheophyte junction more precisely and to test the usefulness of mitochondrial nucleotide sequences for derivation of phylogenetic information we investigated several species representing early branches in land plant evolution. Most importantly, the group of hormworts is now represented for the first time by the species A.crispulus. Furthermore, we analysed the liverwort Pepiphylla, the mosses Tpellucida and C.purpureus, the lycopsid I.lacustris, the psilotopsid Tmesipteris elongata, the ferns Ophioglossum petiolatum and Angiopteris palmiformis and the gnetopsids Ephedra gerardiana and Gnetum gnemon. The green alga Chara corralina, as a member of the Charales, regarded as the extant algal representatives most closely related to the ancestors of land plants, is now likewise included in our studies. Experimentally we have, on the one hand, extended the available data set of homologous sequences from the upstream part of the cox3 gene and, on the other hand, investigated the 3'-terminal region of this gene to statistically evaluate the inferences made from analysis of the upstream region (Figure 1). An alignment of the upstream cox3 sequences obtained in the analysis of the species together with some of those previously analysed is shown in Figure 2. No length variation of this cox3 region is observed for any of the >30 species ranging from algae to seed plants investigated. Liverwort RNA editing Most surprisingly, and contradicting earlier assumptions, RNA editing is detected in the liverwort species Fepiphylla. In Pellia 12 editing sites are observed, three of which are silent (Figure 2). One silent exchange is a reverse edit in a histidine codon (CAT--CAC, position 57) which is conserved in all other species as either CAC or CAT at the DNA level. Different reverse edits in cox3 have been observed in the filicopsids Asplenium and Osmunda (Hiesel et al., 1994a). In these cases the reverse edits are essential to reconstitute conserved amino acid codons and to eliminate a stop codon in the Asplenium reading frame (position 181). The nine non-silent C-*U editing events in Pellia likewise reconstitute conserved amino acid codons and thus confirm the necessity of RNA editing for functional gene expression in this liverwort. Each of the nine non-silent editing positions is conserved in at least two vascular plant species and nucleotide identities are re-established at the RNA level in comparison with its sister liverwort species M.polymorpha in these instances. RNA editing in 'true' mosses (Musci) The unexpected finding of RNA editing in the liverwort Pellia inevitably required reconsideration of the idea that RNA editing arose in evolution only after divergence of the vascular plant line. The finding prompted us to investigate further species of another bryophyte class, the 'true' mosses (Musci). We consequently analysed the species C.purpureus and Tpellucida in this study and indeed find evidence for RNA editing. Both species have a single RNA editing site in common that is required to reconstitute a universally conserved UGG tryptophan codon (position 301; Figure 2). While this codon is genomically encoded in other bryophyte species, editing at this site is also required in some of the tracheophytes. No further editing is required in the analysed region of cox3 in Ceratodon and Tetraphis, since all other conserved amino acids are genomically encoded. Hornwort RNA editing Hornworts are a rather small class of bryophytes with an unclear relationship to the other plant groups, particularly the mosses and liverworts. The species A.crispulus is here investigated as a first representative of this group. Nucleic acid preparations of Anthoceros presented us with difficulties during PCR amplification, even when CsCl-purified material was used, and were inhibitory when added to other PCR reactions. Ultimately amplification succeeded after extreme dilution of the preparations. While unambiguous sequences were obtained from amplification of Anthoceros cdna (Figure 2), a population of clones with diverging sequences were obtained from Anthoceros genomic DNA even after repeated attempts. We ascribe this phenomenon to the presence of an inhibitory and error-inducing substance associated with Anthoceros DNA. The deduction of editing sites in Anthoceros is thus somewhat preliminary, since additional sequence differences other than the expected C-*U changes observed in the comparison of DNA and cdna are found between individual genomic clones (for details see the corresponding database entry). These differences, however, are most likely PCR artefacts, for the reasons outlined above. Due to the scarcity of biological material purification of Anthoceros mitochondria to possibly overcome the problem is not feasible at present. With the above caveat 10 editing sites are observed for Anthoceros in the upstream cox3 region, nine of which 1404

3 RNA editing in bryophytes Oenothera ATV-'A A A _'-A _~A A_ :,A-, T -A' MCA T-T -.A ;T TTTS,C CTC ATA CTC TC CTA CAT ACC ATC Cy~~~~~~~ ~~~T~~~rCCA _--M'A;_T A- A Z A~~~~~~~~~~~~~~~~~~~~~~~~~~~~~'-ATC 77'. A'_'A G S, T ~7 ;A A:~A TAT S~T TTS ~;GC CTC ATA CCCT ATE CUA TAT AT CCATA CAT ACU AT.. Ephc.11C... A= AA A_A_;T A -- ATTT- ka ~ ~ ~ ~ ~ --TEAC ~ C ATCTCT AC O CRA CA CAT TT ACT ATC ~CGTEACCACCT ACTAC Gnetumi CC CCC CCA TCA ACA TCA CAT ACT ACC 7 A.A A7A 'T CTA A~;TT CC GC TATCA CC ACTCA TAT ACT ATC OPh1otm C1.AT A.>AC~ C T T. TT_,TG- C --A ATTA A.gi.pt..1. C 5 CA TCAATCA3A ATC T~~~~~~~~~~~~~~~A-TA CC CCC CCA CCA ATA TAT ACT C ATC yeccpteri..tt C- AAAA-CCTC ACC -ATC_A~ CAT MCAC-CCC C ; CCA C. CA A7A CTT A AC;T TCA TGC CCC CCA ATA ATC CCA TAT ACT ACT Aspleniu7 7 _'~T77 "A _.A A _;CACT TCC CC CC ARCTA ABC,: _A CT CU'AT A C-A3A GAT CAA- ATC CRC TT CCC TTA C-C TEAT CSA TAR ATE TTA TAT ATE ARC Eq.munda. =3 TZC:- A7CACC CCC C. C 7 ;TCCC AC TAZ ATC _AT C7A TTT A-- CCCA CCCT CCA ACA CC ACT AGT TTA CCC CCC CCC TCG ATCT CTEA TCA ACT ACT Ophioglssum 'A C A 7,--C AGCACC 2 C.CT C. CC ACT. CAT ACT. 7AT CT: CCC WAC CCA C..T G CA A CA ~:TC IC ACT TCA CCIC CCA CGCTA ATCATTCA TAT ACT ACC A.ngopteis :T; G 7 ~:A TT ---C C AGAC ACT C.T CT CCCS ATCC TATACATCA CC CC TC AC3 CCA CCC CCA ACA CTT CT ACT TTA CCC CCC GA TAC ACTA TCTA TAT ACT ATG Lycopodium ATC_ -A --TTGG-A ASC~ ACTCTI;T..TCC ATC TAC ATC..CAC CCC TT ATC CCA CCCT CGA ACA CCC CCC AGT CCA CCC CCC GCA ACTA ATC TTA TCA ACT ACTG Spohe.A..-, T_AM CCA SCC ZIC CCA ASC ACC ACT CCC C..T CCC ACT TAT ACT CAC CT CTCCC ACC CAA CCC C3A AA CCC CCC ACT TCTA CCC CCC GGA ACT ACT TTA CAT ACT ACT Coraodon -'T1 TT ~;_3 7TCA SGA = TT SC ASCACCATT ~-C 37CT CCC ATC TCA ACT CATC TC CCC ACG CA CCT CCA ACA CCC CCC CCC TTA CCCC TTGG'A ACT ATCT CTA TAT ACT ACT Tetraphi T -; C ;; -TTSGA AC2 ACC ACT CCCT CCC CCC ATC TCA ACT CA4 C TCT T AC CCA CCC CCA A A CCC CCC CCC CCA TTC CCCGTA ACTG ATCT TTA TAT ACT ACTG Chara~~ ;T T-_ =G 37A G-_T T~; :;ACA AC- ACT..CC..CC CCC ATC TAT ATGC AT TCT CAT A-_A CCA GCC AC. CC CCC CCC ACT TTA CCC TTA CCA ACT ACT CTT TAT ACT ACTG P-LC7.M T..M H P'S S>7 > 3.P>T CS>L S.L CT>M C >3 C T>.M 'Rl~~~~~ 210~~ CT CA C... C...;,,T T ;AT: AGTTGAA CGA CAT CAT ACA AAA..TC CTA CAA TTA CCA..TT COA CAT CCC TOT ACT CCC CCC ATCT GTA TCCC TATCCC ACTG CCC ErTC CCC CCC CCC CCC TTEC TABCC G~ C... G'' ;T~T TCCA3 "C "AA. GA CATC AC ACT AAC GCT GTA CAA TTA CCGA CCC CCA TAT CCC CCC ACT TIA TCU ATM GTA TCCC CATCCC ACTG CCC ErTC C GCCC rtc CRC 7-CTA G"' G ""'CA ;T"TTA CGTGAATCC A"C"CT AAAGAAACATC AT ACCCA.ACTECGA CA.ATATCGGA CWrCCACTAT GGTTTTATTCTEACTTTATUGTACTCGCAGGTA ATGTTC TC TTC GTTT rttett TT- ~;A GS G~;--;C AT~TTATACG GA TC AS T3 AC CCC_ CAT CAT AT" AAA CCC CTA CACCATTAGGACTT CA CAT CCC CCC CCC CCC CCC ACT GTA TCCC CATCCC ACTG CCC CCC CCC GCCC CCC CCC TTT~;T T~T~G GZ~;A 3T CR CT GA TC AC TC AA CGA CAT CAC A"" AAA CCC GTA CAA TTA CCC CCC BCC TCA CCC CCC ACT ETC CCC ATCGTCC CCC CAT CCC ACTG CCC CCC TEA GCCC CCC CCC CT 3TS T~, ~C-A,T:M :TGATCA_ A AA CCA CAT CAT ACC AAA CCC GTA CAA TTA GGA CCC CCC TCA CCC CCC ACT CCC CCC ATC TCC CCC CAT CCC ACTG CCC CCC TEA GCCC CCC CCC 777:;T3 =' C~C ~AT TT CA GT CT ACT TAC SACAGGACA CAT ACT AAA CCC CCA +AA TTA CCC CCC CCC CAT CCC CCC ATCTU CTTCC ACGTCCCG CCC CATTCC ACTG CCC CR TCA CCC CCC CCC 77~ ~;A EG GS G7 AT3TTATACS GA TC ft TAC 3AC CCA CATC"AC AC'C AA~A CCC CCA CAA CCA CCA CCC CCC TCA CCC CCC CCC CCC CCC ATCT CCGTCMCGATCCC ACTG CCC MCCTT CCC CCC TCC 777~;T T3TG C;C AT TTTTAC:, SA TC AT TC AA CCC CAT CAT A"C AAA CCC GTA CA.A TCA GGA CrC CCC GTA CCC CRC CfrC TEA CCC AM CCC CCC CAT CCC ACTG CCC ErTC TTA GCCC CCC CCC.7-~TATGSTG CG 3A ~;- TA --- GA TC AT TC AA CCA CAT CAC A"C AAA CCC GTA CAA TTA GGA CCC CCC TCA CCC CCC CCC CCC CCC ATCGTCCCCTCGAT CCC ACTG CCC CCC TCA GCCC T CCC C..C AA CCA CAT "AC ATA CCC CCC CCA CAA CCA CCACACAT CCC CCCC CATATA CCC GG CCCCCCTA ACT ACTTGT CRCTT TCCCCACGGAGCCCTCCCTTCCC C. BCACG 7- AA TC" ACT TCA CAT CCGA CAC CAT ACA CACACCTC A CEATCECCCTCCACT CCGCCCACCC CCC CCC CM AEG G 7..U :;4..TAf CCT SACT 7CA AA CGA CAT CAT ACACC CCCAT CCC CAA TTA CTA CCC CTE TAT CC TCACTAT CCC CCC ACTCCGC CC CCC CCC GAG CCC ACTG CCA CCC CCC CCC C.. CACT..AC AS GGACAT CAT ACA CCC CCC CCC CAA CCC GGA CCC CCC CATA CCC ACT ACTT CCC CCC ATCGTTCCC CAG CCC ACTG CCC CCC CCA CCC CCC CCC C- CT;M_ ~G 'A ;T-T -; A ~A+37+A2 GA TC ACT AC GAC CCA CAT CAT ACA CCC CAA TTA CCA CCC CCC CAT GCC ACTG ACT ATCGTG TCCT CCGA.A CCC ATG TTA GCCC C7CT..C.. C... S CGT G G GA ACTCAC GAA CCA CAT CAT ACA CCC CCC CCC CAA TCA GCA CCC CCC CAT CCC ACTG ACT CCG CCC ACT GCC TCCC GAA CCC ACTG CCC CCC TTA CCC CCC CCC C- CTTOG. C T. C~_ G ;A TAACS A ACTAGAA GGA CAT CAT ACA CCC CTG CCC CA.A TTA CCC CCC CCC CAT CCC ATA ACT CCC CCC ATCT GTT TCCC CAA CCC ACTG CCC CCC TTA GCT CCC CTT CCC CCTA CCC 73C T" -,TG AA...T.A CCTM AAGA CAT CAT ACA CCC CTC CCC CAA TTA GGA CrC CCC TAT CCC ACTG ACT CCC TEC ATC CCC TCCC CAA CCC ACTG CCC TTT TEA GCCC CU ETC CCC CCA TCC T..C ~-T3T~T T S A C C A AA CCA TAT CAT ACA TCA CCC CCC CCA CCC GGA CCC CCC TAT GGC ACTG ACT CCC CCC ACT CCC TCA GAA GTA ACTG CCC CCC GTA GCCC CCC CCC F P-LP. PC A3' -'TCYCTTP..Q P>.L RC C S>.FP>.L.>L S>.F.>I C P'S CS>F >F >FL S>F >F 3C B.. -r ";T","N" IT~_ -A A7~ CT: CCA CCC ACT CC'-:7C "-CA AAA CCC ACT OGG CCC TCA CAT.CCT CCC TG. ATA CCC CCC CCC AAC ACT CrC ACT CCC CCC TCA CCC CCA CCC B..;~ N;_"BC"T CATT. TG:C -- -: ;A:A ACC3A CCC ACT C:- --C7CC AAA CCC ACT GCC CCC TTA CAC CCC CCC CA.A ACTCCCCTTCC AAC ACT CCC ACT CTE CCC CCA TCCC GA CCC BC "N C B-C TTCC" CCCC7C CCTA-A-CACCTC A-AGCCC CACC TTCCCAC CT CA~~: ~ T A CCG ACTCRACCACCCACC rcacc CASCCT CCA CCC ATC" CC '"CCC CAG CCC T CCCGO CCCG TTA CAC CCC CCC CCA ACTACCCC TTA ACTCC ACT CTA ::: Z: CCC CCA CCC TGACC BC.. TTTCCC C= ETC- C..;..C- C~~T -GAC C.A CCC ATCT BCC CCC CCT CAA CGA ACT TAT CCC TTA TAT CCC CCC GCCA ATCT CCC CCC CTA AAT TT T ATT ACT CCC ACT CTA CCC TCA C CCC GCA BCC.S"~A CCCAC" C ~~ CGA CCC ACT CCC "CC CCC GAA GGA ACT TAT CCC CTA TAT CCC CCC GGA ACT CCC CCC CTA CAT ACT CCC ACT CTA CCC TCA CCC GGA :T =OT'I ;ACCT EGG. GCCC CTCCC TAGGACT 3CA CCC ACTTGCCC"C CCC GAA GGA CCC TAGTT CC TCA AAC CCC CTG CGA ACT CCC CTA AAT ACT CCC ACT CTEA CCC TCCC GGA TBC. TTMl :TTCTC IG:C CCTT CC" GTCCCG CC CCA CCC ACTTOOBC"CC"CC A.AA GGA ACT TAT CCC TTA CAT CCC CCC GGA ATCT CCC CCCCTEA AAT ACT CCC ACT CEC CCC CCC TCCC GGA TTC MGC.. TT"CTTCU GCCC _T ;A CT A"C CCA CAT ATE CTA CCC ACT BCG..CC CCC A TT GA ACT CAT CCC TTA CAT CCC CCC CGA ACT CCC CCC TEA AAT ACT CCC ACT ET CCC TCA TCTE GGA WTT7- T C T C C GCCC BC.. C;7 C CCCCCAG CT CCA CTE ACT CGGCC"'C CCC AAA GGA ACT CAT CCC CCA TAT CCC CCC GGA ACT CCC CCC CCA CAT ACT CRC ACT CCC CCC CCA TCCC GGA,T A CG~~'' CCT TC T">":.--",;:CACTAC GCCC " CTC CA CCC ACT CGGCC"C CCC CATA GGA ACT CAT CCC CTA CAT CCC CCC CCC ACT CCC CCC CTA ACT ACT CCC ACT CTCA CCC TCA TCCC GGA BC~ -C TTT A 77T--~Ṯ "TU BCA T CCC BCE "NC GGA ACT CGA BG3CC A ACT CAT CCC CCA TAT CCC CCC CCC ACT CCC CCC TEA AAT ACT CRC ATCT CTEA CCC RCA TCCC GGA BG: C7- E C IG:;. C C 0 ATN"GCCCCCT" A ACACCGACAT OS2CCA CCC CAT CCC CCA CAT CCT CCC CTA ACT CCC CCC CCA A.AT ACT CCC ACT CCCA CCC MCA W,-, A-- TCCC CCC CCC AC CCC ACTG CC. ACT G.AG.TC TTA CAT SCT TCG CGA ACT CCT CTA ACAT AACCC ACT ATEAC CCC TCA TCC. SCC A+ T-7-T-- :;ZACC CCACTC ACTT~GC-CT BC SACAT CAT TCA ICC CCCC CCA ACT CCC CTA AAT ACT CCC ACT TICA CCC TTA 7 -:;~T 3A =~7C A 3 TCCC CA CCC..'T-- CT CCA -CCC ACT BC ACT CAT CCCS CCA ITCCTTOCCC CA ACT "C CCCT"CTA AAT ACC CCC ACT CTA CTT TCA TCT CCA SCC A-T'T _'A 7 ~7. CC..CA CCC ACT CC7 -T~CC A 3 AC CAT CCC TTA AAT CCC CCC CGA ACT CCC CCC CCC ACT ACT CCC ACT TTA CCT TCA TCCC CA CCC -AT~ '_-A =TA_'A 7;T :; AC" CCA GC.T ACT CC~ _Z7C A S ACT CCC CCC TTA CAT 'CT CCC CCA ACT CCC CCC CTA AAT ACC CCC ACT CTA "CCT TCA CCC CCA CCC B.. C7TC TMECA ~ T; A 43 C CCGA CCC ATC CC37 = A 7 ACT C"T..CC CCC CAT ""C CCC CGA ACT CCCTC TETCA ~ACT ACT C-rC ACT CCA "CCTETA TCCC CTACC TC.. C CC CCC A A 'T;--- :- ATCC CC:A GCT ACT CCS TZA ~A G ACT CAT CCC TCA CAT CCT CCC GCA ATC CCC CCC CCA AAT ACT CCT ACT "CA CCT TCA TCCC GA SCCC 33 'C "C A 3. P P>3L P>3. > P>.L P>3 C A Fig. 2. Aligynment otl the 381 nt upstreami re'on of the miitochondrial c(05 gene amiplified fromi the species indicated. Amino acid codons are given as triplets and the corresponding amiino acids are inidicated In the one letter code where changes are introduced hy RNA editing. C-*>U editingy events are inidicated bv black boxes. reverse edits bv double crosses. The horizontal gap separates vascular (upper part) from non-vascular species (lower part). Homologyous group II introns intcrriupt the co_v3 reading, framie in Lvcop)oduon. Matrchantua and Peli/ia betwseen positions I 1 7 and Database accession nos for the niucleotide sequences friomi top to hottoni are: 0Ober-teriana X76275: Cvcas r-evo/uto X76279-, Egerardfiana X92735: G.pgnemon X92722: P.nuduoi X76276:, Telo~otigio X92738: Atildius X76274: O.c/aovNtoniioino X76277: O.p)etiolatnin X92739: A.pal,nij'rr,nis X9273 1: L.squarr-osutn X76273: IL/acu.sti.is X92736: Eatrvense X76282: A.c'ri.Vnpu/us X92721I. C.purpureit X T.pelucwida X92737; SpIalustre X7627 1: ALpjoI.vtnorp)ha M68929: P.epfipl)hla X92740:, C oro/inao X are silent exchanges. Eight editing events are observed in the third codon position. The single first codon position edit (at position 13, in common with Isoetes and the only editing site conserved in another species) leaves the affected leucine codon identity unchanged. Five cases each of conventional C-*U edits and reverse exchanges are found. The only non-silent C->U exchange (position 365) reconstitutes a well-conserved leucine codon. An additional edit should be postulated for Anthoceros at position 142, where a conserved arginine codon is reconstituted in Aspleniumn by a reverse (U-4C) exchange. While uncertainties about the genomic sequence remain, analysis of the 3-terminal cox3 sequence confirms the presence of editing in the hormwort (see below). as a sister group to the previously investigated club moss Lvcopodiuin. In sharp contrast to the single editing site of Lvcopodium, in this cox3 region Isoetes shows the highest frequency of RNA editing ever observed in a plant. Of 122 cytidine residues, 48 (39%) are converted to uridines at the RNA level and only nine of these edits leave the amino acid identity unchanged. At positions four consecutive C--U edits are found. RNA editing is also identified in the psilotopsid Telongata. Seven RNA editing sites are found in the investigated cox3 coding region, six of which are conserved in the sister whisk fern Psilotum nudum. A thymidine is observed at position 272 of the genomic Psilotumn sequence, where editing is required in the Tmesipteris RNA sequence to reconstitute a conserved leucine codon. Both true fern species included in the earlier studies, Tracheophyte RNA editing The earlier hypothesis that RNA editing evolved in the Asplenium nidus and Osmunda clavtoniana, are tracheophyte line of land plant evolution was strengthened systematically classified as leptosporangiate ferns. We by the observation of only a single editing site in the cox3 have now included the species O.petiolatum and Apalmisequence of L.squarrosum, a tracheophyte at a basal formi.s as members of the eusporangiate ferns. Editing phylogenetic position. The discovery of RNA editing in patterns and frequency are highly divergent in the two bryophytes prompted us to include the lycopsid I.lacustris species, with 16 sites identified in Ophioglossum and only 1405

4 O.Malek et al O nothera T CAT CAT GCT ATA CTA GCG GGG AAG GAA AAA CGA GCA GTT TAC GCT TTA GTA GCT ACC GTT TTA CTG GCT ATA GTA TTC ACC GGA TTT CAA GGA ATG GAA TAT TAT CAA GCA CCC CycaCTCAT CAT GCT ATA CUAC T GGG. AAA GAA CAA CAA GCA GTT EAC GCT TEA GTA GCT ACC GTT TCA CTG GCT CTA GTA TTC ACT GGG TTT CAA GGA ATG GAA TAT EAT CAA GCA CCT Onetum T CAT CAT GCT ATA CTC GCG GGG. AAG GAG CAT TA GCA GTT TAC GCT TTA GTA GCC ACC GTT TCA CTG GCT CTA GTA TTC ACT GGA TTC CAA GGA ATG GAG TAT TAT CAA GCA CCT Pilotum T CAT CAT GCT ATA CTC ACG GGT.. TTA GAG CAG CAA GCG GTT TAC GCT TTA GTA GCT ACC GTT TGG CTG GCT CTA GTC TTT ACT GGG TTT CAG GGA ATG GAA TAT GTA GAA GCA CCC AmCleniumTCAC +AT GCC ATA CTC GCA GGT.. TTA AAA +AA CAA GCG OTT EAC GCT TTA GTA GCT ATC GTT TGG CTG GCT CTA GTT TM ACC GGG TTT fag GGA ATG GAA TAT TAT GAA GCA CAT Oanunda T CAT CAT GCT ATA CTC GCA GGT.. CTA AAA GAA CAA GCG GTT TAC GCT TTA GTA GCT ACC GTT EGG CTG GCT CTA GTC TTC ACE GGG TTT CAA GGA ATG GAA TAT TAC GAA GCA CCT Ophioglos1w. T CAT CAT GCT ATA CTC GCA GGT.. TCA AAA AAA CAA GCG GTT TAC GCT TTA GTA GCT ACC GTT TGG CTG GCT CTA GTC TTT ACT GGG TTT CAA GGA ATG GAA TAT GTA GAA GCA CCT Equiaet. CTCAT CAT GCG ATA CTC GCA GGT.. CTG AAA CAA CAA GCG GTT TAC GCT TTA GTA GCT ACC GTT TGG CTG GCT CTA GTA TTT ACT GGG TTT CAA GGA ATG GAA TAT TAC GAA GCA CCT Anthocaroo T CAT CAT GCT ATA TTA GCG GGA. TTG AAA GAA GAA GCT GTT TAC GCT TTA GTA GCT ACT GTT TCG CTG GCT TTA GTT T ACC GGG CTT TAA GGA ATG GAA EAT GTA GAA GCA CCT Marchantia TCAT CAT GCT ATA CTC GCA GGT. TTA AAA CAA CAA GCA GTT TAC GCT TTA ATA GCT ACC GTT TTC CTG GCT CTA GTC TTT ACT GGG TTT CAA GGA ATT GAA TAT ATA GAG GCC CCC P-llia T CAT CAT GCT ATA CTC GCA GGT GGT TGT TTT TTA AAA CAA GCA GTT TAC GCT T ATA GCT ACC GTT TTC CTG GCT CTA GTC TTT ACT GGG TTT CAA GGA ATT GAA TAC GTA GAG GCC CCC Y>H P>L STOP>Q H>Y S>L I>T R>W P>L P,S T STOP>Q H>Y H>Y L>P >F CM ACG ATT TCA GAT AGT ATT TAT GGT TCG ACC TTT TAT TTA GCA ACT GGC TTT CAT GGT TTT CAT GTG ATT ATA GGT ACT CTT TTC TCG ATC ATA TGT GGT ATT CGC CAA TAT CTT GGT CAG ATG ACA AAG G ETC ACT ATT ECG GAT GGT ATT TAT GGT TCT ACC TTT T C TEA GCA ACT GGG TTT CAT GGT TTT CAT GTG ATT ATA GGT ACT ATT CUTUA ATC ATA TGT GGT ATT CGC CAT TAT CTG GGT CAT TTG ACC AAG A TTC ACT ATC TCG GAT GGT ATT TAT GGT TCT ACC TTT TTC TTA GCA ACT GGG TTT CAT GGT TTT CAT GTG ATT ATA GGT ACT ATT TTC CTA ATC ATA TGT GGT ATT CGC CAA TAT ATG GGT CAT TTG ACC AAG G TTT ACT ATT TCC GAT GGT ATT TAT GGT TCT ACC TTC TTC TTA GCT ACC GGA TTT CAT GGT TTT CAT GTC ATT ATA GGC ACT CTT TTT CTA ATC ATC TGT GGT ATT CGC CAA TAT CTA GGT AAT TTT AGC CCT T TTT ACC ATT TCT GAC GGT ATT TAT GGT TTC ACT TWA TTC TTA GCT ACC GGG CTTT AT GGG TEC fat GTT ATT ATA GGG ACE ATT TTC TTG ATG ATA EGC GGT ATT CGT faa TAC ATA GGCTAT TTT AGT TCT T TTT ACC ATT ECC GAT GGT ATT TAT GGT TCT ACE TTT TTC TTA GCA ACT GGG TTT TAT GGG TTT fat GTC ATT ATA GGG ACT ATT TTC TEA ATA ATA TGC GGT ATT CGT GAA TAT ATG GGC CAT TTT AGC CCT T T T ACT ANT TCT GAT GGG ATT TAT GGT TCG ACT TTC TM TA GCT ACT GGA TTC CAT GGG TTT CAC GTC ATT ATA GGC ACC ATT TTC TUT ACTA ATC TG GGT ATT CGC faa TAT CTG GGG CAT TTT AGC CCT T TTC ACC ATT TCC GAT GGT ATT TAT GGT TCC ACC TTT TC CTA GCA ACT GGA TTT CAT GGT TTT CAT GTC ATC ATA GGA ACT ATC TTC TTG ATT ATG TGT GCT ATT CGT CAA TAT CTG GGT CAT TTT ACC CCA A TTC ACA ATT TCC GAT GGT ATT TAT GGT T+T ACT ET ET CUT GCT ACAGGT TTT CAT GGT TTT CAT GTT ATT GTG GGT ACC ATT CCC CTA ATA ATA ETT GGT ATT CGT +fa TAC CTG GGT CAT TTC ACT GTA A TTC ACT ATT TCC GAT GGA ATT TAT GGT TCT ACG TTT TTT TTA GCT ACA GGG TTT CAT GGT TTT CAT GTC ATT ATA GGT ACT ATT TTC TTA ATA ATA TGT GGG ATT CGT CAA TAT CTG GGT CAT TTT ACC CCA A TTC ACT ATT TCA GAT GGA ATT TAT GGT TCT ACG TAr TTT TUA GCT AC TG GT TTT CAT GGT TTT CAT GTC ATT ATA GGT ACT ATT M TUA ATA ATA TGT GGG ATT CGT CAA TAT CTG GGT CAT TTT ACC CCA A >L F T>I P>S F>S T SGL S,AL S>L A Y>H S>F Y>H T>I T S>F S>L R>C STOP>Q Y>H >F >F Fig. 3. Alignment of the downstream (248/254 bp) region of the co.3 gene. Graphic details of the presentation are as in Figure 2. Homologous group II introns interrupt the coy3 reading frame in the liverworts Marchantia and Pellia between positions 182 and 183. No editing sites are as yet determined for Psilotomn, where only the cdna sequence is available, as shown. Editing sites indicated in the Eqluisettin and Cvc-cas sequences are deduced from sequence comparison and not yet confirmed by cdna sequencing. Database accession Nos are: Crevoluta X93553; G.gneinon X92722; P.nldu,n X92724; Anidus X92732; O.clawtoniana X92725; O.petiolatuin X92723; E.arvense X93552; A.crisplulus X92730; Pepiplla X four sites in Angiopteris. Only the editing event at position 250, reconstituting a tryptophan codon, is conserved between the two eusporangiate ferns. Five of the Ophioglossum base exchanges and one in Angiopteris are silent with respect to the amino acid encoded. Additional editing sites are postulated for Angiopteris at position 107 and for Ophioglossum at 185 to reconstitute conserved leucine codons and for Angiopteris at position 232 to re-establish a phenylalanine codon, but these are not found to be edited in the respective cdna sequences. A group of gymnosperms with few extant species, the gnetopsids, is considered to have a unique evolutionary position among the gymnosperms and has been suggested to be closely related to angiosperm plants. In Egerardiana we find 14 conventional C--U editing sites, four of which are silent. No reverse editing is observed in this species and no further potential edits can be postulated from the sequence comparison to increase protein similarity. No RNA editing is observed in the cox3 mrna of the other gnetopsid investigated, G.gnemon, where well-conserved codon identities are already encoded in the genomic sequence. Is plant mitochondrial RNA editing older than land plants? The DNA sequence of the now included green alga C.corallina shows one site (position 163) that is expected to be edited at the RNA level by a reverse (U--C) editing event. A genomically encoded tyrosine UAU codon should be changed into the CAU codon for histidine, which is universally found encoded at this position in all other species. Remarkably, the histidine residue is even conserved in vertebrate cox3 sequences. However, no evidence for RNA editing has been found in the analysis of cdna sequences of Chara. The genomic sequence of Chara may point to the former existence and subsequent loss of RNA editing in this alga. More mitochondrial sequence data for Chara and related algae (e.g. Nitella spp.) will help to clarify this possibility. The 3'-terminal part of the cox3 gene To evaluate the results obtained for RNA editing frequencies and the phylogenetic tree construction (see below) 1406 derived from analysis of the upstream cox3 region we have started a parallel investigation of the 3'-region of this gene (Figure 1). Additional interest in the 3'-terminal part of the cox3 gene is based on the presence of a second group II intron in cox3 of M.polymorpha (Figure 1) that has significant homology to the intron in the mitochondrial rpslo gene of angiosperms described recently (Knoop et al., 1995; Zanlungo et al., 1995). A 248 bp region from the 3'-terminal half of the gene has been amplified from nucleic acid preparations of diverse species. A length variation is observed in this part of the cox3 reading frame due to insertion of two codons after position 22 of the alignment in Pellia (Figure 3). The occurrence and frequency of RNA editing in the different species as deduced from analysis of the upstream cox3 region are corroborated. Definite conclusions about editing can be drawn for Oenothera, Pellia, Asplenium, Gnetum, Osmunda, Ophioglossum and Anthoceros, where both DNA and cdna sequences are available. In the fern Asplenium a total of 18 editing events are observed in the downstream cox3 region, with only eight conventional C-4U edits and 10 reverse exchanges. As in the 5'-region, genomically encoded stop codons are removed from the cox3 reading frame in three instances (positions 35, 95 and 230) in this part of the Asplenium cox3 gene. Comparable with the observations made for the upstream cox3 region, the second leptosporangiate fern species Osmunda also shows both types of editing. The two reverse edits (positions 176 and 185) in the Osmunda sequence are in common with Asplenium and are needed to restore well-conserved histidine codon identities. Three of the seven conventional C--U editing events observed for this part of Osmunda cox3 mrna are silent. Reverse edits have not been observed for the eusporangiate ferns in the upstream region, but one such event is now found in the 3'-region of cox3 mrna of Ophioglossum. This editing event (position 230) is needed to remove a genomic stop codon and is shared with Asplenium and Anthoceros. Additionally, eight conventional C->U editing events are observed in Ophioglossum, six of which reconstitute conserved amino acid codons. The liverwort Pellia shows six conventional C--U edits

5 RNA editing in bryophytes A Triticum Oenothera 99 Ephedra 84 Gnetum Picea 31 Girikoo 28 Cycas Osmunda Asplenium _ Angiopteris Psilotum 60 Tmesipteris B Triticum Oenothera - ~Ephedra C 40 (23) 37 (18) /100 Cycas Asplenium Triticum 99 Oenothera 72 Ophioglossum Equisetum 41 - Isoetes Lycopodium _ 3--E oo Marchantia 3 1 Peflha 73 Tetraphis 3 Physcomitrella 72 Ceratodon 76 Sphagnum 90 I Anthoceros 100 Chara _ Coleochaete _E57: Stichococcus Prototheca Saccharomyces Stichoc Protothe Equisetum - Isoetes Lycopodium Sphagnum Physcomitrella Pellia Chara 100/100,, 76 (28) L (26) E Anthoceros Prototheca Saccharomyces Psilotum Ophioglossum M archantia Pellia Fig. 4. Phylogenetic tr-ees obtained with the PHYLIP programii package. The yeast sequence was chosen as outgroup to root the trees in each case. Trees were reorganized by flipping certain branches using RETREE for the sake of a more convenient comparison. Sequences (cdna) used were as shown in Ficures 2 and 3 and accession nos for the species not included in these figures are: Gitkgo bilobai X76280: Triticumn o.stiviwin X52539; ellti p)lwens X53679; Stichococci.s X Coleochtiete X76270; Protothecti wicketaoiii UL02970: Saccha(romvces ce)evi.sitie M Further data are available for a number of angliosperm species. but were not included due to lack of additional phylogenetic information. (A) Conisensus derived from 10() tr-ees constructed by the parsimony method (DNAPARS) after bootstrapping based on the alignment as shown in Fivure 2. Numllbers at the branches indicate the percentage of trees in which a group is present in the 100 bootstrap replicates of the data set. (B) Tree fromii the idientical data set conistructed by the ImlaximiluIml likelihood method (DNAML) with the default transition/transversion ratio of PiKci tbiebs X76278: Pli'.scomiti 2.0. (C) Tree as in (A) but based on the combined set of sequences ( nt) shown in Figures 2 and 3. with bootstrap values indicated as in (A). Additionally. bootstrap values are given for the nucleotide data restricted to the upstream region after the oblique or in parentheses. Parentheses indicate that the given bifurcation is not present in the consensus tree topology of the smaller data set. in this region, five of which are needed to re-establish conserved codon identities. Comparison of DNA and cdna sequences confirm RNA editing in Anithoceros in the 3'-terminal part of cox3. Sequences of independent genomic clones from Anithoceros DNA are homogeneous in this gene region. Both conventional and reverse edits at a total of 10 sites are observed in cdna of Anthoceros. In the 3'-terminal part of the cox3 gene, however, these edits are all nonsilent and are required to re-establish amino acid identities or (in two cases) to remove in-frame stop codons, as observed for the fern Asplenzium. No conclusions about the distribution of editing sites in this region of cox3 can as yet be made for Psilotum, where currently only the cdna sequence is available. For Cvcas and Equisetumn only genomic sequences are at present available for this cox3 region. In Equisetum one editing event is predicted at position 159, to reconstitute a phenylalanine codon universally conserved among other plants. In Cycas, however, 10 sites are predicted to be altered by C-*U exchanges in order to re-establish conserved amino acid codons and this observation is in correspondence with the high editing frequency (19 sites) observed for Cvcas in the 5'-region of the gene. Phylogenetic aspects of land plant evolution The cdna sequences as listed in Figure 2 and others obtained earlier for the cox3 gene have been used to construct phylogenetic trees by different methods implemented in the PHYLIP program package (Felsenstein, 1994). A consensus tree derived from 100 bootstrap replicates by the parsimony method (DNAPARS) is shown in Figure 4A. The maximum likelihood method (DNAML) results in a very similar tree topology for the data set of sequences from 28 species (Figure 4B). High bootstrap values for the parsimony consensus tree correspond to long branch lengths at the relevant nodes in the maximum likelihood tree and thus concurrently indicate branchings of high reliability. Consistently low bootstrap values in the parsimony analysis correspond to short node branch lengths in the maximum likelihood topology. Sister genera of the classically defined embryophyte groups angiosperms (Oenotherac berteriana and Triticum aestiv'um), gnetopsids (E.gerardiana and G.gnemon), whisk ferns (P.nudum and 1407

6 O.Malek et al. Telongata), club mosses (L.squarrosum and liacustris) and liverworts (M.polymorpha and P.epiphylla) cluster as distinct clades in our trees in each case with high bootstrap reliability. While the position of Lycopodium in relation to the bryophytes was not clearly resolved in earlier phylogenetic trees, the lycopsids now clearly branch off as the most basal tracheophyte group. This grouping is now widely supported by classical systematics, which also place lycopsids at the base of the tracheophyte phylogeny. Only one extant genus (Equisetum) is described for sphenopsids. The horsetail species under investigation, E.arvense, branches off after the lycopsids in the tracheophyte section of the tree. The fern species expectedly occupy intermediate positions between the horsetail and the seed plants. The evolutionarily advanced leptosporangiate fern Osmunda groups as a neighbour to the seed plants and the eusporangiate fern Ophioglossum branches off next to the psilotopsids; the classical separation of eusporangiate and leptosporangiate ferns is otherwise not reflected in the trees. The leptosporangiate fern Asplenium and the eusporangiate fern Angiopteris are joined as sister groups (albeit with low bootstrap reliability) and branch off between the other ferns. While the branching of the eusporangiate fern Ophioglossum together with the whisk ferns observed with both tree-building methods may appear unusual, it should be noted that psilotopsids and Ophioglossales indeed share several classical developmental characteristics, such as a persistent prothallus and obligate mycorrhiza during this stadium. Both the maximum likelihood and parsimony analyses include the hornwort Anthoceros as the most basal land plant lineage of the data set. External support for this branching comes from investigation of some morphological traits, e.g. chloroplast number and structure, which indicate significant similarity between Anthoceros and algal chloroplasts. Whether liverworts or mosses are to be regarded as the sister group to the tracheophytes remains largely unresolved in the maximum likelihood analysis (Figure 4B) and the inclusion of liverworts as a sister group to the tracheophytes is statistically insignificant in the parsimony analysis (Figure 4A). Among the four moss sequences the primitive moss Sphagnum occupies the basal position, as is also suggested by classical systematics. The two gnetopsids E.gerardiana and G.gnemon are expectedly joined as sister groups in the trees, but a specific affiliation of the gnetopsids with angiosperms remains statistically unsupported. The algal sequences from Prototheca wickerhamii, Stichococcus, Coleochaete and Chara assemble with high bootstrap reliability at the base of the embryophyte phylogeny in this ordering. While some bootstrap values in Figure 4A clearly indicate affiliations of high reliability, other junctions are poorly supported statistically. To this end we have (upon suggestions made during the reviewing process) used the data available for the downstream cox3 region (Figure 3) to base our trees on a larger data set. A parsimony tree based on the combined sequences of the upstream (381 nt) and downstream (254 nt) alignments from the set of species for which sequences of both regions are available is shown in Figure 4C. The resulting tree shows no essential topological differences from the trees based on a smaller number of informative sites (Figure 4A and B) with respect to the branching order of the major plant phyla (not considering the restricted species set). Some branchings are, however, now supported with higher bootstrap reliability. Most interestingly, Ophioglossum is still included as the nearest neighbour to the psilotopsid Psilotum, but with a greatly increased bootstrap reliability (72). Equisetum expectedly still occupies an intermediate position between bryophytes and the other vascular plants. Also, the inclusion of Anthoceros as the most basal genus in the land plant phylogeny remains unaltered, albeit with a higher bootstrap reliability. Likewise, Gnetum is included as the sister group of the angiosperms with higher reliability, but the restricted species sampling for the set of extended sequences must be kept in mind as a cautionary reservation. Discussion The phylogeny of land plants The macrosystematics and phylogeny of early land plants are still being debated. An excellent summary reviewing classical and molecular approaches to define a comprehensive land plant phylogeny is provided in a recent paper by Manhart (1994). It is generally assumed that a green alga related to the class Charophyceae gave rise to the embryophytes. Different systematic classifications have been suggested for green algae that are distinguished by the number of orders belonging to the Charophyceae. In agreement with the recently established view that an alga specifically related to the order Charales gave rise to land plants, our phylogenies place Chara as a sister group to the latter. Coleochaete and Stichococcus are included in different orders of the Charophyceae (Coleochaetales and Klebsormidiales respectively) by some systematicists or even in different classes by others and are found at more basal positions in our trees. The inference that Chara is more closely related to embryophytes than Coleochaete contradicts a phylogeny obtained recently from nuclear rrna sequences (Kranz et al., 1995). Bryophytes are considered a paraphyletic group at the root of the embryophyte tree with only the true mosses (Musci) or the liverworts giving rise to tracheophytes and hornworts as a sister group to all other land plants. The seven bryophyte species included here indeed cluster as a paraphyletic group at the bottom of the embryophyte phylogeny, but it remains unresolved whether mosses or liverworts are more likely as the sister clade to the tracheophytes. Due to the lack of useful morphological or physiological characters a definite phylogeny for the early vascular plants (and here mainly for the three fern ally groups psilotopsids, lycopsids and sphenopsids) remains to be established. Molecular studies have supported the view that lycopsids are most closely related to bryophytes (Raubeson and Jansen, 1992). Our studies clearly support the placement of lycopsids at the root of the tracheophyte tree, since the members of the two lycopsid genera Isoetes and Lycopodium are placed together as a sister group to all other vascular plants. Likewise, the two psilotopsid genera Psilotum and Tmesipteris constitute a dichotomy of high reliability branching off after the sphenopsid Equisetum in the vascular plant phylogeny. The unequi- 1408

7 RNA editing in bryophytes vocal affiliation of Tmesipteris with Psilotum questions a suggested close relation to hornworts based on a morphological trait (Frey et al., 1994) and rather confirms its earlier classification as a psilotopsid. Clearly though, the data set has to be extended to allow statistically meaningful assessments concerning the grouping of leptosporangiate and eusporangiate ferns and the here observed affiliation of Ophioglossum with the psilotopsids. Molecular data may in the future render these classically defined groups phylogenetically meaningless. An extension of the data set should take into account both a wider sampling of key species and more phylogenetically informative positions, possibly based on additional and slightly faster evolving mitochondrial protein genes. Different molecular markers for phylogenetic reconstruction In the contribution of Manhart (1994) the chloroplast rbcl gene (encoding the large subunit of the ribulose bisphosphate carboxylase) was used as a molecular marker in an attempt to deduce a similarly comprehensive phylogeny including representatives of all land plant groups and diverse green algae. The phylogenetic trees obtained, however, were in conflict with phylogenetic assessments derived from classical characters, even after modifying diverse parameters of tree construction. The chloroplast phylogenies (Manhart, 1994) relied on ~1.5 kb of rbcl gene sequence, i.e. nearly four times the mitochondrial sequence data reported here. The unsuitability of a special molecular sequence for a given purpose, inadaequate taxon sampling or unequal rates of evolution are generally responsible for unsatisfactory results in phylogenetic tree construction. Chloroplast sequences in general appear to be better suited to phylogenetic analysis close to the familial level (Clegg and Zurawski, 1992). Additionally, as also discussed by Manhart (1994), RNA editing may play an important role in determining the phylogenetically informative nucleotide sequence in the chloroplast rbcl gene and may thus render attempts to obtain reliable phylogenies directly from genomic DNA sequences questionable. In this respect a survey of land plants for the occurrence of editing in chloroplasts, as reported here for mitochondria, may give informative insights into both the evolution of RNA editing and the employment of chloroplast nucleotide sequences in phylogenetic studies. It will be interesting to see whether the occurrence of RNA editing in the two plant organelles correlates, i.e. whether all vascular plants and some bryophytes show chloroplast RNA editing. Such a finding would consequently prompt speculation about a common evolutionary origin and maybe even a common mechanism for the RNA editing process in chloroplasts and mitochondria. Evolution and raison d'etre of RNA editing The existence of RNA editing in all three classes of bryophytes is probably the most surprising finding reported here; plant mitochondrial RNA editing is consequently older than previously assumed. The differences in RNA editing between the two liverworts Marchantia and Pellia, the two lycopsids Isoetes and Lycopodium and also the two gnetopsids Gnetum and Ephedra show that RNA editing frequency does not correlate with the phylogenetic position of a species. Correlating the occurrence of editing in plant mitochondria with the phylogentic trees suggests more than one independent loss or gain of editing activity. The suspicious case of a TAT (tyrosine) codon in Chara where a conserved CAT (histidine) codon is found in all other species may indicate that RNA editing even predates the occurrence of land plants and was only later lost in certain lines of land plant evolution, such as thalloid liverworts (Marchantia). Additional sequence data of the Charales and Musci will verify or falsify the assumptions about the absence of RNA editing in distinct species of these groups. Very much like the splicing of introns, RNA editing is an apparently superfluous detour in the cell to establish an RNA sequence that could just as well be transcribed directly from a co-linear DNA sequence. Phenomena like alternative splicing and regulatory influences may 'justify' the existence of introns in the eukaryotic nucleus and similar speculations about the reasons for RNA editing in plant organelles have been made. RNA editing may add additional dimensions to gene expression, allowing for different proteins to be made from only one gene by differential editing or providing additional features for gene regulation. Still more sophisticated speculations include the proposal that RNA editing may help to avoid certain DNA sequences incompatible with other processes in the organelles. There is little support for this idea, however, due to the lack of convincing common sequence features surrounding editing sites. As a simple alternative rationale editing may just compensate at the RNA level for genetic drift from thymidine to cytidine in DNA (i.e. towards an increased G+C content) to re-establish the required codon identities. Consequently, a cofrelation is to be expected between the G+C content of a sequence and the observed frequency of editing. To test this hypothesis we plotted the genomic G+C content in cox3 against the number of C->U RNA 0) (0) 01) Cn i0 U) z (G+C) content vs. number of editing sites Chara esel % 0 Isoetes (G+C) residues Fig. 5. Number of G+C residues in the upstream 381 nt cox3 region (x axis) plotted against the number of RNA editing sites (y axis). Each C->U editing event is counted as + 1 and each reverse editing (U-*C) as -1. The set of land plant species is as in Figure 4A (excluding Anthoceros, but including the alga Chara). Linear regression results in a correlation coefficient r2 of 0.77 and the slope of the regression curve is Changes in G+C content are mainly due to changes in C residue number on the coding strand, with only minor variations in the number of G residues (87 + 6). 1409

8 O.Malek et al. editing events for the species investigated (Figure 5). A positive linear correlation (r2 = 0.77) between editing frequency and G+C content is observed. This observation is in agreement with the idea that RNA editing may allow a drift of mitochondrial DNA sequences from U to C which can be compensated for at the RNA level once the RNA editing machinery had been established. A model has been proposed in which a RNA editing activity (e.g. a deaminase activity fortuitously operating on polyribonucleotides) becomes fixed by genetic drift after mutations at the DNA level require RNA alterations to express the conserved protein sequence from the edited RNA (Covello and Gray, 1993). This idea is in accord with the observed proportionality of editing frequency and genomic G+C content observed here for the cox3 gene. Inherent in this idea, however, is the possibility that editing can be lost in the evolution of certain plant lineages (e.g. Marchantia) when the genomic G+C content drifts back to lower values, as suggested by the phylogeny presented here. Materials and methods Biological material When available, fresh plant material was kindly provided by the Berlin Botanical Garden. Tmesipteris elongata was a kind gift from Drs Frey and Kurschner (Berlin) and Isoetes lacustus was kindly provided by Drs Moberg and Martinsson (Uppsala). Anthoceros crispulus and Pepiphvlla were kindly made available by Dr Binding (Kiel). Anthoceros and Pellia were cultivated on MS agar. Chara corralina grown in culture was kindly provided by Dr Fisahn (Berlin) and Tpellucida was obtained with the kind help of Dr Muhle (Ulm). Nucleic acids were extracted either immediately after harvesting or after storage at -20 C. Molecular biological procedures Nucleic acids were prepared from g plant material by the CTAB method (Doyle and Doyle, 1990). Crude nucleic acid preparations were separated into RNA and DNA by differential precipitation in the presence of lithium acetate and subsequent digestion with DNase and RNase respectively. The Boehringer Mannheim kit was used for cdna synthesis with random hexamer primers. An aliquot of the cdna synthesis reaction was used directly for PCR amplification. PCR amplification was at 50 or 45 C annealing temperature with oligonucleotide primers (5'-*3') cox3 15 (GTAGATCCAAGTCCATGGCCT), cox3 13 (GCATG- ATGGGCCCAAGTTACGGC), cox325 (CATCCGGAGCTCCCGTG- ACTTGGGC) and cox323 (GCGAATTCAAAGCCAACGTGATGCT). Oligonucleotides were purchased from TIB Molbiol (Berlin). PCR assays were routinely purified on Microcon-30 columns (Amicon Inc.) and eluted from preparative agarose gels after restriction digestion. PCR products were cloned into Bluescript (Stratagene) vectors via restriction sites in the primer sequences. Approximately four clones were sequenced for each DNA and cdna cloning of a species by the dideoxy chain termination procedure using the Pharmacia sequencing kit. Alternatively, PCR was carried out with one biotinylated primer and subsequently one strand of the PCR product was purified using streptavidin-coated Dynabeads M-280 (Dynal) and used directly as the template for dideoxy sequencing. Comparison of cdna and DNA sequences was used as a control for PCR errors where generally only C*-4U exchanges attributable to RNA editing were observed. The majority of editing events can be predicted from comparison of the genomic sequences and were generally confirmed by cdna sequencing. Rare sequence divergencies in one of a set of clones were considered PCR artefacts. A higher rate of such divergence (mostly G<->A) was observed for independent genomic clones in Anthoceros (see the corresponding database entry). Computer analysis The UWGCG program package for the VAX/VMS (Genetics Computer Group, 1994) was used for initial sequence handling and analysis. Phylogenetic tree construction (Felsenstein, 1988) was with the PHYLIP 3.56 package in the Power Macintosh version obtained via ftp from evolution.genetics.washington.edu (Felsenstein, 1994). Default values were used for run parameters; further details are given in Results and the figure legends. Acknowledgements We are very grateful to our colleagues for providing plant material and helping with classical systematics, most importantly to Drs Moberg and Martinsson (Uppsala), Frey and Kurschner (Berlin), Muhle (Ulm), Binding (Kiel) and Fisahn (Berlin) and T.Durbye and his colleagues from the Berlin Botanical Garden. Additional thanks are due to Herrn Fritsche for taking care of the greenhouse plants. Finally, we would like to thank three anonymous referees for helpful comments to improve this manuscript. References Binder,S., Marchfelder,A. and Brennicke,A. (1994) RNA editing of trnaphe and trnacys in mitochondria of Oenothera berteriana is initiated in precursor molecules. Mol. Gen. Genet., 244, Bonnard,G., Gualberto,J.M., Lamattina,L. and Grienenberger,J.-M. (1992) RNA editing in plant mitochondria. Crit. Rev: Plant Sci., 10, Clegg,M.T. and Zurawski,G. (1992) Chloroplast DNA and the study of plant phylogeny: present status and future prospects. In Soltis,P.S., Soltis,D.E. and Doyle,J.J. (eds), Molecular Svstematics of Plants. Chapman and Hall, London, UK, pp Covello,P.S. and Gray,M.W. (1989) RNA editing in plant mitochondria. Nature, 341, Covello,P.S. and Gray,M.W. (1993) On the evolution of RNA editing. Trends Genet., 9, Doyle,J.J. and Doyle,J.L. (1990) Isolation of plant DNA from fresh tissue. Focus, 12, Felsenstein,J. (1988) Phylogenies from molecular sequences: inference and reliability. Annu. Rev. Genet., 22, Felsenstein,J. (1994) Program Manual for the PHYLIP 3.5c Package. Washington University, Seattle, WA. Frey,W., Campbell,E.O. and Hilger,H.H. (1994) Structure of the sporophyte-gametophyte junction in Tmesipteris elongata P.A. Dangeard (Psilotaceae, Psilotopsida) and its phylogenetic implications-a SEM analysis. Nova Hedwigia, 59, Genetics Computer Group (1994) Program Manual for the Wisconsin Package Version 8. Genetics Computer Group, University of Wisconsin, Madison, WI. Gualberto,J.M., Lamattina,L., Bonnard,G., Weil,J.-H. and Grienenberger, J.-M. (1989) RNA editing in wheat results in the conservation of protein sequences. Nature, 341, Hiesel,R., Wissinger,B., Schuster,W. and Brennicke,A. (1989) RNA editing in plant mitochondria. Science, 246, Hiesel,R., Combettes,B. and Brennicke,A. (1994a) Evidence for RNA editing in mitochondria of all major groups of land plants except the bryophyta. Proc. Natl Acad. Sci. USA, 91, Hiesel,R., von Haeseler,A. and Brennicke,A. (1994b) Plant mitochondrial nucleic acid sequences as a tool for phylogenetic analysis. Proc. Natl Acad. Sci. USA, 91, Hoch,B., Maier,R.M., Appel,K., Igloi,G.L. and Kossel,H. (1991) Editing of a chloroplast mrna by creation of an initiation codon. Nature, 353, Knoop,V., Ehrhardt,T., Lattig,K. and Brennicke,A. (1995) The gene for ribosomal protein S10 is present in mitochondria of pea and potato but absent from those of Arabidopsis and Oenothera. Curr Genet., 27, Kranz,H.D., Miks,D., Siegler,M.-L., Capesius,I., Sensen,C.W. and Huss,V.A.R. (1995) The origin of land plants: phylogenetic relationships among charophytes, bryophytes and vascular plants inferred from complete small-subunit ribosomal RNA sequences. J. Mol. Evol., 41, Manhart,J.R. (1994) Phylogenetic analysis of green plant rbcl sequences. Mol. PhYlogenet. Evol., 3, Marechal-Drouard,L., Ramamonjisoa,D., Cosset,A., Weil,J.-H. and Dietrich,A. (1993) Editing corrects mispairing in the acceptor stem of bean and potato mitochondrial phenylalanine transfer RNAs. Nucleic Acids Res., 21, Marienfeld,J.R., Reski,R. and Abel,W.O. (1991) The first analysed archegoniate mitochondrial gene (cox3) exhibits extraordinary features. Curr Genet., 20, Oda,K. et al. (1992) Gene organization deduced from the complete 1410