UNIVERSITY OF CINCINNATI

Transcription

1 UNIVERSITY OF CINCINNATI Date: I,, hereby submit this work as part of the requirements for the degree of: in: It is entitled: This work and its defense approved by: Chair:

2 Reproductive ecology and population genetics of mycoheterotrophic plant species in the Monotropoideae (Ericaceae) By Matthew R. Klooster B.S. Biology, Xavier University, 2003 A Doctoral Dissertation Submitted to the Faculty of the University of Cincinnati Department of Biological Sciences Advisor: Dr. Theresa Culley As Partial Fulfillment of the Requirements For the Degree of Doctor of Philosophy in Biology May 2008

3 ABSTRACT Myco-heterotrophic plants of the Monotropoideae (Ericaceae) have long been used as model organisms for studies of non-photosynthetic plant biology. These taxa have evolved unique morphological and life history adaptations, not found in most photosynthetic taxa, and experience a unique set of ecological and evolutionary limitations resulting from highly specialized associations with mycorrhizal fungi. Although much is known about the symbiotic mode of carbon acquisition and many convergent life history traits shared across mycoheterotrophic taxa, the reproductive ecology and population genetic structure of these plants is poorly understood. To assess the complexity and specialization in myco-heterotroph reproductive ecology, a comparative analysis was conducted between two closely related genera, Monotropa L. and Monotropsis Schwein. ex Elliot, using three plant species. Three consecutive years of field observations and manipulations on various components of plant reproduction revealed that the species Monotropa uniflora L. and color forms within the congener Monotropa hypopitys L. each exhibited unique reproductive traits (e.g., differences in seasonal timing and duration of reproductive development and phenology, specialization on Bombus spp. pollinators, and breeding systems), many of which differed considerably from Monotropsis odorata Schwein. ex Elliot. Additionally, 11 microsatellite markers were developed for Monotropa hypopitys to assess for the first time, the population genetic structure of myco-heterotrophic plants, while also addressing the appropriate taxonomic placement of the red and yellow color forms of M. hypopitys. Results from this study demonstrated relatively low to moderate levels of genetic variation and high levels of genetic differentiation across most populations. In addition, genetic structuring between red and yellow color forms was suggestive of speciation and the need for a taxonomic revision. Finally, analyses were conducted to determine if cryptic mimicry i

4 functions as an effective defense strategy for herbivore avoidance in Monotropsis odorata. Although a substantial body of functional data supports cryptic mimicry as a defense adaptation in animal systems, it has only been hypothesized to exist in plants. Here we show for the first time, through empirical manipulations and reflectance data that M. odorata possesses adaptive morphology and coloration that mimics leaf-litter, and this functions as a defense strategy for avoiding attacks from visually guided herbivores. ii

5 iii

6 ACKNOWLEDGEMENTS It has been a great honor and privilege to work with a diverse group of researchers and naturalists throughout the duration of this study. Without their expert knowledge, intellectual wisdom, and astute powers of observation, this project would not have been possible. Additional inspiration has come from many sources and has taken many forms. To the following exceptional individuals I am forever grateful: The late Dr. John Thieret, who once stated that a research endeavor requiring sizable populations of Monotropa and Monotropsis is a fool s errand, for they are much too rare and unpredictable. You struck upon my German stubbornness and for that, I thank you. Dan Boone for teaching me the local flora of the Ohio River Valley and showing me where to find the real gems. Marjie Becus, Jim Decker, Mark Dillon, Mary Dodson, Jeremy Gibson, Barb Lund, Mark Pistrang, and David Taylor for providing assistance with locating populations of these elusive species. Dr. Victor Soukup for locating sizable populations of some of the more elusive species, rendering this work possible. The late Bill Culbertson and Stan Lockwood for providing me access to their pristine property to study sizeable populations of these taxa. Adam Hoenle for assistance with lab research and for functioning as my first mentee. I have total confidence in you and your ability to make a profound impact, no matter where life takes you. iv

7 Dr. s Denis Conover, Susan Dunford, Eric Maurer, A. Randall Olson, and Victor Soukup for providing me with guidance and unparalleled support throughout the development and implementation of this research project. Thank you to each of you for seeing me through this process and functioning as model intellects, on which I have imprinted and from which I have grown. Dr. Theresa Culley for providing me with a home, freedom, support, and opportunity. You have seen me through many emotional and intellectual seasons with such patience and dedication and for that, I am forever grateful. I sincerely believe this research would not have been possible without your exceptional intellect and advice. It is an understatement to say that I feel wholly blessed to have you as my mentor. My family and friends for standing by me through my frenzied days as a graduate student. The late Judy Klooster (mom) whose unconditional love guided me through this endeavor as it has through all of life s challenges. It was our shared love of the natural world that sparked my passion and carried me to this summit of accomplishment. I hope, wherever you are, you find cause to continue gracing me with your inspiration. Dr. Dale Klooster (dad), to whom I dedicate this work. Throughout life, your work ethic, love of learning, belief in the power of education, selflessness, and support have been my greatest inspirations. I have always been proud to speak of your intellectual accomplishments and I hope this work can return the favor. Lastly, my best friend and wife to be, Jennifer, who has taught me the meaning of happiness and contentment. Your unwavering support and confidence has afforded me the courage to self-actualize. I know that the future will be bright and full of endless discoveries, with you by my side. v

8 TABLE OF CONTENTS ABSTRACT... i ACKNOWLEDGEMENTS.... iv TABLE OF CONTENTS.... vi LIST OF TABLES.. vii LIST OF FIGURES... viii CHAPTER 1 Background CHAPTER 2 Comparative analysis of the reproductive ecology of Monotropa and Monotropsis: Two myco-heterotrophic genera in the Monotropoideae (Ericaceae) CHAPTER 3 Characterization of microsatellite loci in the myco-heterotrophic plant, Monotropa hypopitys L. (Ericaceae) and amplification in related taxa CHAPTER 4 Population genetic structure of Monotropa hypopitys L. (Ericaceae) and differentiation between red and yellow color forms CHAPTER 5 Cryptic mimicry is an effective defense strategy for herbivore avoidance in the myco-heterotrophic plant Monotropsis odorata (Ericaceae).. 86 CHAPTER 6 Conclusion vi

9 LIST OF TABLES CHAPTER 2 Table 1. Study site locations and population sizes of Monotropsis odorata, Monotropa uniflora, and Monotropa hypopitys (red and yellow color forms). Table 2. Results of repeated measures ANOVAs for the reproductive effort of multiple populations of three myco-heterotrophic taxa surveyed over three consecutive years. Table 3. The visitation duration and fidelity of Bombus spp. Pollinators, foraging in the largest population of three myco-heterotrophic taxa. Table 4. Results of 3-Way nested ANOVAs for the reproductive output and ratios of floral and fruit herbivory of four myco-heterotrophic taxa across three years of study. Table 5. The relative proportion of flowers and fruits damaged by various types of herbivory of four myco-heterotrophic taxa. Table 6. Results from breeding system experiments using pollinator exclusion tents to determine percentages of fruit set in self-compatibility and autogamy treatment groups for four myco-heterotrophic taxa. CHAPTER 3 Table 1. Eight polymorphic forward and reverse microsatellite primer pairs developed from the red, fall-blooming color form of Monotropa hypopitys. Table 2. Amplification of microsatellite primers developed for Monotropa hypopitys in related taxa. CHAPTER 4 Table 1. Populations of the red and yellow color forms of Monotropa hypopitys located across Ohio and Indiana (eastern United States). Table 2. Descriptive genetic statistics of populations of the red and yellow color forms (Monotropa hypopitys). Table 3. Pair-wise genetic differences and geographic distances of seven populations of Monotropa hypopitys. Table 4. AMOVA results for the partitioning of microsatellite variation of Monotropa hypopitys between red and yellow color forms, among populations, and within populations. vii

10 LIST OF FIGURES CHAPTER 2 Figure 1. Reproductive phenologies of multiple populations of four myco-heterotophic taxa monitored from Figure 2. The proportion of total floral visitations by insect taxa on flowers of four mycoheterotrophic taxa. Figure 3. Mean frequency of flowers produced by plants in populations of four mycoheterotrophic taxa surveyed from Figure 4. The floral morphology of four myco-heterotrophic taxa. CHAPTER 4 Figure 1. UPGMA phenogram of seven populations of Monotropa hypopitys including red and yellow color forms. Figure 2. Principal coordinates analysis of samples from seven populations of Monotropa hypopitys consisting of the red and yellow color forms. CHAPTER 5 Figure 1. Cryptic reproductive stems of Monotropsis odorata with intact bracts and with bracts experimentally removed. Figure 2. Mean frequency of predated flowers for control and experimental groups subdivided by time increments, with relative proportions of flower loss by herbivory type. Figure 3. Mean frequency of mature fruits for control and experimental groups. Figure 4. Mean reflectance spectra of petals, stems, and bracts from Monotropsis odorata collected during anthesis, and mean dry leaf litter collected from the base of reproductive stems (representing eight indigenous tree species). Figure 5. Reflectance color scores of petals, stems, bracts, and leaf litter, plotted in Endler s (1990) color space. Figure 6. Color contrast (i.e., mean Euclidian distances) among petals, stems, bracts, and leaf litter color scores. Figure 7. Brightness contrast (i.e., mean intensity contrasts) among petals, stems, bracts, and leaf litter. viii

11 CHAPTER 1 - Background Myco-heterotrophy is a fascinating system of symbiosis that has broad ecological and evolutionary implications for our understanding of plant biology. Defined as plant species that obtain carbon resources from mycorrhizal associates, myco-heterotrophs are a diverse group of organisms both morphologically and ecologically. Convergently evolving this mode of nutrition, myco-heterotrophic plants are found to occur in both monocot ( 368 spp.) and dicot ( 48 spp.) lineages and are typically achlorophyllous for part or all of their lives (Leake 1994). A substantial body of research has shown that these plants obligately associate with specific basidiomycete and ascomycete mycorrhizal taxa (Cullings et al. 1996; Taylor & Bruns 1999; Bidartondo & Bruns 2002; Bidartondo et al. 2002; Taylor et al. 2003). Many of these mycorrhizae are found to connect with neighboring autotrophic host plants, providing limited micronutrients, phosphorous, and nitrogen in exchange for photosynthates (Björkman 1960; He et al. 2003). The myco-heterotroph has evolved by exploiting this mutualism through a carbon laundering, tripartite association. Functioning as a true carbon sink, these plants assimilate carbohydrates and nutrients channeled from host autotrophs through shared mycorrhizal connections without providing any known benefit to the system (Björkman 1960). It has been proposed that mycorrhizal specificity may be responsible for the evolutionary diversification of some myco-heterotrophic taxa in the Orchidaceae and has likely contributed to speciation in many other plant lineages (Taylor et al. 2003). Besides sharing a common mode of carbon acquisition, myco-heterotrophs have a number of other convergent life history traits. It is thought that many of these species first evolved in dense forest habitats possessing low light levels (Wallace 1975; Cullings et al. 1996; 1

12 Bidartondo 2005); these habitats are typically found to lack a substantial herbaceous layer and possess few autotrophic competitors. Densely accumulated leaf litter and thick humus cultivate a vast network of mycorrhizal fungi and may produce a unique microclimate necessary for mycoheterotroph growth and development. Removal of the forest canopy and alteration of litter composition has been shown to severely impact myco-heterotroph survival and propagation (Luoma 1987; Moola & Vasseur 2004; M. Klooster pers. obs.). These plants predominantly exist as underground root masses that can vary in morphology from creeping (coralline) to dense balls (Wallace 1975; Leake 1994). On occasion, highly modified reproductive stems are produced (Olson 1990), each possessing one to many distinct flowers. Reproduction is thought to be fairly erratic as in the ghost orchid (Epipogium aphyllum) that is known to lie dormant for up to thirty years between reproductive events (Leak 1994). Luoma (1987) observed the reproductive effort of a large population of Sarcodes sanguinea and reported that plants did not become reproductive for more than two out of five consecutive seasons. Flowers vary dramatically in size, color, and fragrance, but once fertilization takes place, all species produce numerous, dust-like seeds with minimal endosperm (Olson 1993; Arditti & Ghani 2000; Batygina et al. 2003). Unipolar seed germination is found in both monocot and dicot lineages and is often induced by the presence of a specific mycorrhizal associate (Leake 1994; Bidartondo & Bruns 2002). Due to a lack of endosperm, young plants require almost immediate association with mycorrhizae in order to survive beyond initial germination (Leake et al. 2004). Mycoheterotrophs cannot exist in habitats lacking their fungal associate, and as a consequence, many taxa are rare endemics with limited distributions. Although much is known about the symbiotic mode of carbon acquisition and many convergent life history traits, the reproductive ecology and population genetic structure of myco-heterotrophic species are poorly understood. 2

13 The Monotropoideae (Ericaceae) is an ideal system for studying the ecology of mycoheterotrophic taxa and comparing the strategies utilized by closely related genera and congeners. The Monotropoideae is an entirely non-photosythetic subfamily consisting of 15 species and 10 genera. Each genus associates with one to a few genera of basidiomycete ectomycorrhizae (Bidartondo & Bruns 2001) that entirely envelop roots in a distinctive Monotropoid infection (Duddridge & Read 1982). Research has shown that obligate relationships between plants and other organisms can result in narrow ranges of endemism. (Kruckeberg & Rabinowitz 1985). Subsequently, the rarity of most Ericaceous myco-heterotrophs likely correlates with the limited distribution of their mycorrhizal associate (Bidartondo & Bruns 2001). All plant genera are morphologically distinct in root structure, color, size, flower number, fragrance, pollen morphology, seed shape, and fruit type (Copeland 1935, 1937, 1938, 1939; Bakshi 1959; Wallace 1975; Wallace 1977; Leake 1994). Two genera, Monotropa and Monotropsis, were selected as the first model systems to investigate the reproductive ecology and population genetics of myco-heterotrophic plants. Much of the highly influential literature in the field of mycorrhizal biology and mycoheterotrophy has focused upon the genus Monotropa L. (Bidartondo 2005). Monotropa consists of two species, M. uniflora L.(Indian Pipe) and M. hypopitys L.(Pine Sap), which both exhibit a circumboreal distribution. As in other Monotropoid genera, multiple reproductive stems may be produced per plant, each containing one to many flowers (Wallace 1975). In this genus, reproductive stems and flowers are non-fragrant and conspicuously colored, ranging from solitary white flowers of M. uniflora to yellow and red color forms of M. hypopitys. Each species is capable of producing sizable reproductive stems that stand 4 12 tall. Flowers emerge from the ground in a nodding position and upon pollination, assume an erect orientation 3

14 (Wallace 1977; M. Klooster, pers. obs.). Fruits form into dry capsules that contain seeds with wing-like integuments for wind dispersal (Olson 1980). The monotypic genus, Monotropsis Schwein. ex Elliot, was also used as part of a comparative reproductive analysis and to empirically study the defense strategy of cryptic mimicry for the first time in plants. Monotropsis odorata Schwein. ex Elliot (Sweet Pine Sap) is a rare species endemic to the Appalachian Mountain Range and is presently listed as threatened or endangered in four states of its limited range (USDA Plant Database 2008). Found almost exclusively associated with Oak Virginia Pine (Pinus virginiana) forests, these plants possess coralline roots, which seasonally produce one to many reproductive stems that stand 2 4 tall (Copeland 1939). Known to produce highly fragrant flowers, these plants are very difficult to locate visually due to their small stature and seemingly cryptic, brownish bracts that cover the reproductive stems and encircle each flower. Flowers are deep purple to lavender colored and upon fertilization, produce berries with seeds that appear to be animal dispersed (Wolf 1922; Copeland 1939; Leake 1994). The goal of this dissertation is to answer novel questions concerning the evolutionary ecology of myco-heterotrophic taxa to add to our understanding of nonphotosynthetic plant species and their role in the environment. First, I present a comparative analysis of the reproductive ecology of Monotropa and Monotropsis (Chapter 2), offering insight into possible limitations and freedom of constraints inherent to a myco-heterotrophic life history. Second, I outline the development of eleven microsatellite markers in Monotropa hypopitys (Chapter 3). Third, these molecular markers are used in the first ever population genetic analysis of M. hypopitys (Chapter 4), demonstrating genetic divergence of populations in the eastern United States and the genetic structure of red and yellow color forms. Finally, analyses were conducted 4

15 to determine if cryptic mimicry functions as a defense strategy in Monotropsis odorata (Chapter 5), testing a novel defense adaptation never before empirically shown to exist in plants. Together these studies show that myco-heterotrophic plants play a dynamic role in the environment in which they live, adding to our understanding of the complexity of nonphotosynthetic plant ecology (Chapter 6). References Arditti, J. and Ghani, A.K.A Tansley Review No Numerical and physical properties of orchid seeds and their biological implications. New Phytol. 145: Bakshi, T.S Ecology and Morphology of Pterospora andromedea. Botanical Gazette 120: Batygina, T.B., Bragina, E.A., and Vasilyeva, V.E The reproductive system and germination in Orchids. Acta Biologica Cracoviensia 45: Bidartondo, M.I The evolutionary ecology of myco-heterotrophy. New Phytol. (Tansley Review) 167: Bidartondo, M.I. and Bruns, T.D Extreme specificity in epiparasitic Monotropoideae (Ericaceae): widespread phylogenetic and geographical structure. Molecular Ecology 10: Bidartondo, M.I. and Bruns, T.D Fine-level specificity in the Monotropoideae (Ericaceae): specificity for fungal species groups. Molecular Ecology 11(3): Bidartondo, M.I., Redecker, D., Hijri, I., Wiemken, A., Bruns, T.D., Domínguez, L., Sérsic, A., Leake, J.R., and Read, D.J Epiparasitic plants specialized on arbiscular mycorrhizal fungi. Nature 419:

16 Bijörkman, E Monotropa hypopitys L. an epiparasite on tree roots. Physiologia Plantarum 13: Copeland, H.F On the genus Pityopus. Madroño 3: Copeland, H.F The reproductive structures of Pleuricospora. Madroño 4: Copeland, H.F The structure of Allotropa. Madroño 4: Copeland, H.F The structure of Monotropsis and the classification of the Monotropoideae. Madroño 5: Cullings, K.W., Szaro, R.M., and Bruns, T.D Evolution of extreme specialization within a lineage of ectomycorrhizal epiparasites. Nature 379: Duddridge, J.A. and Read D.J An ultrastructural analysis of the development of mycorrhizas in Monotorpa hypopitys L. New Phytol. 92: He, X., Critchley, C., and Bledsoe, C Nitrogen transfer within and between plants through common mycorrhizal networks (CMNs). Critical Reviews in Plant Science 22(6): Kruckeberg, A.R. and D. Rabinowitz Biological aspects of endemism in higher plants. Annual Review of Ecology and Systematics 16: Leake, J.R Tansley Review No. 69. The biology of myco-heterotrophic ( saprophytic ) plants. New Phytol. 127: Leake, J.R., McKendrick, S.L., Bidartondo, M., and Read, D.J Symbiotic germination and development of the myco-heterotroph Monotropa hypopitys in nature and its requirement for locally distributed Tricholoma spp. New Phytol. 163(2):

17 Luoma, D.L Synecology of the Monotropoideae within Limpy Rock Research Natural Area, Umpqua National Forest, Oregon. M.S. Thesis. Oregon State University. Moola, F.M., and Vassuer, L Recovery of late-seral vascular plants in a chronosequence of post-clearcut forest stands in coastal Nova Scotia, Canada. Plant Ecology 172: Olson, R.A Seed morphology of Monotropa uniflora L. (Ericaceae). Amer. J. Bot. 67: Olson, R.A Observations on the floral shoots of Monotropa hypopitys (Monotropaceae). Rhodora 92: Olson, R.A Patterns of embryo formation in Monotropa hypopitys (Monotropaceae) from North America and Western Sweden. Amer. J. Bot. 80(7): Taylor, D.L. and Bruns, T.D Population, habitat and genetic correlates of mycorrhizal specialization in the cheating orchids Corallorhiza maculate and C. mertensiana. Molecular Ecology 8(10): Taylor, D.L., Bruns, T.D., Szaro, T.M., and Hodges, S.A Divergence in mycorrhizal specialization within Hexalectris spicata (Orchidaceae), a nonphotosynthetic desert orchid. Amer. J. Bot. 90(8): USDA Plant Profile Database, May Wallace, G.D Studies of the Monotropoideae (Ericaceae): Taxonomy and distribution. The Wasmann Journal of Biology 33: Wallace, G.D Studies of the Monotropoideae (Ericaceae). Floral nectaries: anatomy and function in pollination ecology. Amer. J. Bot. 64:

18 Wolf, W Notes on Alabama plants. A new Monotropoid plant. American Midland Naturalist. 8:

19 CHAPTER 2 Comparative analysis of the reproductive ecology of Monotropa and Monotropsis: Two myco-heterotrophic genera in the Monotropoideae (Ericaceae) M.R. Klooster and T.M. Culley Department of Biological Sciences University of Cincinnati Cincinnati, OH Tel: , Fax:

20 Abstract In recent years, research conducted upon pollinator and mycorrhizal associations has facilitated a better understanding of such highly specialized interspecific ecological interactions. Myco-heterotrophs, defined as plants that acquire carbon and nutrient resources from mycorrhizal fungi, have been tremendously useful as study organisms for mycorrhizal symbioses. Despite being free from some of the ecological constraints inherent to a photosynthetic life history, myco-heterotrophic organisms that rely on mycorrhizal fungi for resources may be subject to a unique set of limitations. Specifically, it is unclear if specialization on mycorrhizal associations has resulted in the evolution of generalization in other life history traits, such as reproductive ecology. To assess the complexity and levels of specialization in myco-heterotroph life history traits, a comparative analysis of the reproductive ecology was conducted among three species of two closely related genera, Monotropa and Monotropsis. Three consecutive years of field observations and manipulations were performed on populations of each genus to investigate flowering phenology, pollination ecology, breeding system, and reproductive effort and output. Results from these analyses indicated that color forms within the species Monotropa hypopitys and the congener M. uniflora each exhibited unique reproductive traits including differences in seasonal timing and duration of reproductive development, phenology, specialization on Bombus spp. pollinators, unique herbivore defense adaptations, and breeding systems; many of these differed considerably from Monotropsis odorata. This study is the first thorough investigation of the reproductive ecology of myco-heterotrophic species and offers insight into the implications this life history trait may have for uniform convergence upon a generalist reproductive strategy. 10

21 Introduction Mutualisms and symbioses are some of the most important ecological interactions driving ecosystems but these have been historically understudied. Myco-heterotrophy is an important system of symbiotic interactions that has played a key role in our fundamental understanding of highly specialized ecological interactions and the evolutionary ecology of non-photosynthetic plant biology (Leake 1994; Bidartondo 2005). Defined as plant species that obtain carbon resources from obligate mycorrhizal associates, myco-heterotrophs are a phylogenetically, morphologically, and ecologically diverse group of organisms (Leake 1994) that evolved from photosynthetic ancestors (Wallace 1975; Cullings et al. 1996; Bidartondo 2005). While they are now free from some of the limitations of green plants (e.g., complex vegetative structures and expensive photosynthetic pigmentation [Leake 1994]), this evolutionary shift in the life history of myco-heterotrophs has not come without costs. Consequences of myco-heterotrophy include an obligatory reliance upon mycorrhizal associations for carbon influx (Bijörkman 1960) and specialized habitat requirements for survival and propagation (Luoma 1987; Taylor & Bruns 1999; Leake et al. 2004; Moola & Vassuer 2004) that have contributed to rarity, isolation, and divergence among closely related taxa (Kruckeberg & Rabinowitz 1985; Bidartondo & Bruns 2001; Taylor et al. 2003). Although much is known about mycorrhizal symbioses (e.g., Bidartondo & Bruns 2001, 2002) and the many convergent life history traits shared by mycoheterotrophic taxa (e.g., reduced seed size and endosperm, loss of vegetative structures, primary existence as a subterranean root mass [Wallace 1975; Olson 1993; Leake 1994]), it remains unclear how the inherent constraints of myco-heterotrophy are balanced by freedom from photosynthetic constraints and how both might influence the evolution of the reproductive ecology of these non-photosynthetic plants. 11

22 In a recent review by Bidartondo (2005), it was hypothesized that the limitations of a highly specialized, myco-heterotrophic life history may provide some predictive value to reproductive strategies utilized by these plants. Bidartondo argued that it would be an evolutionarily unstable strategy for a myco-heterotroph engaged in an obligate symbiotic interaction to assume additional compulsory associations, including those related to reproduction. Subsequently, taxa would be likely to possess a reproductive ecology free from further specialization, as evident by traits such as a generalist pollination syndrome and/or autogamous self-pollination. While this theory does highlight the potentially maladaptive strategy of an organism possessing multiple life history constraints, it remains unclear why many closely related myco-heterotrophic species have distinctly different reproductive traits (i.e., flowering phenologies; size and structure of reproductive stems; color, fragrance, and number of flowers). The Monotropoideae (Ericaceae) presents an ideal system for studying the reproductive ecology of myco-heterotrophic taxa in light of the predictions that emerge from Bidartondo s (2005) theory. The Monotropoideae is an entirely nonphotosynthetic subfamily with 9 of 10 genera exhibiting narrow geographic ranges and endemism (Kruckeberg & Rabinowitz 1985), likely correlating with the limited distribution of their specialized mycorrhizal associates (Bidartondo & Bruns 2001). Most genera are morphologically distinct in traits such as color and size of reproductive stems, flower number, floral fragrance, pollen morphology, seed shape, and fruit type (e.g., Copeland 1935, 1937, 1938, 1939; Bakshi 1959; Wallace 1975, 1977; Leake 1994). It is possible that the phenotypic variation observed in these closely related taxa reflects multiple pathways of converging upon the same reproductive strategy in different habitats. Alternatively, it is possible that the trait differences observed for each species may correspond with distinct 12

23 reproductive strategies, the byproduct of specialization in a discrete ecological niche due to endemism and isolation. It was the goal of this study to investigate and compare the reproductive strategies of three closely related myco-heterotrophic species in the Monotropoideae to examine these two alternative scenarios. Specifically, we compared the flowering phenology, pollination ecology, breeding system, and reproductive effort and output of two closely related myco-heterotrophic genera, Monotropa and Monotropsis, to assess possible reproductive limitations inherent to a mycoheterotrophic life history. Based on information in the scientific literature, we developed and tested five different hypotheses. First, taxa should exhibit unique flowering phenologies with distinct fluctuations in seasonal reproductive effort and fecundity, as indicated in numerous anecdotal and published reports (Wolf 1922; Luoma 1987; Wallace 1975, 1977; Leake 1994). Second, some variation in the morphological traits of flowers and reproductive stems between genera may be due to herbivore defense and consequently we expect to observe differential herbivory rates and fitness impacts on members of each genus. Third, members of Monotropa and Monotropsis should be primarily outcross-pollinated like many members of the Ericaceae (e.g., Levri 1998; Hokanson & Hancock 2000; Stout 2007). Fourth, taxa should exhibit high pollinator diversity and abundance consistent with a generalist pollination syndrome, as indicated by Bidartondo s theory. Finally, these taxa likely exhibit breeding systems that ensure seasonal reproductive success such as self-compatibility, autogamy, and geitonogamy. 13

24 Methods Study system Much of the highly influential literature in the field of mycorrhizal biology and mycoheterotrophy has focused on the genus Monotropa (e.g., Björkman 1960; Olson 1990, 1993; Bidartondo & Bruns 2001, 2002; Leake et al. 2004; Bidartondo & Bruns 2005; Bidartondo 2005). Monotropa consists of two species, M. uniflora (Indian Pipe) and M. hypopitys (Pine Sap), which both exhibit a circumboreal distribution (Wallace 1975; Leake 1994). As in other Monotropoid genera, multiple reproductive stems may be produced per plant, each stem containing one to many flowers (Wallace 1975). In this genus, reproductive stems and flowers are not noticeably fragrant but are conspicuously colored, ranging from solitary white flowers (M. uniflora) to yellow or red inflorescences (M. hypopitys). Each species is capable of producing sizable reproductive stems that stand cm tall. Flowers emerge from the ground in a nodding position and upon fertilization, assume an erect orientation (Wallace 1975). Fruits are dry capsules that contain seeds with wing-like integuments for wind dispersal (Olson 1980). Within the species M. hypopitys, there are two distinct color forms, yellow and red, and this variation has caused much confusion among taxonomists. Once classified as separate species, these color forms are currently thought to simply represent natural color variation within the species and have not been assumed to serve any ecological function (Wallace 1975, 1977). Because the red and yellow forms have been observed to exhibit unique flowering phenologies (Neyland 2004), rarely occur in sympatry, and are ecologically understudied, each form was treated as a separate experimental unit and will be referenced as separate taxa in this study. Another closely related taxon exhibiting unique reproductive traits is the monotypic genus, Monotropsis. Monotropsis odorata (Sweet Pine Sap) is a rare endemic of the 14

25 Appalachian Mountains and southeastern United States and is presently listed as threatened or endangered by four states of its limited range (USDA Plant Database 2008). Found almost exclusively growing in upland, mixed Oak-Pine forests (Jones 2005), these plants possess coralline roots, which seasonally produce one to many reproductive stems that stand 5 10 cm tall (Wolf 1922; Copeland 1939). Known for their highly fragrant flowers (similar to baking cloves), these plants are notoriously difficult to visually locate due to their small stature and the seemingly cryptic, brownish bracts and sepals covering the reproductive stems and encircling each flower (Klooster et al., in prep.). Flowers are deep pink to lavender colored, typically with a white tip, and upon fertilization, form indehiscent, fleshy fruits with seeds that are animal dispersed (Wallace 1975; Leake 1994). Site description and sampling Populations of each taxon were identified in Ohio, Indiana, Kentucky, and Tennessee (eastern United States) in 2004 and early 2005 (Table 1). All populations of Monotropa spp. were located in mixed deciduous, old growth forest remnants, and plants were typically observed to grow in close proximity to Fagus grandifolia and Quercus spp. In two populations (Cowan Lake State Park, Highland Co., Ohio and Nature Conservancy Land, Adams Co., Ohio) multiple taxa were observed growing in sympatry, and each taxon was treated independently of all other co-occuring taxa. M. uniflora and M. hypopitys (yellow form) were observed to grow across a broader geographic distribution than populations of the red color form of M. hypopitys, which was rare and only observed to grow in forests on the edge of the Appalachian Mountains in southern Ohio. Monotropsis odorata was also restricted to a southern portion of the Appalachian 15

26 Mountains and primarily occurred in secondary growth, Oak-Virginia Pine (Pinus virginiana) stands. It was not possible to identify individual genets of these myco-heterotrophs without exhuming roots and severing essential mycorrhizal connections. Therefore individual plants of each species were identified as isolated clumps of reproductive stems that were located more than one meter from the next neighboring clump, and were marked with semi-permanent flagging (N plants per population). Consequently, the total number of plants identified in a population using this method is likely an underestimate of the actual population size. Flowering phenology & seasonal reproductive effort Populations were monitored throughout three years ( ) to determine when plants became reproductive and to assess the duration of flowering phenology for each species. Reproductive effort, defined in this study as the average number of reproductive stems produced per plant, was assessed in each population across the three years of study. Reproductive stems were used as a measure of reproductive effort instead of flower number to standardize this measurement across taxa because each species typically produces a variable number of flowers per stem, with the exception of M. uniflora. All stem data for each population were log transformed for normality. Repeated measures ANOVAs were conducted across seasons for each taxon to test the null hypothesis that plants exhibit no difference in reproductive effort, using population and season as independent variables and numbers of stems produced per plant as the dependent variable. The red color form of M. hypopitys was excluded from this analysis due to the lack of multiple populations for comparison. Because there was a significant drought during the summer and fall of 2007, season was treated as a fixed factor. 16

27 Seasonal fecundity & herbivory Seasonal fecundity was analyzed to determine the potential reproductive capacity of populations of each species. To assess fecundity, reproductive stems from a subset of flagged plants (n= plants; 1-8 stems per plant) in each population were randomly selected prior to anthesis and flower numbers were recorded. At the end of the blooming period, these stems were collected and their flowers and fruits were analyzed with a dissecting microscope to place them in one of three categories (mature, aborted, herbivory). Ratios were then calculated from this data by dividing the number of flowers or fruits in each category by the total number of flowers per stem. Data from all stems of a given plant were then averaged to yield mean mature, aborted, and herbivory ratios, and these were used in further population and species level analyses. Plant ratios were used as a means of standardizing data due to strong variation in flower number produced per plant across the different taxa. Because it was not possible to accurately count or germinate the dust-like seeds, or rear offspring in a controlled setting, mean mature fruit ratios per plant were used as a measure of the reproductive output of each population across field seasons. Mature fruit ratios and herbivory ratios were arcsin-square root transformed to enhance normality prior to analysis. A three-way nested ANOVA was used to determine significant differences in the reproductive output of taxa, with taxon, year, and population nested within taxon as independent variables and mature fruit ratios as the dependent variable. An additional three-way nested ANOVA was performed using ratios of only flowers and fruits that suffered from herbivory as the dependent variable to determine if there were significant differences in herbivory rates of taxa and populations nested within taxa across all years of study. All factors in these statistical models were treated as fixed due to the non-random event of a drought in Least-squares means were used for post hoc 17

28 comparisons of species level effects on differences in mature fruit ratios and herbivory ratios. Finally, herbivory data were combined across populations and further classified under one of the following four categories to determine which herbivory type most commonly affected each taxon: floral herbivory (consumption of flower sex parts), stem herbivory (consumption of part of the stem or severing the stem from its roots), nectar robbing (small chew holes at the base of petals, adjacent to nectaries), seed predation (burrowing into a fruit to consume developing or mature seeds). The herbivory category of seed predation was not applied to fruits of Monotropsis odorata because it was not possible to accurately separate fruits attacked by seed herbivores from those consumed by animal seed-dispersal agents. Pollinator diversity & visitation rates Preliminary research performed in the summer and fall of 2004 showed nectar production was highest in the late morning and early afternoon, indicating that pollinators may likely visit during the day (M. Klooster, unpubl. data). Additionally, observations conducted by Wallace (1977) on a number of Monotropoid genera revealed that Bombus spp. may play significant roles as floral visitors. Subsequently, pollinator observations were conducted within the largest population of each taxon between the daylight hours of 9:00am and 7:00pm EST. Pollinator activity was monitored for each taxon over two consecutive years (30 hrs per year per taxon) from with the exception of the yellow color form of M. hypopitys, which was examined in 2007 only. Pollinators were defined as pollen dispersal agents that contacted stamens and pistils, whereas floral visitors failed to make contact with male and/or female sex parts. At peak bloom in a given year, pollinator observations were videotaped each day for three consecutive days (10 hrs per day) and were reviewed at a later time to determine the average 18

29 number of flowers, stems, and plants visited during each complete pollinator foraging event. Additionally, the total duration of each complete pollination event and the average time spent by each pollinator visiting each plant was also determined from video obtained during the field season. Complete foraging events were defined as activity of a given pollinator that was observed from beginning to end throughout an entire population. Any visitation event that was not observed and recorded in its entirety was excluded from further analyses. Because pollinator observations for the yellow color form of Monotropa hypopitys were conducted over a single season and few complete visitation events were observed, video recordings of pollination in this taxon were excluded from detailed analyses. Voucher specimens of pollinators and floral visitors were collected during observations to visually assess pollen load; insects were identified to family or genus when possible. These voucher specimens were used in conjunction with video footage to determine which floral visitors were primary pollen dispersal agents (i.e. pollinators) and to ascertain if non-pollinating floral visitors forage for pollen and nectar in this system. Furthermore, pollinator foraging behavior was observed both in the field and by video to reinforce and better resolve various components of the breeding system (i.e. geitonogamy, self-compatibility, obligate outcross fertilization, and buzz-pollination). Breeding system Self-compatibility and autogamy (including prior- and delayed-selfing mechanisms) were examined in these taxa as well as their reliance upon floral visitors for successful reproduction using approximately nylon pollinator exclusion tents constructed in the largest population of each taxon. These tents were placed over newly emerged reproductive stems of randomly selected individual plants (n 4 stems/tent) prior to anthesis. Tents were constructed using very 19

30 fine mesh and in such a way as to exclude flying and crawling insects while allowing proper light, moisture, and airflow to the plants. Flowers on two stems within each tent were selfpollinated by hand to determine self-compatibility. All remaining flowers on the other stems within each tent were left unmanipulated to test for autogamy (including prior- or delayedselfing). Due to population size constraints of each species, it was not possible to balance this experimental design with an outcross-pollinated, untented treatment that, when compared to a control group, would be useful in measuring pollinator limitation (Kearns & Inouye 1993). All tented treatments were performed across multiple populations or seasons and data were pooled, with the exception of a single seasonal treatment for the yellow form of M. hypopitys. At the end of flowering, senesced reproductive stems containing the intact fruits and flowers in each tented treatment were harvested. Differences in viable seed set between selfcompatibility and autogamy treatment groups were determined by studying fruits under a dissecting microscope and observing seed development. Flowers were placed in one of two categories: mature fruit or aborted fruit/ovary. Relative self-compatibility and autogamy were then determined based on the presence or absence of mature fruits in each treatment group. To determine if herkogamy (spatial separation of male and female sexual parts) exists in these taxa, samples of 30 reproductive stems at anthesis were randomly selected from the largest population of each taxon. Flowers on each stem were dissected and the relative position of anthers to the receptive stigmatic region was assessed under a dissecting scope at 2 4 x magnification, with distinct physical separation classified as herkogamy. A population was determined to exhibit a mixed breeding system if floral morphs varied in the separation of anthers and stigmas, and if this trait resulted in self-pollination and production of mature fruits in the autogamy tented treatment. Additionally, observations of pre- and post-anthesis flowers 20

31 were used to determine if temporal separation in the reproductive maturation of stamens and pistils (dichogamy) exists in this system. Results Flowering phenology & seasonal reproductive effort Each taxon exhibited unique seasonal timing and duration of reproductive phenology (Fig. 1). Additionally, each population of plants showed high fidelity for the timing of reproductive phenology among years with no population varying in the timing of anthesis beyond 7 10 days across all three seasons. Monotropsis odorata took the longest time (32-34 weeks) for reproductive stems to develop, floral receptivity to subside, and fruits to mature. Taxa in the genus Monotropa exhibited substantially shorter flowering periods than Monotropsis. Monotropa uniflora had the most variable reproductive phenology across populations ranging from late June (i.e., BCI population) into early October (i.e., LP and WC populations). This variation in M. uniflora phenology among populations was not directly attributable to a latitudinal gradient, geographic distance, or habitat type. The red and yellow color forms of M. hypopitys exhibited distinctly different timing in their seasonal reproductive phenologies with the five populations of the yellow form consistently reproducing during mid-summer (from July 11 August 14), whereas populations of the red color form were strictly fall blooming (September 15 October 5). Seasonal reproductive effort was highly variable for all taxa in the three consecutive years of observations. According to the repeated measures ANOVAs used to compare reproductive effort, there was a significant interaction of year and population (P < 0.001) in each taxon with the exception of Monotropsis odorata, which showed no significant interaction (P = 21

32 0.64; Table 2). Additionally, populations of each taxon significantly differed in reproductive effort across seasons (P < ), reflecting inconsistent production of reproductive stems by individuals within populations. A small percentage of plants across populations reproduced consistently in all years (ranging from 8 20%), with an average of 87% of plants exhibiting at least one season of dormancy in the three years. Additionally, there was no clear synchronicity in the timing of reproductive years or dormancy among individual plants within populations. A few individuals in each population exhibited substantially higher reproductive effort (>50 stems per plant) in a given year than other individuals, although these reproductive bursts were often preceded and followed by seasons of dormancy or minimal reproductive effort. Pollinator diversity & visitation rates Over 210 hours of observations across three field seasons implicated only a few insect taxa as floral visitors of Monotropsis and Monotropa. Monotropsis odorata attracted the greatest abundance and diversity of floral visitors across both seasons, with minimal diversity observed in Monotropa spp. (Fig. 2). Most insect floral visitors consumed nectar from flowers with a few insects possibly functioning as minor pollen vectors due to infrequent contact with plant sex parts (i.e., Aprocrita, Erynnis spp., Epargyreus clarus, Halictidae, Vespidae). Those floral visitors with short mouthparts (i.e., Tachinidae and Syrphidae) were often observed foraging on the sugary exudates excreted from the stigma and did not function as nectar robbers or pollinators. Bumblebees (Bombus spp.) were the most abundant floral visitors across all years of observations, harvesting both pollen and nectar. Additionally, Bombus spp. were the primary pollen dispersal agents across all years in populations of Monotropa and Monotropsis, 22

33 demonstrating relatively high fidelity while foraging on flowers of each species (Table 3). Monotropa hypopitys (yellow form) received the fewest number of observed pollinator visitations with only six in 2007, and Monotropsis odorata elicited the highest frequency of pollinator visitations each year with 154 and 77 in 2005 and 2006, respectively. Video footage and field observations revealed that buzz pollination played a substantial role in all pollination events for Monotropsis and was observed less frequently in Monotropa. Additionally, Bombus spp. were observed to commonly visit on average 2 flowers per stem and 2-4 stems per plant, supporting the likelihood of geitonogamous pollination in self-compatible taxa. M. uniflora elicited the overall shortest duration (median of 2:07 min and 2:34 min in 2005 and 2006 respectively) of pollinator visitations by Bombus spp. which visited the fewest stems and plants per complete visitation. Alternatively, Bombus spp. spent the longest duration of time (median of 4:18 min and 4:08 min in 2005 and 2006 respectively) foraging on Monotropa hypopitys (red form) and on average, visited the most flowers, stems, and plants of this taxon. Seasonal fecundity & herbivory Seasonal fecundity was highly variable across populations of each taxon and years of study (Fig. 3). A three-way nested ANOVA was initially used to quantify differences in the reproductive output among populations and taxa across the three years of study. Results from this model demonstrated a significant interaction of taxon and year (P < ), with significant differences in the overall reproductive output among taxa (P = 0.014) and across years (P < 0.031, Table 4). Additionally, populations nested within species differed significantly in reproductive output (P < ), and these results are consistent with broad fluctuations in seasonal fecundity among individuals within populations. Post hoc comparisons revealed that 23

34 Monotropa uniflora had significantly lower mature fruit ratios per plant than either M. hypopitys (yellow form; P = ) or Monotropsis odorata (P = 0.046), with all other comparisons among taxa yielding non-significant differences. Monotropsis odorata exhibited the highest and most consistent overall reproductive effort and relative fruit set between populations across all three years of study. The BC population of the red color form of Monotropa hypopitys showed the largest overall decrease in relative fruit set across years, from 45% in 2005 and 56% in 2006 to 0% in Overall, 2005 was the most fecund season for all taxa, in which fecundity either remained consistent or steadily declined in the subsequent two years. A drought in the summer and fall of 2007 likely contributed to the overall decline in reproductive effort and output of the seasonally later blooming taxa, with the fall-blooming LP population of M. uniflora and the BC population of M. hypopitys (red form) exhibiting a substantial decline in reproductive effort and 0% reproductive output for that year. This and other ecological factors contributed to rates of floral abortion that varied strongly among taxa and across seasons, ranging from 29% and 13% in 2005 for the LP and BC populations of M. uniflora and M. hypopitys (red form) respectively, to 100% floral abortion in 2007 for these same populations. Herbivory rates and the type of herbivory also differed between Monotropsis and Monotropa. Herbivory rates significantly differing across taxa (P = ) and among populations nested within taxa (P < ; Table 4). However, there was no significant effect of year on herbivory rates (P = 0.11), although there was a significant interaction of taxon and year (P < ). Post hoc comparisons demonstrated that plants of Monotropa uniflora exhibited significantly higher ratios of flower and fruit loss to herbivory than all other taxa (P < 0.01), with no significant differences detected among the other multi-flowered taxa (P > 0.05). Monotropsis odorata plants suffered the lowest ratio of flower loss to herbivory with an average 24

35 of 10.8% per year. Additionally, the reproductive stems and flowers of M. odorata predominantly suffered from predation of viable floral and stem tissue (63% and 36% of total herbivory, respectively), whereas the reproductive stems and flowers of Monotropa taxa were more likely to suffer from seed predation once flowers were fertilized (Table 5). All forms of herbivory for Monotropsis odorata peaked in frequency in early spring with 55 85% of damage occurring prior to reproductive maturity, and an average of 23% of herbivory observed after anthesis. In contrast, approximately 9-16% stem herbivory and 7-20% floral herbivory was observed while Monotropa taxa were developing or reproductively active. However, once viable tissue began to dry and seed development was near completion, stem-boring lepidopteran larvae consumed seed within mature fruits, accounting for 71-81% of the total herbivory observed in Monotropa. Breeding system Tented treatments, designed to exclude insect floral visitors and pollinators, revealed striking differences in levels of self-compatibility and autogamy among taxa of Monotropsis and Monotropa (Table 6). Plants in both populations of Monotropsis odorata showed negligible selfcompatibility with approximately 1% fruit set in self-pollinated treatments and were not autogamous (0% fruit set), while Monotropa spp. showed moderate to high levels of selfcompatibility ranging from 20% in M. uniflora to 72% in M. hypopitys (yellow form). Monotropa spp. differed substantially in levels of autogamous self-pollination with tented, unmanipulated stems of M. uniflora and M. hypopitys (red form) showing < 11% fruit set and plants of the yellow color form of M. hypopitys producing approximately 68% autogamous fruits. 25

36 The morphology of flowers collected from the largest population of each taxon exhibited approach herkogamy with orientation of the stigma above the level of the anthers, with the notable exception of the yellow color form of M. hypopitys (Fig. 4). The flowers sampled from the SL population of this taxon exhibited a mixed breeding system with one or both whorls of anthers in direct contact with the receptive stigmatic region in 91% of flowers sampled at reproductive maturity, and the remaining 9% of flowers exhibited approach herkogamy. Additionally, there was no clear evidence for dichogamy in Monotropsis or Monotropa, as there was no discernible temporal separation in pistil and stamen maturation. Discussion Previous studies of phylogenetically diverse taxa have proposed that convergence on a myco-heterotrophic life history and reliance upon highly specialized symbiotic associations has resulted in further convergence upon traits such as loss of complex vegetative structures, existence primarily as a subterranean root mass, and reduction in seed size and endosperm (e.g., Wallace 1975; Olson 1993; Leake 1994). Subsequently, it was hypothesized by Bidartondo (2005) that these organisms may possess other life history traits free from additional obligatory associations, such as a generalist pollination syndrome and autogamous self-pollination. Results from the current comparative analysis revealed that no taxon strictly conformed to these tenets. A number of ecological factors functioned in concert to impact the reproductive ecology of these taxa, resulting in varying degrees of specialization among taxa. Specifically, the interactions of pollination ecology, herbivory, mycorrhizal associations, and the environment have imposed unique selective pressures upon each taxon resulting in the evolution of complex reproductive 26

37 traits and strategies that are not inherently predetermined by a myco-heterotrophic life history alone. Taxa of Monotropa and Monotropsis exhibited distinctly different timing and duration of various stages of reproductive development and phenology, supporting our first hypothesis and previous observations (Wallace 1975, 1977; Leake 1994). Specifically, reproductive development and phenology of Monotropsis lasted up to 36 weeks, which was nearly four times the duration of Monotropa spp. Additionally, each population of Monotropa uniflora differed in the timing of flowering phenology, ranging from early summer to late fall, whereas populations of all other taxa consistently reproduced within a discrete season. Interestingly, the two color forms of M. hypopitys exhibited different blooming periods, supporting temporal reproductive isolation in these taxa. Even when both color forms occurred in sympatry (as was the case for the BC and BCY populations), flowering phenologies were separated by 6 8 weeks, which may have implications for genetic divergence and possibly speciation in these morphs. This is currently being examined with molecular markers in a related study. Because these myco-heterotrophs were reported to reproduce unreliably across seasons with unique reproductive phenologies, we expected taxa to be generalist-pollinated by a locally abundant and diverse group of insects (Waser et al. 1996). However, Bombus spp. appeared to function as the most reliable floral visitors and were the primary pollen dispersal agents for these taxa, indicating that Monotropa and Monotropsis exhibit low pollinator diversity, failing to support our fourth hypothesis. The low pollinator diversity observed in this system is indicative of specialization on Bombus spp., which exhibit a generalist preference for many plant taxa and are abundant and reliable pollinators in the endemic ranges of these myco-heterotrophs. Although taxa shared a common pollinator, it was observed that Bombus behavior differed while 27

38 foraging on flowers of Monotropa and Monotropsis, likely resulting from differences in anther morphology. Monotropa produces anthers that dehisce along a slit, spilling pollen onto the inner walls of the corolla, which results in pollen collecting on the head and thorax of Bombus spp. as they probe flowers for nectar. In Monotropsis, each anther possesses two pores that dehisce but do not readily release pollen from the anther sac. Instead, Bombus spp. induce the release of pollen from anther sacs through high frequency buzzing upon probing each flower (Hermann & Palser 2000). Despite the higher number and frequency of insect taxa observed visiting flowers of M. odorata, it appears that Bombus spp. are the primary pollen dispersal agents because buzz pollination is necessary for pollen release. Additionally, the number and duration of pollinator visitations varied among Monotropa spp., which may be suggestive of differential preferences by Bombus spp. for particular taxa. The high frequency and abundance of Bombus visitations, as well as the production of copious nectar and pollen, suggests reliance by taxa upon pollinators for successful fertilization. Tented treatments further demonstrated this dependency because low to negligible autogamous self-pollination was detected in most taxa, which failed to support our hypothesis that autogamy would be favored in this system. Monotropsis odorata was determined to be self-incompatible which stood in stark contrast to the highly self-compatible and autogamously self-pollinating yellow form of Monotropa hypopitys. M. uniflora exhibited low self-compatibility and negligible autogamy, whereas the red color form of M. hypopitys exhibited a high level of selfcompatibility similar to that of the yellow color form of M. hypopitys but had low autogamous fruit set. Additionally, nearly all taxa exhibited approach herkogamy, consistent with outcrosspollinated and animal-pollinated species (Barrett 2003). Although the vast majority of flowers sampled for the yellow color form of M. hypopitys showed no spatial separation between anthers 28

39 and stigmas, it was unclear to what degree and in what proportions this breeding system persisted in other populations. Results indicate that these taxa exhibit unique breeding systems and most taxa show a distinct reliance upon pollinators for successful pollen dispersal and fertilization. Therefore, pollinator abundance and fidelity are vital for successful reproduction in all taxa but substantially less so for the autogamous, yellow color form of Monotropa hypopitys. Another factor strongly influencing the reproductive ecology of these myco-heterotrophs was herbivory, which significantly differed among taxa and populations, with a significant interaction of taxon and year. Additionally, the type of herbivory differed between Monotropa and Monotropsis, likely indicating that different guilds of animal herbivores target members of each genus. These results support our hypothesis that herbivory consistently plays a role in reducing the reproductive output of plants across years, possibly owing to specialization by herbivores in the unique ranges of endemism. Results also suggest that some distinctive plant defense strategies may have evolved across taxa. For instance, taxa within the genus Monotropa produce large reproductive stems that exhibit conspicuous coloration ranging from white to yellow and red, yet reproductive stems and floral tissue of these taxa exhibit a relatively lower proportion of herbivory, possibly owing to the production of systemic herbivore defense compounds (Kunze 1878; Orton 1922) and aposematic coloration (Rubino & McCarthy 2004). In contrast, the small reproductive stems and flowers of Monotropsis odorata are covered with brown scarious bracts that cover colorful petal and stem tissue, camouflaging the plants against a natural leaf litter substrate. When the bracts are removed and the colorful floral and stem tissue of M. odorata becomes exposed, flowers and stems are significantly more likely to suffer from herbivory than when they remain concealed by bracts (M. Klooster, unpublished data), supporting the evolution of cryptic mimicry (Wiens 1978) as a defense adaptation against 29

40 herbivory in this species. Overall, the selective pressures imposed by floral, stem, and seed herbivores in each taxon have likely played a substantial role in the evolution of defense adaptations, which may account for some fundamental trait differences observed among genera (i.e., floral fragrance, coloration, size, and morphology). The variation in reproductive effort and seasonal fecundity observed in most of these taxa may also be attributable to the interaction of a number of factors, including pollinator behavior, breeding systems, and the environment. Although Bombus spp. did show relatively high fidelity when foraging on flowers of these taxa, the frequency of visitations uniformly declined from 2005 to 2006, possibly reflecting seasonal fluctuations in the number of reproductive plants and variation in the reproductive effort of those plants that reproduced. Additionally, it is unclear if pollinator limitation exists in this system and to what degree, possibly reducing pollen dissemination and subsequent fertilization in years of low pollinator abundance. Differences in plant morphological traits and breeding systems also appear to elicit differential visitation rates by Bombus spp. For instance, the small, highly fragrant, and self-incompatible Monotropsis odorata attracted the highest frequency of Bombus visitations across both years of observations, whereas the robust, conspicuously colored, autogamous yellow color form of Monotropa hypopitys attracted the fewest pollinator visitations in a given year. Furthermore, the production of numerous reproductive stems per plant and pollinator foraging behavior favored geitonogamous self-pollination, which could be a potential waste of nectar and pollen resources for self-incompatible taxa and may potentially promote inbreeding and reduce plant fitness in the self-compatible, Monotropa. Finally, seasonal fluctuations in moisture and temperature appeared to play a substantial role in both reproductive effort and output. In the summer and late fall of 2007, a drought struck the eastern half of the United States. Associated with the lack of 30

41 precipitation came a notable decline in the reproductive effort of plants observed within the majority of summer and fall blooming populations of Monotropa uniflora and M. hypopitys (both color forms). This overall reduction in reproductive stem and flower production was accompanied by increased floral abortion and a substantial decrease in seasonal fecundity with some populations of Monotropa spp. failing to produce any mature fruits. Although specific correlations between particular environmental factors and plant reproduction were not examined here, the change in levels of precipitation across years, from , and the observed decline in reproductive effort and output indicates that these myco-heterotrophic taxa are sensitive to environmental fluctuations. Finally, because myco-heterotrophs rely solely upon mycorrhizal associates for water and nutrients, and indirectly upon autotrophic plants for carbohydrates, it can be assumed that this dependency upon other organisms as part of a web of ecological associations may potentially limit resource availability, affecting the growth and yearly reproductive effort of mycoheterotrophs (Bidartondo 2005; Selosse et al. 2006). Consequently, it is possible that slow or inconsistent mycorrhizal resource contributions may explain differences in the resource pool and thus the duration of reproductive stem development and flowering phenologies. Furthermore, temporal variation in the reproductive effort of plants of a given taxon (such as in populations of Monotropa uniflora or the color forms of Monotropa hypopitys) may result from association with unique mycorrhizal taxa at the population level and could lead to speciation (Taylor & Bruns 1999; Bidartondo & Bruns 2002; Taylor et al. 2003). Plants in which successful fertilization takes place must further rely upon this web of interactions for resources necessary for seed and fruit production. Fluctuations in or early termination of resource flow may result in the random or selective abortion of some fruits and seeds so that others can develop (e.g. 31

42 Marshall & Ellstrand 1988; Martin & Lee 1993; Burd 1998), possibly explaining at least some of the variation in reproductive output observed across taxa. Further research concerning the provisioning of resources by mycorrhizal associates may provide insight into differences in the relative productivity of myco-heterotrophs and the reproductive timing of populations. Conclusion This pioneering study functions as the first thorough investigation and comparative analysis of myco-heterotroph reproductive strategies. Results from this study support the principal hypothesis that varying degrees of specialization in reproductive ecology can evolve among closely related myco-heterotrophic taxa. As our understanding of the ecology of nonphotosynthetic plants grows, we may see that specialization on a symbiotic interaction in one life history trait, such as mycorrhizal associations, may not exclude the possibility of specialization in other traits, such as reproduction. Alternatively, in conjunction with more functional data on various components of myco-heterotroph ecology, future studies may reveal further underlying constraints promoting the evolution of more generalist traits across diverse phylogentic lineages. Results from this study show that myco-heterotrophic plants have evolved a variety of reproductive strategies (e.g., differences in seasonal timing and duration of reproductive development and phenology, specialization on Bombus spp. pollinators, unique herbivore defense adaptations, breeding systems) for dealing with a concert of intrinsic and extrinsic ecological factors to ensure successful propagation. Although there were marked similarities among all taxa and dissimilarities especially between genera, it can be concluded that a mycoheterotrophic life history does not alone dictate the uniform convergance of taxa upon a generalist reproductive biology or shared reproductive traits. 32

43 Acknowledgements We extend special thanks to M. Becus, D. Boone, E. Buschbeck, J. Burger, B. and G. Culbertson, D. Conover, J. Decker, M. Dodson, S. Dunford, S. Lockwood, E. Maurer, R. Olson, M. Pistrang, V. Soukup, D. Taylor for providing support and resources necessary to locate populations and conduct these analyses. M. Bidartondo offered critical advice on this manuscript. Additional thanks to Cherokee National Forest, Daniel Boone National Forest, Germantown MetroPark, The Nature Conservancy, Ohio Department of Natural Resources, the Culberson Family, and the Lockwood Family for granting permission to study these species and providing access to populations. Funding used to conduct this research was made possible through the University Research Council Fellowship and the Weiman, Wendel, Benedict Award offered by the University of Cincinnati. References Bakshi, T.S Ecology and Morphology of Pterospora andromedea. Botanical Gazette 120: Barrett, S.C.H Mating strategies in flowering plants: the outcrossing-selfing paradigm and beyond. Philosophical Transactions: Biological Sciences 358: Bidartondo, M.I The evolutionary ecology of myco-heterotrophy. New Phytol. 167: Bidartondo, M.I. and Bruns, T.D Extreme specificity in epiparasitic Monotropoideae (Ericaceae): widespread phylogenetic and geographical structure. Molecular Ecology 10:

44 Bidartondo, M.I. and Bruns, T.D Fine-level specificity in the Monotropoideae (Ericaceae): specificity for fungal species groups. Molecular Ecology 11(3): Bidartondo, M.I. and Bruns, T.D On the origins of extreme mycorrhizal specificity in the Monotropoideae (Ericaceae): performance trade-offs during seed germination and seedling development. Molecular Ecology 14: Bijörkman, E Monotropa hypopitys L. an epiparasite on tree roots. Physiologia Plantarum 13: Burd, M Excess flower production and selective fruit abortion: a model of potential benefits. Ecology 79: Copeland, H.F On the genus Pityopus. Madroño 3: Copeland, H.F The reproductive structures of Pleuricospora. Madroño 4: Copeland, H.F The structure of Allotropa. Madroño 4: Copeland, H.F The structure of Monotropsis and the classification of the Monotropoideae. Madroño 5: Cullings, K.W., Szaro, T.M., and Bruns, T.D Evolution of extreme specialization within a lineage of ectomycorrhizal epiparasites. Nature 379: Herman, P.M. and Palser, B.F Stamen development in the Ericaceae. I. anther wall, microsporogenesis, inversion, and appendages. Amer. J. Bot, 87: Hokanson, K. and Hancock, J Early-acting inbreeding depression in three species of Vaccinium (Ericaceae). Sexual Plant Reproduction 13: Jones, R.L Plant Life of Kentucky: An illustrated guide to the vascular flora. University of Kentucky Press, Lexington, KY p

45 Kearns, C.A., and Inouye D Techniques for Pollination Biologists. The University Press of Colorado. pp Kruckeberg, A.R. and D. Rabinowitz Biological aspects of endemism in higher plants. Annual Review of Ecology and Systematics 16: Kunze, R.E Monotropa uniflora, L. Botanical Gazette 3: Leake, J.R The biology of myco-heterotrophic ( saprophytic ) plants. New Phytol. 127: Leake, J.R., McKendrick, S.L., Bidartondo, M., and Read, D.J Symbiotic germination and development of the myco-heterotroph Monotropa hypopitys in nature and its requirement for locally distributed Tricholoma spp. New Phytol. 163(2): Levri, M.A The effect of timing of pollination on the mating system and fitness of Kalmia latifolia (Ericaceae). American Journal of Botany 85: Luoma, D.L Synecology of the Monotropoideae within Limpy Rock Research Natural Area, Umpqua National Forest, Oregon. M.S. Thesis. Oregon State University. Marshall, D.L and Ellstrand, N.C Effective mate choice in wild radish: evidence for selective seed abortion and its mechanisms. The American Naturalist 131: Martin, M.E. and Lee, T.D Self pollination and resource availability affect ovule abortion in Cassia fasciculata (Caesalpiniaceae). Oecologia 94: Moola, F.M., and Vassuer, L Recovery of late-seral vascular plants in a chronosequence of post-clearcut forest stands in coastal Nova Scotia, Canada. Plant Ecology 172:

46 Neyland, R The systematic significance of color variation in Monotropa hypopithys (Ericaceae) inferred from large ribosomal subunit (26S) rrna gene sequences. Madroño 51: Olson, R.A Seed morphology of Monotropa uniflora L. (Ericaceae). Amer. J. Bot. 67: Olson, R.A Observations on the floral shoots of Monotropa hypopitys (Monotropaceae). Rhodora 92: Olson, R.A Patterns of embryo formation in Monotropa hypopitys (Monotropaceae) from North America and Western Sweden. Amer. J. Bot. 80(7): Orton, C.R Observations on the presence of the anti-neuritic substance, water-soluble B, in chlorophyll-free plants. The Journal of Biological Chemistry 53: 1-6. Rubino, D.L. and McCarthy, B.C Presence of aposmaic (warning) coloration in vascular plants of southeastern Ohio. Journal of the Torrey Botanical Society 131: Selosse, M.A., Richard, F., He, X., and Simard, S.W Mycorrhizal networks: des liaisons dangereuses? Trends Ecol. Evol. 21: Stout, J.C Reproductive biology of the invasive exotic shrub, Rhododendron ponticum L. (Ericaceae). Botanical Journal of the Linnean Society 155: Taylor, D.L. and Bruns, T.D Population, habitat and genetic correlates of mycorrhizal specialization in the cheating orchids Corallorhiza maculate and C. mertensiana. Molecular Ecology 8(10): Taylor, D.L., Bruns, T.D., Szaro, T.M., and Hodges, S.A Divergence in mycorrhizal specialization within Hexalectris spicata (Orchidaceae), a nonphotosynthetic desert orchid. American Journal of Botany 90:

47 USDA Plant Profile Database, March Wallace, G.D Studies of the Monotropoideae (Ericaceae): Taxonomy and distribution. The Wasmann Journal of Biology 33: Wallace, G.D Studies of the Monotropoideae (Ericaceae). Floral nectaries: anatomy and function in pollination ecology. Amer. J. Bot. 64: Waser, N.M., Chittka, L., Price, M.V., Williams, N.M., and Ollerton J Generalization in pollination systems, and why it matters. Ecology 77: Wiens, D Mimicry in plants. Evol. Biol. 11: Wolf, W Notes on Alabama plants. A new Monotropoid plant. American Midland Naturalist. 8:

48 Figure Legends Figure 1. Reproductive phenologies of multiple populations of four myco-heterotophic taxa monitored from Reproductive phenologies for each population represent the mean duration and seasonal timing of flowering observed for the three-year period. Lines to the left of the boxes represent reproductive stem and floral development from initial emergence to reproductive maturity. Boxes represent reproductive maturity from anthesis to fertilization and lines extending to the right of boxes represent the duration of fruit and seed development from fertilization to fruit set. Figure 2. The proportion of total floral visitations by insect taxa on flowers of four mycoheterotrophic taxa. Each diagram represents 30 hours of independent observations conducted at peak bloom in the largest population of each taxon from The total number of visitations performed by each floral visitor in a given year is indicated next to the insect identification in the figure legend. Figure 3. Mean frequency of flowers produced by plants in populations of four mycoheterotrophic taxa surveyed from Each bar represents the average number of flowers produced by plants in the respective population in each year of study. Regions of each bar shaded in grey represent the proportion of flowers produced that successfully developed into mature fruits. Panels pertaining to each taxon are as follows: A. Monotropa uniflora, B. Monotropa hypopitys (yellow form), C. Monotropsis odorata, D. Monotropa hypopitys (red form). 38

49 Figure 4. The floral morphology of four myco-heterotrophic taxa. Thirty stems were sampled from individual plants of the largest population of each taxa and were assessed for relative anther to stigma position. Monotropsis odorata (A), Monotropa uniflora (B) consistently displayed approach herkogamy, while Monotropa hypopitys (yellow form) (C) exhibited a mixed breeding system (>90% of flowers showed no anther to stigma separation; pictured here), and Monotropa hypopitys (red form) (D) displayed approach herkogamy. 39

50 Tables Table 1. Site locations of taxa used to conduct this study. Included are site identifications (site ID) used when referencing individual populations in the text, the approximate population sizes (N), and GPS coordinates for each location. Taxon Study Site Location County, State Daniel Boone National Forest Monotropsis Powell Co., KY odorata Cherokee National Forest Monroe Co., TN Nature Conservancy Land Adams Co., OH Cowan Lake State Park Monotropa Highland Co., OH uniflora Lockwood Property (Private) Hamilton Co., OH Wood Creek (Private) Hamilton Co., OH* Germantown Metropark Montgomery Co., OH Cowan Lake State Park Highland Co., OH Monotropa Flat Woods (Private) hypopitys Jefferson Co., IN (yellow form) Stonelick State Park Clermont Co., OH Nature Conservancy Land Adams Co., OH* Nature Conservancy Land Monotropa Adams Co., OH hypopitys Shawnee State Forest (red form) Scioto Co., OH* *Used for reproductive phenology study only Site ID N Location PT ~30 CNF 233 BCI >225 CLI 24 LP 17 WC ~19 GM 41 CL 60 FW 65 SL >250 BCY ~12 BC 211 SSF ~15 37º48.469N 83º39.150W 35º19.778N 84º16.975W 38º48.005N 83º24.082W 39º22.899N 83º54.658W 39º13.920N 84º39.950W 39º12.353N 83º15.365W 39º38.444N 84º25.135W 37º22.899N 83º54.658W 38º50.221N 85º26.388W 39º12.451N 84º04.234W 38º48.005N 83º24.082W 38º48.005N 83º24.082W 38º41.876N 83º10.250W 40

51 Table 2. Results of repeated measures ANOVAs for the reproductive effort of multiple populations of three myco-heterotrophic taxa surveyed over three consecutive years. Taxon Sources df MS F P Year < Monotropsis odorata Year*Population Error(Year) Year < Monotropa uniflora Year*Population Error(Year) Year < Monotropa hypopitys Year*Population (yellow form) Error(Year)

52 Table 3. The visitation duration and fidelity of Bombus spp. pollinators, foraging in the largest population of three myco-heterotrophic taxa. Sixty hours of observations were conducted per taxon in 2005 and Data collected from complete visitation events include median and range of duration of all visitation events as well as the average number of flowers, reproductive stems, and plants visited by Bombus pollinators during each foraging bout. Taxon Year Median visitation duration (range) Avg. # of flowers Avg. # of stems Avg. # of plants Monotropsis odorata :32 (1:11-20:04) :13 (1:11-16:37) Monotropa uniflora :07 (0:31-8:36) :34 (1:06-11:45) Monotropa hypopitys :18 (1:20-10:32) (red form) :08 (1:04-27:30)

53 Table 4. Results of 3-Way nested ANOVAs for reproductive output and ratios of floral and fruit herbivory of four myco-heterotrophic taxa across three years of study. Reproductive output Floral and fruit herbivory Sources df MS F P df MS F P Taxon Year Population(Taxon) < < Taxon*Year < <

54 Table 5. The relative proportion of flowers and fruits damaged by various types of herbivory of four myco-heterotrophic taxa. Included are the number (N) of predated flowers and fruits and the proportion of flowers and fruits in the following herbivory types: floral herbivory (FH), stem herbivory (SH), nectar robbing (NR), seed predation (SP). Seed predation was not measured in Monotropsis odorata because it was not possible to differentiate between fruits predated by herbivores and those consumed by seed dispersal agents. Taxon N FH SH NR SP Monotropsis odorata Monotropa uniflora Monotrops hypopitys (yellow form) Monotropa hypopitys (red form)

55 Table 6. Results from breeding system experiments using pollinator exclusion tents to determine percentages of fruit set in self-compatibility and autogamy treatment groups for four myco-heterotrophic taxa. Plants examined in this study (N) possessed at least two stems per treatment group. Flowers on stems in the self-compatibility treatment were self-pollinated by hand, whereas stems in the autogamy group were left tented but unmanipulated. Taxon N % Autogamy N % Self-compatibility Monotropsis odorata Monotropa uniflora Monotropa hypopitys (yellow form) Monotropa hypopitys (red form)

56 Figure 1 46

57 Figure Monotropsis odorata Bombus spp.(154) Solitary Wasp (Apriocrita)(31) Erynnis spp.(17) Tachinid Fly (Tachinidae)(8) Epargyreus clarus(1) Bombus spp.(77) Solitary Wasp (Apriocrita)(12) Erynnis spp.(12) Monotropa uniflora Bombus spp.(91) Syrphid Fly (Syrphidae)(35) Halictid Bee (Halictidae)(2) Bombus spp. (26) Syrphid Fly (Syrphidae) (11) Halictid Bee (Halictidae) (23) Monotropa hypopitys (red form) Bombus spp.(44) Bombus spp.(42) Vespid Wasp (Vespidae)(1) 2007 Monotropa hypopitys (yellow form) Bombus spp.(6) Syrphid Fly (Syrphidae)(1) 47

58 Figure 3 A 45 B Number of Flowers Number of Flowers C C CNF PT CNF PT CNF PT D 0 BCI CLI LP BCI CLI LP BCI CLI LP Number of Flowers Number of Flowers CL FW GT CL FW GT CL FW GT BC BC BC

59 Klooster et al., p. 49 Figure 4 49

60 Klooster et al., p. 50 CHAPTER 3 Characterization of microsatellite loci in the myco-heterotrophic plant, Monotropa hypopitys (Ericaceae) and amplification in related taxa M.R. Klooster, A.W. Hoenle, and T.M. Culley Department of Biological Sciences University of Cincinnati Cincinnati, OH Tel: , Fax:

61 Klooster et al., p. 51 Abstract The myco-heterotroph, Monotropa hypopitys is a perennial, circumboreally distributed herb of significant importance in studies of non-photosynthetic plant biology. To address a deficiency in our knowledge of myco-heterotroph population genetics, 11 microsatellite markers were developed using a cost effective, non-radioactive protocol. Multiplex reactions revealed polymorphism in the red and yellow color forms of M. hypopitys with an average of 2.69 alleles per primer. Many primers additionally amplified in the congener M. uniflora and five other closely related genera. This is the first report of microsatellite primer development and amplification in the Monotropoideae (Ericaceae). 51

62 Klooster et al., p. 52 Introduction The myco-heterotrophic plant, Monotropa hypopitys (Pinesap; Ericaceae) has been integral in studies of non-photosynthetic plant biology. Myco-heterotrophs, defined as plants that obtain carbon resources from associated mycorrhizal fungi, are rare among angiosperms, consisting of approximately 400 nonphotosynthetic taxa (Leake 1994). Early experiments first used M. hypopitys to identify the mycorrhizal connections between myco-heterotrophic plants and neighboring tree roots (Bijörkman 1960). Since then, this circumboreally distributed species and its congener, M. uniflora, have been used in pioneering studies of myco-heterotroph developmental biology (Olson 1990), symbioses (Bidartondo & Bruns 2002), and early lifehistory chronology (Leake et al. 2004). Despite these pivotal research advancements, there exists a significant gap in our understanding of myco-heterotroph population genetics and reproductive ecology (Bidartondo 2005). Such research is of pressing importance given the ever-growing rarity of these taxa, their specialized mycorrhizal associates, and pristine habitats resulting from anthropogenic activity and global climate change (e.g., Moola and Vassuer 2004). To address important questions concerning myco-heterotroph population genetic structure, 11 microsatellite primer pairs were developed in the red, fall-blooming color form of M. hypopitys. Methods and Results The protocol developed by Glenn and Schable (2003) was chosen as a non-radioactive and cost effective approach to microsatellite development. DNA was extracted from fresh tissue of M. hypopitys using the modified CTAB method of Doyle and Doyle (1987), treated with Qiagen RNase A (Qiagen Inc., Valencia, CA) and digested using Rsa I restriction enzyme. Restriction fragments were then enriched with biotinylated oligos using PCR, recovered using 52

63 Klooster et al., p. 53 magnetic Dynabeads (Invitrogen Co., Carlsbad, CA), and subsequently ligated and transformed into plasmids of competent bacteria using the TOPA-TA cloning kit (Invitrogen Co., Carlsbad, CA). After cells were plated and incubated, hundreds of positive bacterial colonies with successful insertions were obtained. Of these colonies, 158 were individually selected and amplified using PCR with 55 (35%) of the inserts falling within the size limits of bp. These were then sequenced and screened for the presence of microsatellite regions. Eleven sequences (20%) possessed regions suitable for designing forward and reverse primers, and primers were developed using Primer3 software (Rozen & Skaletsky 2000). Microsatellite primer pairs were tested using 72 DNA samples collected from the red color form of M. hypopitys located on Nature Conservancy land in Adams Co., OH (N38º48.005, W83º24.082) and 21 DNA samples from the yellow color form at Cowan Lake State Park, Highlands Co., OH (N37º22.899, W83º54.658). Once primer amplification was confirmed, we used the cost effective method of analyzing individual DNA samples in multiplex reactions, combined with fluorescently labeling forward primers during PCR (adapted from Schuelke 2000; see Culley et al., in press). Briefly, each of the 11 microsatellite regions was amplified using the unlabeled reverse primer, the forward primer incorporating a unique sequence added to the 5' end, and a third primer composed of this same unique sequence but with a fluorescent label (6- FAM, NED, VIC, or PET) attached to the 5' end. The four sequences used were M13(-21) (TGTAAAACGACGGCCAGT), two modifications (TAGGAGTGCAGCAAGCAT, CACTGCTTAGAGCGATGC) and T7term (CTAGTTATTGCTCAGCGGT). PCR was performed in 10µl reaction volumes using the Qiagen Multiplex kit (Qiagen Inc., Valencia, CA) as follows: 5µl Multiplex PCR Master Mix, 1X primer mix (2µM each), 0.2µl DNA and 3.8µl dh2o. Initial attempts at multiplexing all 11 primer pairs together in one reaction per DNA 53

64 Klooster et al., p. 54 sample failed, likely due to interactions among primers. Therefore, multiplexing was performed using the following four primer groups: Mono22, 48 (Group1); Mono15, 20, 29, 47 (Group 2); Mono21, 44, 53 (Group3); Mono02, 35 (Group 4). Multiplex PCR consisted of 95ºC for 15 min, followed by 30 cycles each of 94ºC for 30 s, 57ºC for 45 s, and 72ºC for 45 s, and then 8 cycles each of 94ºC for 30 s, 53ºC for 45 s, and 72ºC for 45 s, followed by a final extension of 72ºC for 10 min. Samples were run on a 3730xl sequencer (Applied Biosystems, Fortune City, CA) at the Cornell University BioResource Center with the LIZ 500 internal size standard, and fragment analysis was conducted with Genemapper vers. 3.7 software (Applied Biosystems). All microsatellite primer pairs amplified in the red and yellow color forms of M. hypopitys, with the exception of Mono47 and Mono48, which failed to amplify or inconsistently amplified in the yellow form, respectively. Polymorphism was detected in 8 of 11 primer pairs in the two populations with variable heterozygosity, and the total number of alleles ranged from 2-6 per polymorphic locus (mean = 2.27 and 3.10 in the red and yellow forms respectively; Table 1). The three monomorphic primer pairs were as follows: Mono29 (Genebank accession: EU568345), Mono47 (EU568348), Mono53 (EU568350). After using a Bonferroni correction for multiple comparisons, significant deviations from Hardy-Weinberg equilibrium were detected in four loci (Mono15,20,44,48) for the red color form and one locus (Mono02) for the yellow color form. Linkage disequilibrium was not detected for the red color form but was identified in one pair of loci (Mono02 and Mono35) for the yellow color form after correcting for multiple comparisons. The possibility of null alleles was indicated by an excess of homozygotes (P<0.05) in Mono48 for the red color form only using MicroChecker (van Ooserhout et al. 2004). 54

65 Klooster et al., p. 55 To determine if these primers could amplify across closely-related Monotropoid genera, DNA was extracted from fresh tissue of M. uniflora and Monotropsis odorata, and from dry, herbarium specimens of Allotropa virgata, Pleuricospora fimbriolata, Pterospora andromeda, and Sarcodes sanguinea. Using the four primer groups in multiplex reactions, six primers amplified in the congener Monotropa uniflora. In the other genera, 3-9 primers also amplified, some at relatively low amplitude of fluorescence (Table 2). Due to the age and quality of herbarium specimen DNA and low sample sizes, these results are likely an underestimate of the broad applicability of the primers in other taxa. ACKNOWLEDGEMENTS We thank T. Glenn for sharing his protocol and the University of Cincinnati Herbarium (CINC) for providing tissue. Special thanks to the Daniel Boone National Forest, Cherokee National Forest, Ohio Department of Natural Resources, Germantown Metroparks, The Nature Conservancy, and the Culbertson family for granting permission to collect M. hypopitys and related species. REFERENCES Bidartondo, M.I The evolutionary ecology of myco-heterotrophy. New Phytologist 167: Bidartondo, M.I. and Bruns, T.D Fine-level mycorrhizal specificity in the Monotropoideae (Ericaceae): specificity for fungal species groups. Molecular Ecology 11:

66 Klooster et al., p. 56 Bijörkman, E Monotropa hypopitys L. an epiparasite on tree roots. Physiologia Plantarum 13: Culley, T.M., Weller, S.G., Sakai, A.K., and Putnam, K.A. (In press). Characterization of microsatellite loci in the Hawaiian endemic shrub, Schiedea adamantis (Caryophyllaceae), and amplification in related genera. Molecular Ecology Resources. Doyle, J.J., and Doyle, J.L A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bulletin 19: Glenn, T.C., and Schable, M Microsatellite isolation with Dynabeads. Information online at: Leake, J.R Tansley Review No. 69. The biology of myco-heterotrophic ( saprophytic ) plants. New Phytologist 127: Leake, J.R., McKendrick, S.L., Bidartondo, M., and Read, D.J Symbiotic germination and development of the myco-heterotroph Monotropa hypopitys in nature and its requirement for locally distributed Tricholoma spp. New Phytologist 163: Moola, F.M., and Vassuer, L Recovery of late-seral vascular plants in a chronosequence of post-clearcut forest stands in coastal Nova Scotia, Canada. Plant Ecology 172: Olson, R.A Observations on the floral shoots of Monotropa hypopitys (Monotropaceae). Rhodora 92: Rozen S, and Skaletsky H.J. (2000) Primer3 on the WWW for general users and for biologist programmers. In: Bioinformatics Methods and Protocols: Methods in Molecular Biology (eds. Krawetz S, Misener S), pp Humana Press, Totowa, NJ. 56

67 Klooster et al., p. 57 Schuelke M (2000) An economic method for the fluorescent labeling of PCR fragments, Nature Biotechnology 18: Van Oosterhout, C., Hutchinson, W.F., Wills, D.P.M., and Shipley, P Microchecker: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4:

68 Klooster et al., p. 58 Table 1. Eight polymorphic forward (F) and reverse (R) microsatellite primer pairs developed from the red, fall-blooming color form of Monotropa hypopitys. Data includes the microsatellite repeat motif, size range (including the bp fluorescent label; see text), and fluorescent label used in multiplexing reactions. All primers share the ideal annealing temperature (T a ) of 53ºC. The number of alleles (A) and observed and expected heterozygosity (H o and H e ) were averaged over 72 individuals of the red color form (grey cells) and 21 individuals of the yellow color form (white cells). Name Primer Sequence (5-3 ) Repeat motif Size (bp) Label A H o H e Genbank # Mono02 F: CCGGAAAGATGTCCCAATAA (CT) 10 (CA) FAM R: CATGAGAAGGGGAAGCAATG EU Mono15 F: CAACAGAGCCAACAGCTAAGG (AG) R: CTTTCAGTTGCTTCACCCTTG PET EU Mono20 F: TTCGTTCGTTGAGTCCGTTAT (AC) R: GAGTATTCATGCAATTGAGCAC VIC EU Mono21 F: TCTGCACTGTGGTTGATTCAG (CA) R: GAGGAGCCCAGGAGTAGCTT NED EU Mono22 F: AAGTTTGACCATTGTGCCTTG (TTG) R: TTCACCGGATCATTTAGCAAG 3 (CT) FAM EU Mono35 F: CCTCATTACGCCTTCACTGC (AC) PET R: TCCTATATCCGGTGGTGGTG EU Mono44 F: CATATGTGGACGATCCGAGAC (GA) R: GGCTGAGAGATGAAGCCCTAA FAM EU F: GATTCGGATCGTCACATCG Mono48 R: CATCCATCCACATCAGCATC (TA) FAM EU

69 Klooster et al., p. 59 Table 2. Amplification of microsatellite primers developed for Monotropa hypopitys in related taxa. DNA was extracted from fresh tissue of M. uniflora and Monotropsis odorata and from dry herbarium tissue for all other species. Listed are the sample sizes (N), the product size range (including the bp fluorescent label; see text), and the number of alleles per locus (in parentheses). Primer pair Mono47 failed to amplify in related taxa and primer pair Mono53 was monomorphic for most taxa. Species N Mono02 Mono15 Mono20 Mono21 Mono22 Mono29 Mono35 Mono44 Mono48 Allotropa virgata (4) (2) (2) (2) (2) Monotropa uniflora (3) (2) Monotropsis odorata (3) (2) Pleuricospora frimbriolata (2) (2) (3) (2) (3).. Pterospora andromedea (3) Sarcodes sanguinea (2)

70 CHAPTER 4 Population genetic structure of Monotropa hypopitys L. (Ericaceae) and differentiation between red and yellow color forms M.R. Klooster and T.M. Culley Department of Biological Sciences University of Cincinnati Cincinnati, OH Tel: , Fax:

71 Abstract The myco-heterotroph, Monotropa hypopitys L., has been a model organism for evolutionary ecology studies of non-photosynthetic plant species. However, M. hypopitys has perplexed taxonomists for centuries owing to confusion over taxonomic placement of two discrete color forms (red and yellow). The purpose of this study was to characterize the population genetic structure of M. hypopitys using eleven microsatellite markers and to determine levels of genetic differentiation between the two color forms. Results from this analysis demonstrated relatively low to moderate levels of genetic variation across populations, with levels of variation differing between color forms. High levels of genetic differentiation were detected among populations of the yellow color form and between the red and yellow color forms. Additionally, analyses showed genetic structuring of sympatric and allopatric populations of M. hypopitys by color form, suggestive of speciation and the need for a taxonomic revision. This is the first study of the population genetic structure of a non-photosynthetic, mycoheterotrophic plant and offers conclusive evidence of genetic divergence between color forms of M. hypopitys. 61

72 Introduction In recent years, research concerning the evolution of complex ecological interactions has brought myco-heterotrophic plants to the forefront of science as model organisms for highly specialized symbioses. Defined as plants that acquire nutrients and carbon resources from highly specialized mycorrhizal associates, myco-heterotrophs have enhanced our understanding of the complexity and ecological importance of plant-fungal relationships (Leake 1994). One taxon that has been particularly useful in studies of non-photosynthetic, myco-heterotrophic plant biology is Monotropa hypopitys L. Initially used in pioneering studies that identified the complex web of interactions among autotrophic plants, mycorrhizal fungi, and mycoheterotrophs (Bijörkman 1960), M. hypopitys has since functioned as an important research organism in studies of development biology (Olson 1990,1993), life history chronology (Leake et al. 2004), and symbioses (Bidartondo & Bruns 2002; Leake et al. 2004; Bidartondo 2005). Ironically, this intriguing and scientifically valuable organism has presented its own unique set of challenges to researchers. M. hypopitys has perplexed taxonomists for centuries, exhibiting various morphs and color variants that have been described as natural color forms of a single species or as distinct species. Additionally, M. hypopitys has been classified as an independent genus, Hypopitys (Small 1914; Britton & Brown 1970; Furman & Trappe 1971), but the species was later subsumed under Monotropa by Wallace (1975) because of numerous morphological similarities to Monotropa uniflora L. All totaled, M. hypopitys has undergone over 85 taxonomic rearrangements ranging as far back as Linnaeus (Wallace 1975). The cause for such taxonomic confusion has come from the existence of two primary color forms (red and yellow) that share a similar distribution pattern and habitat requirements. Both forms have been observed to grow circumboreally in mature temperate forests, associating 62

73 with basidiomycete mycorrhizae of the genus, Tricholoma (Bidartondo & Bruns 2002; Leake et al. 2004). Additionally, both forms of M. hypopitys produce one to many flowers per reproductive stem and one to many reproductive stems per plant, with similar floral, fruit, and seed morphologies (Wallace 1975). However, it has been proposed that these color forms may exhibit discernible morphological differences, including degree of pubescence, presence or absence of toothed bracts, and petal length (Britton & Brown 1970). Additionally, the color forms bloom at different times, with the yellow color form of M. hypopitys exhibiting an earlier, summer-blooming phenology compared to the fall-blooming, red color form (Wallace 1975; Neyland 2004; M. Klooster, unpublished data). Some recent attempts to determine a genetic basis for color variation and possible divergence among color forms have been inconclusive. As part of a larger phylogenetic assessment based on the plastid gene rps2 and nuclear rdna (28S and ITS), Bidartondo and Bruns (2001) determined that M. hypopitys sampled from North America and Eurasia are polyphyletic. Additionally, Neyland (2004) conducted a comparative phylogenetic analysis to determine levels of genetic divergence between color forms of M. hypopitys using (26S) rrna gene sequences. Results indicated that color forms of M. hypopitys have not evolved along separate lines of ancestry and individual samples do not exhibit color-form-specific clustering in the phylogram. To date, it remains unclear if the differences observed among color forms are simply the byproduct of phenotypic plasticity of a single species or representing genetic differentiation between distinct taxonomic entities. With the recent advancement of population genetic techniques, including microsatellite markers, it is now possible to further resolve the population genetic structure of M. hypopitys to address this long-standing taxonomic question. The purpose of this paper is to describe for the 63

74 first time, the basic population genetic structure of the myco-heterotroph, M. hypopitys, especially in terms of genetic differentiation between populations of the red and yellow color forms growing in sympatry and allopatry in the eastern United States. Because mycoheterotroph populations are typically fragmented, sensitive to disturbance (e.g., Moola & Vasser), and exhibit specialized habitat requirements for survival and propagation (e.g., Luoma 1987; Leake 1994; Taylor & Bruns 1999; Bidartondo & Bruns 2002; Leake et al. 2004; Bidartondo 2005), (1) it was our hypothesis that levels of genetic variation and polymorphism among populations will be relatively low (Young et al. 1996). (2) Additionally, we hypothesized that moderate to high levels of genetic differentiation will be detectable among populations, possibly correlating with geographic distances. (3) Finally, because color forms have been proposed to exhibit unique reproductive phenologies (M. Klooster & T. Culley, in prep.) with the potential for reproductive isolation, it was our hypothesis that significant genetic structuring would be detectable between color forms. Methods Site description and sampling Populations of Monotropa hypopitys were identified in Ohio and Indiana (eastern United States) in 2004 and early 2005 (Table 1). All populations were located in mixed deciduous, old growth forest remnants and plants were typically observed to grow in close proximity to Fagus grandifolia Ehrh. and Quercus spp. L. The coloration of reproductive stems were recorded in each population to determine if red and yellow forms typically occur in sympatry or allopatry. At one site (Nature Conservancy Land, Adams Co., Ohio), both color forms were observed growing in sympatry but exhibited unique flowering phenologies, differing in reproductive 64

75 timing by four to six weeks (M. Klooster & T. Culley, in prep.). Consequently, individuals of the two color forms in this area were treated as separate populations, BCY and BCR (Table 1). In all other sites, reproductive stems exhibited little variation in color and each population was subsequently classified as a member of the red or yellow color form. The yellow form of M. hypopitys was observed to grow across a broader geographic region of the eastern United States than populations of the red color form, which was rare and only observed to grow in forests on the edge of the Appalachian Mountains in southern Ohio. All populations were monitored from to assess flowering phenology and were additionally used as part of a larger study investigating the reproductive ecology of myco-heterotrophic plants (M. Klooster, unpublished data). It was not possible to identify individual genets of this myco-heterotroph without exhuming roots and severing essential mycorrhizal connections. Therefore plants were identified as isolated clumps of reproductive stems that were located more than one meter from the next neighboring clump, and were marked with flagging (n per population). Because this taxon reproduces sporadically (Wallace 1975; Leake 1994), sampling of genets was conducted over three years. Special care was taken not to sample from the same plant twice across years. A single reproductive stem was sampled from each plant within a population so as not to damage roots or impact plant viability. Stems were subsequently stored at -70 o C for later use. Microsatellite Analysis DNA was extracted from stem tissue collected from individual plants in populations across the three-year sampling period ( ) using the modified CTAB method of Doyle and Doyle (1987). When necessary, liquid nitrogen was used to pulverize dry tissue. Samples 65

76 were then analyzed using eleven microsatellite primer pairs, subdivided into four primer groups in multiplex reactions (see Klooster et al., in press) using fluorescently labeled forward primers during PCR (adapted from Schuelke 2000; see Culley et al. 2008). Samples were run on a 3730xl sequencer (Applied Biosystems, Fortune City, CA) at the Cornell University BioResource Center with the LIZ 500 internal size standard, and fragment analysis was conducted with Genemapper vers. 3.7 software (Applied Biosystems). All eleven microsatellite loci amplified in populations of the red color form, in which they were initially developed (Klooster et al., in press). Select primers that failed to amplify in populations of the yellow color form included Mono47 (SL, FW, and CL), Mono48 (SL, FW, and BCY), and Mono44 (FW). Analyses were conducted to quantify levels of genetic variation among populations using Genetic Data Analysis (GDA; Lewis & Zaykin 1999). Statistics calculated from this analysis included: number of alleles per locus (A) and per polymorphic loci (A p ), percentage of polymorphic loci (P; 0.95 level), observed heterozygosity (H o ), and expected heterozygosity (H e ). Levels of Hardy-Weinberg equilibrium and linkage disequilibrium were then calculated for all loci using exact tests with levels of significance adjusted by sequential Bonferroni corrections. Spearman s rank correlation analyses were conducted to determine if population size was significantly correlated with observed heterozygosity and expected heterozygosity values. Deviations from Hardy-Weinberg equilibrium were also measured for populations using Wright s fixation index (f), with a χ 2 test (Li & Horvitz 1953) used to assess significant departure of f from zero. The possibility of null alleles was also evaluated for each population using the software program, MicroChecker (van Ooserhout et al. 2004). Levels of genetic differentiation among populations were initially assessed using Weir & Cockerham s (1984) θ, calculated in GDA, with bootstrapping across loci to detect significant deviations from zero. θ is analogous to 66

77 Wright s (1951) F ST but accounts for small and unequal sample sizes as well as the size and number of populations (Weir & Cockerham 1984). Spatial genetic analyses were also conducted to measure levels of genetic structuring among populations (including the two color forms) and to ascertain if genetic distances of populations (i.e. θ) were related to geographic distances. To determine if genetic and geographic distances were correlated among populations, a Mantel Test was performed using TFPGA (Miller 1997). A UPGMA phenogram constructed from coancestry coefficients was used to determine how populations cluster together, offering some insight into their relative genetic differences. An hierarchical AMOVA was conducted using the program GenAlex (Peakall & Smouse 2006) to determine how genetic variation was partitioned among predetermined groups. In this analysis, sampled populations were analyzed by color form first to determine if the highest proportion of molecular variance was found between color forms before variance was partitioned among and within populations. Finally, a Principal Coordinates Analysis (PCoA) was used to plot all individuals together across a gradient using the standard distance coefficient for codominant genotype data in GenAlex (Smouse & Peakall 1999). This analysis allowed us to determine if individuals group with other members of their population and/or color form in twodimensional space. Results Populations of the red and yellow color forms of Monotropa hypopitys exhibited variable levels of polymorphism (Table 2). Overall, nine of the eleven microsatellite loci were polymorphic, with an average of 2.16 alleles per locus and 3.15 per polymorphic loci. The loci Mono47 and Mono53 failed to amplify or were fixed in all populations, with locus Mono29 67

78 additionally fixed across populations of the red color form. Two loci, Mono02 and Mono22, were most variable with four to six alleles detected across populations of both color forms. The CL and GT populations of the yellow color form exhibited the highest number of A (3.10 and 2.27 respectively), with the small BCY population exhibiting the overall lowest value of A. Both populations of the red color form showed intermediate values for A, but the small SSF population had the overall lowest number of alleles per polymorphic loci (2.66) of any population. The largest population of the red color form (BCR) and yellow color form (SL) both exhibited intermediate values of A and A p. Populations of the red and yellow color forms shared 55% of alleles, and four alleles were specific to populations of the red color form and 28 alleles were found exclusively in populations of the yellow color form. Levels of genetic variation differed among populations, with the smallest population (BCY) exhibiting the lowest observed heterozygosity. The highest levels of observed heterozygosity occurred in populations of the red color form (H o = 0.33 [BCR], 0.32 [SSF]), compared to populations of the yellow color form (average H o = 0.14). Interestingly, population size was not significantly correlated with observed heterozygosity (r s = 0.46; P = 0.29) or expected heterozygosity (r s = 0.21; P = 0.64). Additionally, there was no significant difference between the expected and observed proportions of heterozygous loci (paired t-test; t = -0.58, df = 6, P = 0.58). Wright s fixation index (f) significantly deviated from zero in three of seven populations (BCR, BCY, and CL; P < 0.05). Deviations from Hardy-Weinberg equilibrium were detected in all but four loci (Mono29,35,47,53). The locus Mono02 was not in Hardy-Weinberg equilibrium in four populations, with the remaining six loci deviating in one to three of the seven populations. There was no evidence for linkage disequilibrium between loci across populations, with the exception 68

79 of possible linkage among the following pairs of loci in the CL population: Mono02 & 35; Mono02 & 21; Mono02 & 20; Mono02 & 15; Mono15 & 21; Mono 15 & 35; Mono20 & 21. With the exception of population SSF, which showed no sign of null alleles, the following populations of the red and yellow color forms demonstrated an excess of homozygosity in at least one locus: BCR (Mono48), BCY (Mono15,22), CL (Mono02,20,21), FW (Mono22), GT (Mono02,15,22,48), and SL (Mono02,44). Varying levels of genetic differentiation were detected among populations of the red and yellow color forms using Weir & Cockerham s (1984) θ (Table 3). Populations of the red color form (BC and SSF) showed a moderate level of differentiation with θ = 0.12 (lower CI = 0.017, upper CI = 0.24). Pair-wise comparisons of populations of the yellow color form showed a range of θ values from , with a mean value of 0.52 for all yellow populations (lower CI = 0.41, upper CI = 0.66). All pair-wise comparisons of red color form to yellow color form populations revealed substantial levels of genetic differentiation, ranging from Interestingly, sympatric populations of the red and yellow color forms (BCR and BCY respectively) were genetically differentiated from one another (θ = 0.59; lower CI = 0.34, upper CI = 0.77). No significant correlation was observed among pair-wise comparisons of genetic and geographic distances across all populations (Mantel Test; r = -0.23; P = 0.13). A UPGMA phenogram further supported genetic differentiation among populations and color forms (Fig. 1). Populations of the red color form clustered together and separately from populations of the yellow color form. The yellow color form showed grouping of populations on two separate branches of the phenogram with CL and GT populations clustering together and separately from BCY, FW and SL. The AMOVA indicated that 40% of the variance observed was due to color form differences, with the remaining 31% and 29% representing among 69

80 population and within population differences, respectively (Table 4). Finally, PCoA demonstrated distinct clustering of all individuals of the red color form in separate space from individuals of the yellow color form, with the x-axis explaining 49% and the y-axis 20% of the variation among samples (Fig. 2). Samples from populations of the yellow color form occupied the same region of space but showed two independent clusters, with the CL and GT populations clustering together and separately from the BCY, SL, and FW populations, which grouped together. Samples from the BCR and BCY populations clustered at opposite ends in space and with their respective color forms, indicating genetic differentiation between these sympatric populations. Discussion The myco-heterotrophic plant, Monotropa hypopitys, has been an effective model organism used for pioneering investigations of nonphotosynthetic plant biology (Leake 1994; Bidartondo 2005). Despite its scientific efficacy, this species has confounded taxonomists for over two centuries primarily due to confusion over the identity of the red and yellow color forms. In this study, modern population genetic techniques using microsatellite markers were employed for the first time to quantify levels of genetic variation among populations and color forms of M. hypopitys in the eastern United States. Results from this analysis demonstrated low to moderate levels of genetic variation across populations of M. hypopitys relative to other angiosperm taxa (Hamrick & Godt 1989), supporting our first hypothesis. Additionally, levels of polymorphism across populations were highly variable, failing to correspond with population size. The majority of these loci were out of Hardy-Weinberg equilibrium in at least one population, with no population exhibiting Hardy-Weinberg 70

81 equilibrium across all loci. These results suggest that differential selective forces or nonrandom mating, small population sizes, etc. may be influencing the evolution of populations and are consistent with the effects of habitat fragmentation (Sherwin & Moritz 2000) and/or specialization. Because myco-heterotrophs obligately rely on mycorrhizae for germination (Bruns & Read 2000), growth (Bijörkman 1960; Leake et al. 2004), and survival (Leake 1994; Bidartondo 2005), the natural range of these plants is inherently restricted to regions occupied by their fungal associates. Consequently, plant populations are naturally fragmented due to the narrow distribution of specific mycorrhizal symbionts (Bidartondo & Bruns 2002), possibly increasing the likelihood of reproductive isolation and genetic differentiation among populations separated by uninhabitable matrices. In addition, human disturbances may also further contribute to isolation and populational differentiation as forests of the eastern United States (specifically the Ohio River valley) are becoming increasingly fragmented due to urbanization and deforestation (e.g., Pimm & Askins 1995). Because populations are fragmented, the effects of genetic drift may have contributed to a loss of genetic variation and to divergence across populations. This study also demonstrated that populations of M. hypopitys are genetically differentiated and exhibit structuring by color form, supporting our previous hypotheses. The fact that microsatellite markers originally developed in the red color form of M. hypopitys did not consistently amplify in the yellow color form suggests genetic differences at the primer sites, resulting in the failure of primers to anneal (Klooster et al., in press). Furthermore, 32 alleles (45%) were unique to different color-forms in this population genetic survey, indicative of a lack of gene flow between color forms. High levels of differentiation were detected in pairwise comparisons across populations of the two color forms ( ). These θ values were 71

82 overall much larger than the values calculated from populations within the yellow color form ( ) or within the red color form (0.12). However, levels of genetic differentiation failed to correlate with geographic distance. Because high levels of genetic differentiation were also observed among some populations of the yellow color form, it can be assumed that these relatively small, fragmented populations have likely diverged as a result of low levels of gene flow, genetic bottlenecks, and/or drift. Interestingly, both color forms collected from a sympatric population in Adams Co., Ohio (BCR & BCY) were genetically differentiated from one another and exhibited genetic structuring consistent with allopatric populations of each color form, clustering separately in UPGMA and PCoA analyses. In addition, results from the AMOVA demonstrated that the highest proportion of molecular variance observed was attributable to genetic differences between color forms, with considerably less variation partitioned among populations or within populations. Because allopatric and sympatric populations of M. hypopitys were observed to exhibit color-form-specific blooming periods (M. Klooster & T. Culley, in prep.), it is possible that temporal reproductive isolation may function, possibly in tandem with geographic isolation, as a mechanism for genetic divergence and possibly speciation between color forms. In addition, the autogamous behavior of the yellow color form may restrict gene flow via pollen and further enhance isolation of the color forms. This is consistent with observed values of heterozygosity in which the yellow color form showed on average lower levels of H o and H e than the red color form. The red color form is primarily outcross-pollinated which can promote higher levels of genetic variation (Barrett & Kohn 1991) whereas the yellow color form is primarily autogamously self-pollinating, which can lead to a loss of genetic variation (M. Klooster and T. Culley, in prep). It is also unclear if members of each color form have further specialized on 72

83 independent mycorrhizal associates within the genus Tricholoma (Bidartondo & Bruns 2002), which has been shown to function as a force driving speciation in some myco-heterotrophic taxa (e.g., Kruckeberg & Rabinowitz 1985; Taylor & Bruns 1999; Taylor et al. 2003). Furthermore, it is unknown how unique mycorrhizal associates and differential rates of resource provisioning by symbiotic fungi may influence reproductive timing in populations of myco-heterotrphic taxa (Selosse et al. 2006; M. Klooster & T. Culley, in prep.). Further research resolving ecological differences between color forms in sympatric and allopatric populations across their circumboreal distribution may reveal additional factors promoting reproductive isolation and genetic divergence. This study is the first population genetic survey of a non-photosynthetic, mycoheterotrophic species offering insight into levels of genetic variation that are lower than most photosynthetic angiosperms (Hamrick & Godt 1989). Additionally, this study provides the first conclusive evidence of genetic divergence among populations of M. hypopitys that, in combination with temporal reproductive isolation, support genetic divergence between color forms consistent with potential speciation. Results from this analysis and a recent study documenting differences in the reproductive ecology between color forms (M. Klooster & T. Culley, in prep.) support the need for a taxonomic revision of M. hypopitys. By continuing to study this species across a larger portion of its circumboreal distribution, we may finally elucidate genetic and ecological factors responsible for the variation inherent to M. hypopitys and resolve this long-standing taxonomic dilemma. 73

84 Acknowledgements We thank D. Boone, M. Becus, B. Culbertson, M. Dillon, B. Lund, S. Lockwood, and V. Soukup for assistance with locating populations and conducting analyses. We show gratitude to A. Hoenle for help with DNA extractions and microsatellite analyses. Special thanks to the Ohio Department of Natural Resources, Germantown Metroparks, The Nature Conservancy, and the Culbertson family for granting permission to collect M. hypopitys. References Barrett, S.C.H. and Kohn, J.R Genetic and Evolutionary Consequences of Small Population Size in Plants: Implications for Conservation. In: D.A. Falk and K.E. Holsinger (eds) Genetics and Conservation of Rare Plants, pp Bidartondo, M.I The evolutionary ecology of myco-heterotrophy. New Phytol. 167: Bidartondo, M.I. and Bruns, T.D Extreme specificity in epiparasitic Monotropoideae (Ericaceae): widespread phylogenetic and geographical structure. Molecular Ecology 10: Bidartondo, M.I. and Bruns, T.D Fine-level specificity in the Monotropoideae (Ericaceae): specificity for fungal species groups. Molecular Ecology 11(3): Bruns, T.D., and Read, D.J In vitro germination of nonphotosynthetic, myco-heterotrophic plants stimulated by fungi isolated from the adult plants. New Phytol. 148: Bijörkman, E Monotropa hypopitys L. an epiparasite on tree roots. Physiologia Plantarum 13:

85 Britton., N.L. and Brown, H.A An Illustrated Flora of the Northern United States and Canada, Second Edition, Vol. II. New York: Dover Publications Inc. Culley, T. M., Weller, S.G., Sakai, A.K., and Putnam, K.A. (In press). Characterization of microsatellite loci in the Hawaiian endemic shrub, Schiedea adamantis (Caryophyllaceae), and amplification in related genera. Molecular Ecology Resources. Doyle, J.J., and Doyle, J.L A rapid DNA isolation procedure for small quantities of fresh leaf tissue, Phytochem. Bulletin 19: Furman, T.E. and Trappe, J.M Phylogeny and ecology of mycotrophic achlorophyllous angiosperms. Quarterly Review of Biology 46: Hamrick, J.L. and Godt, M.J Allozyme diversity in plant species. In: A.H.D. Brown, M.T. Clegg, A.L. Kahler, and B.S. Weir (eds) Plant Population Genetics, Breeding, and Genetic Resources, pp Klooster, M.R., Hoenle, A.W., and Culley, T.M. (in press). Characterization of microsatellite loci in the myco-heterotrophic plant, Monotropa hypopitys (Ericaceae) and amplification in related taxa. Molecular Ecology Resources. Klooster, M.R., and Culley, T.M. (in prep). Comparative analysis of the reproductive ecology of Monotropa and Monotropsis: Two myco-heterotrophic genera in the Monotropoideae (Ericaceae). Kruckeberg, A.R. and Rabinowitz, D Biological aspects of rarity in higher plants. Annual Reviews of Eco1ogy and Systematics 16: Leake, J.R The biology of myco-heterotrophic ( saprophytic ) plants. New Phytol. 127:

86 Leake, J.R., McKendrick, S.L., Bidartondo, M., and Read, D.J Symbiotic germination and development of the myco-heterotroph Monotropa hypopitys in nature and its requirement for locally distributed Tricholoma spp. New Phytol. 163(2): Lewis, P.O., and Zaykin, D Genetic Data Analysis: Computer program for the analysis of allelic data, Version 1.0 (d12c). Free program distributed by authors over the internet from Li, C.C., and Horvitz, D.G Some methods of estimating the inbreeding coefficient. American Journal of Human Genetics 5: Luoma, D.L Synecology of the Monotropoideae within Limpy Rock Research Natural Area, Umpqua National Forest, Oregon. M.S. Thesis. Oregon State University. Miller, M.P Tools for population genetic analyses (TFPGA) 1.3: A Windows program for the analysis of allozyme and molecular population genetic data. Computer software distributed by the author. Moola, F.M., and Vassuer, L Recovery of late-seral vascular plants in a chronosequence of post-clearcut forest stands in coastal Nova Scotia, Canada. Plant Ecology 172: Pimm, S.L., and Askins, R.A Forest losses predict bird extinctions in eastern North America. Proc. Natl. Acad. Sci. 92: Neyland, R The systematic significance of color variation in Monotropa hypopithys (Ericaceae) inferred from large ribosomal subunit (26S) rrna gene sequences. Madrono 51: Olson, R.A Observations on the floral shoots of Monotropa hypopitys (Monotropaceae). Rhodora 92:

87 Olson, R.A Patterns of embryo formation in Monotropa hypopitys (Monotropaceae) from North America and Western Sweden. Amer. J. Bot. 80(7): Peakall, R., and Smouse, P.E GENEALEX 6: Genetic Analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: Schuelke M (2000) An economic method for the fluorescent labeling of PCR fragments, Nature Biotechnology 18: Sherwin, W.B. and Moritz, C Managing and monitoring genetic erosion. In: A.G. Young and G.M. Clarke (eds) Genetics, Demography and Viability of Fragmented Populations, pp Selosse, M.A., Richard, F., He, X., and Simard, S.W Mycorrhizal networks: des liaisons dangereuses? Trends Ecol. Evol. 21: Small, J.K Monotropaceae. North American Flora 29: Smouse, P.E., and Peakall, R Spatial autocorrelation analysis of multi-allele and multilocus genetic micro-structure. Heredity 82: Taylor, D.L. and Bruns, T.D Population, habitat and genetic correlates of mycorrhizal specialization in the cheating orchids Corallorhiza maculate and C. mertensiana. Molecular Ecology 8(10): Taylor, D.L., Bruns, T.D., Szaro, T.M., and Hodges, S.A. 2003, Divergence in mycorrhizal specialization within Hexalectris spicata (Orchidaceae), a nonphotosynthetic desert orchid. American Journal of Botany 90: Van Oosterhout, C., Hutchinson, W.F., Wills, D.P.M., and Shipley, P Microchecker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 4:

88 Wallace, G.D Studies of the Monotropoideae (Ericaceae): Taxonomy and distribution. The Wasmann Journal of Biology 33: Weir, B.S., and Cockerham, C.C Estimating F-statistics for the analysis of population structure. Evolution Wright, S The genetic structure of populations. Annals of Eugenics 15: Young, G.G., Boyle, T., and Brown, T The population genetic consequences of habitat fragmentation for plants. Trends in Ecology and Evolution 11:

89 Figure Legends Figure 1. UPGMA phenogram of seven populations of Monotropa hypopitys including red and yellow color forms, based on coancestry coefficients. All populations were located in Ohio and Indiana in the eastern United States. Population abbreviations are given in Table 1. Figure 2. Principal coordinates analysis of samples from seven populations of Monotropa hypopitys consisting of the red and yellow color forms. Axes were constructed using the standard distance coefficient for codominant genotype data in GenAlex (Peakall & Smouse 2006) with the percentage of variation explained by each axis as indicated. Population abbreviations are given in Table 1. 79

90 Table 1. Populations of the red and yellow color forms of M. hypopitys located across Ohio and Indiana (eastern United States). Included are site descriptions, identifications used when referencing individual populations in the text, the approximate population sizes (N), the average blooming period of each population observed from , and GPS coordinates Taxon Study Site Location County, State Shawnee State Forest Monotropa Scioto Co., OH hypopitys Nature Conservancy Land (red form) Adams Co., OH Nature Conservancy Land Adams Co., OH Cowan Lake State Park Highland Co., OH Monotropa Flat Woods (Private) hypopitys Jefferson Co., IN (yellow form) Stonelick State Park Clermont Co., OH Germantown Metropark Montgomery Co., OH Site ID N Blooming Period GPS SSF 14 Sept. 22 Oct. 3 BCR 211 Sept. 17 Sept. 30 BCY 13 July 15 July 26 CL 60 July 17 Aug. 2 FW 65 July 15 July 29 SL >250 July 18 July 31 GT 41 Aug. 5 Aug º41.876N 83º10.250W 38º48.005N 83º24.082W 38º48.005N 83º24.082W 37º22.899N 83º54.658W 38º50.221N 85º26.388W 39º12.451N 84º04.234W 39º38.444N 84º25.135W 80

91 Table 2. Descriptive genetic statistics of populations of the red and yellow color forms (M. hypopitys). Included are number of individuals sampled per population (N), number of alleles per locus (A) and per polymorphic loci (A p ), percentage of polymorphic loci (P; 95%), expected heterozygosity (H e ) and observed heterozygosity (H o ), and Wright s fixation index (f). The top two rows represent populations of the red color form and the remaining rows indicate populations of the yellow color form, with mean values for each color form indicated in bold. *Significant deviations of f from zero (P < 0.05) Population N A A P P H e H o f SSF BCR * mean BCY CL FW GT * SL * mean

92 Table 3. Pair-wise genetic differences (Weir and Cockerham s θ; shown above the diagonal) and geographic distances (km; shown below the diagonal) of seven populations of Monotropa hypopitys. SSF BCR BCY CL FW GT SL SSF BCR BCY CL FW GT SL

93 Table 4. AMOVA results for the partitioning of microsatellite variation of Monotropa hypopitys between red and yellow color forms, among populations, and within populations. Sources df MS Est. Var. % Total Var. Ψ-statistics P Among Color Forms Among Pops Within Pops

94 Figure 1 84

95 Figure 2 Principal Coordinate 2 (20.30%) BCR BCY CL FW GT SL SSF Principal Coordinate 1 (48.75%) 85

96 CHAPTER 5 Cryptic mimicry is an effective defense strategy for herbivore avoidance in the mycoheterotrophic plant Monotropsis odorata (Ericaceae) M.R. Klooster 1, D.L. Clark 2, and T.M. Culley 1 1 Department of Biological Sciences University of Cincinnati Cincinnati, OH Tel: , Fax: Department of Biology Alma College Alma, MI

97 Abstract Cryptic mimicry is a well-documented defense adaptation, functioning to increase individual fitness by reducing attacks from visually guided predators. Organisms that exhibit this defense strategy often possess cryptic coloration in addition to a behavior or morphology that protectively mimics an object in the environment, rendering the appearance of prey undetectable, undesirable or unpalatable to predators. Although a substantial body of functional data supports cryptic mimicry as a defense adaptation in animal systems, it has only been hypothesized to exist in select plant taxa and remains experimentally untested. Here we show for the first time, through empirical manipulations and quantitative assessment of the visual spectrum, that the plant species Monotropsis odorata possesses adaptive morphology and coloration that mimics leaf-litter, and this functions as a defense strategy for avoiding attacks from visually guided herbivores. M. odorata is of particular interest due to its nonphotosynthetic, myco-heterotrophic life history (i.e., carbon resources are obtained from symbiotic mycorrhizal fungi) and the implications this may have for the evolution of mimetic coloration, useful for plant defense. While reproductive stems of most closely related mycoheterotrophic species exhibit coloration (such as white, yellow, and red) that contrasts with natural substrates, only M. odorata stems appear camouflaged. Additionally, the unique reproductive stems of this species offered us the ability to experimentally manipulate its morphological appearance and coloration using novel methods, without adding artificial compounds or damaging viable tissue. Our results empirically support the hypothesis that cryptic mimicry has evolved in plants and functions as an effective defense adaptation, reducing the frequency of herbivore attacks and thereby increasing plant fitness. 87

98 Introduction Camouflage coloration that allows an organism to blend in with its surroundings can increase individual fitness by reducing attacks from visually guided predators (e.g. Endler 1981, 1984, 2006). Such cryptic coloration is often associated with an organism exhibiting a behavior or possessing a morphology that mimics an object in the environment, which renders the prey undetectable, undesirable or unpalatable to a predator (Main 1987). For example, the vine snake, Oxybelis aeneus frequently possesses morphology and behavior that resembles a wind-blown vine or plant stem with the same coloration as the plant surface (Fleishman 1985). The phenomenon of exhibiting traits that mimic the coloration, structure, and/or movement of a primary element(s) of the natural environment is known as cryptic mimicry (Barlow & Weins 1977; Weins 1978), special resemblance (Endler 1981), or cryptic mimesis (Pastuer 1982). Although cryptic mimicry is broadly accepted as both a predatory and a defense adaptation to avoid visual detection in animal systems, it has not been empirically shown to exist outside the animal kingdom. While most plants have evolved herbivore avoidance strategies that utilize conspicuous morphological (Williams & Gilbert 1981; Campitelli et al. 2008), mechanical (Gómez & Zamora 2002) and/or systemic chemical defenses (Rohner & Ward 1997), it has also been repeatedly hypothesized that some plants may elude predators through various forms of cryptic mimicry. For example, in at least twenty parasitic Australian mistletoe species, it has been proposed that cryptic mimicry via resemblance to the host plant may lead to a reduction in mistletoe herbivory when the host tree possesses secondary compounds that deter herbivores (Barlow & Weins 1977; Ehleringer et al. 1986; Bannister 1988; Canyon & Hill 1997). Leaf mottling in some forest herbs may also function as camouflage to deter color-blind vertebrate herbivores by disrupting the 88

99 outline of leaf surfaces, mimicking the dappled light environment of the forest floor (Givnish 1990; Cuthill et al. 2005). Additionally, a number of succulent plant taxa in the Mesembryanthemaceae (Aizoaceae) such as Argyroderma spp., Cheiridopsis spp., Lithops spp., and Pleiospilos spp. are thought to possesses morphology and coloration that protectively mimic stones found in the arid deserts of their South African habitat (Wickler 1968; Weins 1978). Many of these taxa possess heavily modified, desiccation resistant leaves that photosynthesize by allowing light to enter through opaque tissue or windows on the leaf surface, while additionally deterring foraging rodents through shape and coloration that resemble the rocky substrate (Brown et al. 1991; Schmiedel & Jürgens 1999; Ellis et al. 2006; Ellis et al. 2007). Despite striking morphological similarities between plant structures and substrates, claims of cryptic mimicry in plants remain anecdotal to this point. Without empirical data supporting hypotheses of cryptic mimicry in these or like systems, subsequent claims of this defense strategy in plants is likely to be met with some skepticism (Everard & Morley 1970). A system that is ideal for experimentally addressing questions of plant cryptic mimicry is myco-heterotrophy, defined as plants that acquire carbon resources from associated mycorrhizal fungi (Leake 1994). Unlike green plants that require specialized photosynthetic pigmentation (chlorophyll a and b, carotene, xanthophyll, and phaeophytin), these non-photosynthetic, heterotrophic plants are open to a world of evolutionary possibilities in coloration, much like animals. Recent studies concerning myco-heterotrophic plants have focused on selective pressures leading to a non-photosynthetic life style and the successive convergent evolution of morphologically reduced and highly modified reproductive stems and plant structures (Olson 1990; Leake 1994; Leake et al. 2004; Bidartondo 2005; Julou et al. 2005; Tedersoo et al. 2007). Some species of the Monotropoideae (Ericaceae) such as Pterospora andromeda and Monotropa 89

100 hypopitys possess bright red or yellow reproductive stems, bracts, and flowers that may function to deter herbivores through aposmatic coloration (Lev-Yadun 2001; Rubino & McCarthy 2004) and/or act as pollinator attractants (Wallace 1977; Klooster pers. obs). Other taxa such as Monotropa uniflora and Monotropastrum glabosum are mostly or completely devoid of pigmentation and may attract foraging bees as pollinators through the use of UV reflectance (Wallace 1977; Ushimaru & Imamura 2002; Klooster pers. obs.). In contrast, a close relative of these Monotropoid taxa, Monotropsis odorata, is notoriously difficult to visually locate in the wild primarily because of its small stature and exceptional inconspicuous coloration (Wolf 1922; Copeland 1939; Wallace 1975; Leake 1994). Like related species, the reproductive stems of M. odorata possess vibrantly colored, pinkish-purple flowers and deep-purple stems. However, these structures are uniquely concealed and rendered indiscernible by a dense covering of brown, scarious bracts, making reproductive stems appear morphologically similar to the dry deciduous and pine leaf substrate under which they grow (Wolf 1922; Wallace 1975; Olson 1994). In this system, leaf-like bracts are uniquely comprised of vegetative tissue and sepals that die, dry, and turn brown during early reproductive stem development (Wallace 1975; M. Klooster pers. obs.) and can be easily removed without causing direct damage to underlying viable reproductive structures. The goal of this study was to empirically determine if cryptic mimicry functions as a defense strategy for herbivore avoidance in M. odorata, reducing the frequency of herbivory and subsequently increasing plant fitness. We employed both field manipulations and the novel use of reflectance spectrometry, as used in several investigations addressing animal crypsis (e.g. Church et al. 1998; Stuart-Fox et al. 2004; Thery 2007), to address each of the following questions: 1) Are plants, from which bracts have been removed, significantly more likely to suffer increased frequency of herbivory and 90

101 reduced reproductive output than plants with intact bracts? 2) Do bracts covering the reproductive stems and flowers of M. odorata reflect light in the same visual spectrum as the ambient leaf litter found in their natural environment? 3) Do stem and floral tissues concealed by the brown bracts exhibit contrasting coloration and brightness rendering them more conspicuous than bracts against an ambient leaf litter? In conjunction with answering these questions, the reproductive ecology of Monotropsis odorata was examined in detail for the first time to understand the relationship between life history traits and the use of cryptic mimicry as an effective defense strategy. Materials and methods Study system Observations conducted from were used to identify the following stages of Monotropsis odorata reproductive phenology and various components of the reproductive ecology of this taxon (M. Klooster & T. Culley, in prep). Reproductive stems of M. odorata emerge from the soil in mid fall (September October). Each plant produces one to many lavender reproductive stems cm in height, covered with numerous fleshy lavender bracts, and possessing an average of 5-6 buds (ranging from 1 18 flowers per stem) encased in a whorl of lavender sepals. Stems and buds develop to three quarters maturity over the course of the fall season and arrest development with the onset of winter and cold temperatures. Over the course of the winter months, the bracts and sepals (henceforth referred to collectively as bracts) become scarious and turn brown in coloration (with no apparent abscission zone), encasing the fleshy, dark purplish-black reproductive stems and pink flower buds. In early March, when daytime high temperatures reach o C, buds resume development and floral parts reach 91

102 maturity over the subsequent 4 6 weeks. By early to mid April, floral development is complete and anthesis takes place, though typically no more than 2 3 mm of each corolla will emerge through the whorl of dry bracts. Flowers are highly fragrant (somewhat like baking cloves) and pinkish to purple in color, usually with a white band at the apex of the corolla. Pollinator observations and tented treatments revealed that flowers are herkogamous, self-incompatible, and Bombus pollinated for approximately two weeks post anthesis (M. Klooster & T. Culley, in prep). Bombus spp. appear to use the strong floral fragrance to locate clumps of receptive reproductive stems; even those stems covered by dense leaf litter, and indiscernible to the naked human eye, were observed to elicit visitations. Additionally, the presence of bracts and the downwardly arching shape of the reproductive structures likely render any exposed floral tissue indiscernible to an organism foraging from above the flowers. The small white band on the corolla, protruding from the dried calyx, reflects in the UV spectrum and may function as a visual cue for fine scale localization of copious nectar and pollen once fragrance has attracted floral visitors to the area. After fertilization, the petals senesce and fruit set ensues over 8 10 weeks with developing fruits remaining encased in whorls of dry petals and sepals. Fruits are white or pink berries that break through the corolla and, upon over-ripening, turn brown and are pungently fragrant like rotten cheese. Fragrant fruits attract and are consumed by woodland rodents and/or woodland birds, and seeds are animal dispersed. Monotropsis odorata is susceptible to herbivory for approximately weeks, from the initial emergence of reproductive stems in the fall to mature fruit set the following summer. A large population of M. odorata was located along the Appalachian Mountain range in Cherokee National Forest, TN in 2005 at 535 m (N , W ). Because this rare species is myco-heterotrophic and cannot be removed from the soil without damaging the 92

103 necessary mycorrhizal connections, an individual plant was defined as an isolated clump of reproductive stems, located at least 1 meter from the next neighboring clump. Each plant was marked with a semi-permanent flag in spring Detailed analyses of flowering phenology, pollination, seasonal reproductive output, and herbivory were conducted over three years from , with the current study taking place in early March through May of 2006 and Field manipulations To assess the role that cryptic bracts may play in herbivore avoidance, plants were randomly selected in early March of 2005 and 2006, once floral development resumed and just prior to herbivore activity. A total of plants that each possessed 3-12 reproductive stems were randomly selected and assigned to either a control group (n = 45 plants in 2006, n = 25 plants in 2007) or to an experimental group (n = 45 plants in 2006, n = 25 plants in 2007). In the experimental group, all dry, sterile bracts were carefully removed from all stems of each plant using needle nose forceps and surgical scissors to reveal the viable flower petals and stem tissue underneath (Fig. 1). Due to inconsistent seasonal reproductive output, it was not possible to maintain equal sample sizes across seasons or to use the same plants in replicate treatments. Sample size limitations and plant rarity also restricted the implementation of an additional treatment group consisting of stems where bracts could be left intact but painted a conspicuous color to match that of the petals and stem. To assess the possibility that the bracts could serve a dual role as camouflage and insulation, the control and experimental groups were monitored each month to determine if early abortion of flowers resulted from desiccation. Herbivory data were collected at two periods each season for both groups, from resumption of floral development to anthesis (March 5 th early April) and from post-anthesis to pre-fruit maturation (mid-april 93

104 June 6 th ), which allowed us to determine when herbivory rates peak each season. Once the final herbivory survey was conducted in June, reproductive stems in the control and experimental groups were harvested and returned to the lab. Fruits on each sampled reproductive stem were assessed using a dissecting microscope and were placed into one of the following three categories: maturing fruit, aborted ovary/fruit, damaged via herbivory. Mature fruits were used as a measure of successful reproductive output, which allowed us to infer reproductive fitness impacts associated with herbivory. Aborted ovary/fruit and herbivory categories were used to quantify unsuccessful reproductive attempts. Preliminary observations conducted in 2005 revealed that nectar robbing (small chew holes at the base of petals, adjacent to nectaries), floral herbivory (consumption of flower sex parts), and stem herbivory (consumption of part of the stem or severing the stem from its roots) typically resulted in floral abortion and reduced overall plant fitness. Therefore, the herbivory category included all forms of floral or stem predation that resulted in floral/fruit abortion. Since plants in the control and experimental groups had variable numbers of flowers per reproductive stem and reproductive stems per plant, ratios of maturing, aborted, and predated flowers were calculated per plant to standardize the data. The JMP software package (version 5.1.2, SAS Institute Inc.) was used to conduct all statistical analyses. Calculated ratios violated the assumptions of standard parametric tests including homogeneity of variances and a normal distribution, despite the use of multiple data transformations. Consequently, all data were analyzed using nonparametric statistics. Kruskal- Wallace tests were used to determine significant differences in herbivory ratios between experimental and control groups within each year. This test was also used to determine significant differences between years for experimental and control group herbivory ratios. To 94

105 determine if a trend in herbivory type could be observed across both seasons, the proportion of predated flowers falling into each herbivory category (floral herbivory, nectar robbing, and stem herbivory) was calculated for the control and experimental groups. To determine if plants with bractless reproductive stems were more likely to suffer fitness costs associated with herbivory than unmanipulated plants (with intact bracts), a Kruskal- Wallace test was used to compare mature fruit ratios of intact and bractless stems. Across year comparisons within experimental groups and control groups, respectively, were also conducted using this statistic. Finally, to determine if the physical act of bract removal had a negative impact on plant fitness and increased abortion rates (possibly due to decreased pollinator attraction and/or desiccation), all reproductive stems in the control and experimental groups that experienced any form of herbivory were removed from the data set. Ratios of mature fruits were then recalculated for the control and experimental groups using the remaining, intact stems. A Kruskal-Wallace test was used to determine if there was a significant difference in ratios of mature fruits produced in the experimental and control groups within each year. Reflectance measurements Reflectance analyses were conducted using freshly harvested dry bracts/sepals and fleshy petals and stem tissue of M. odorata to determine if reproductive stems are distinguishable in the visual spectrum from a dry leaf litter background. In April 2005, during M. odorata peak blooming period, 50 dry leaf litter samples representing eight different indigenous tree species (Quercus pinus, Q. rubra, Q. marilandica, Q. coccinea, Q. alba, Q. velutina, Acer rubrum, Pinus virginiana) were randomly collected from the bases of multiple M. odorata reproductive stems. 95

106 In April 2005, 43 reproductive stems from different plants of M. odorata were also randomly sampled in Cherokee National Forest, TN. Twenty-three additional reproductive stems, one from each of 23 different plants, were sampled at peak bloom from Daniel Boone National Forest, KY in April To maintain freshness, field samples were refrigerated (4 o C) directly after being removed from the field and for no longer than 48 h prior to conducting analyses. Reflectance data were recorded from all leaf samples and M. odorata reproductive stem parts using a reflectance probe (Ocean Optics R400-7) connected to a full spectrum UV/VIS, deuterium/halogen lamp (DT-1000), an Ocean Optics USB2000 spectrophotometer and a notebook computer running the OOIBase32 software program (Ocean Optics, Inc.). Prior to sampling, a Whiteport Optolon 2 matte reflectance standard (> 97% reflectance from , ANCAL, Inc.) was used and set in scope mode to a maximum count of 3500 units. Additionally, electric dark current was removed, a dark sample was taken, and spectrum averaging was set to three samples. All reflectance measurements were performed in a dark room on a black matte surface, maintaining a 5 mm distance between each sample and the probe. Field samples were removed from refrigeration and brought up to room temperature (~21 o C) immediately prior to analysis. For each leaf litter sample, three reflectance measurements were taken from the top and bottom of the leaf respectively (6 total measurements per leaf). These data were then averaged to produce one mean reflectance value per leaf. Three dry sterile bracts/sepals were selected for reflectance analysis from each reproductive stem sampled in 2005 and Additionally, two reflectance measurements were taken from flower petals and the stem respectively for each sample collected in Multiple measurements recorded from sterile bracts/sepals, stem and flower petals were then averaged to obtain a single mean reflectance value for each structure per reproductive stem sampled. 96

107 Reflectance data analyses Reflectance spectra of plants and their natural backgrounds are defined as the distribution of light reflected from a sample over a defined range of wavelengths with respect to a virtually perfect reflector (i.e., a white standard). Hue (e.g. red, green, blue) is defined by the shape of the spectral curve, particularly its dominant wavelength. Chroma, a color s saturation, is a function of the magnitude of the dominant wavelength slope. Brightness refers to a spectrum s total intensity, as measured as the area under the spectral curve (e.g. Endler, 1990). Intensity contrast refers to intensity differences between plant and leaf litter background spectra. Color segments and color space We used Endler s (1990) segment classification method as a means of classifying plant color reflectance patterns and comparing these data to the leaf litter backgrounds found in the habitat. This technique is an unbiased method that presumes only the presence of a typical opponency system of color vision and compares the outputs of receptors sensitive to nonadjacent portions of the visible spectrum. This method is superior to more subjective analyses (e.g. human ranking systems, Munsell color chips) that are often used in the assessment of animal coloration (see Grill and Rush 1999). The segment classification method is useful because it provides a graphical summary of differences in hue and chroma among spectra. Furthermore, color contrast refers to differences between plant parts and leaf litter background spectra that are independent of intensity and can be examined statistically as Euclidian distances. To calculate these distances, values at 20 nm increments from nm were extracted from the spectral samples, creating a distribution of 20 values. These 20 values were then partitioned into four 80 nm color segments; 97

108 corresponding roughly to the (I.) ultraviolet range ( nm) and the human-perceived color ranges of (II.) blue to green ( nm), (III.) green to orange ( nm), and (IV.) orange to red ( nm). Values within each color segment were summed, producing one value per segment, and then each of the four values was divided by the sum of the entire spectrum, resulting in four linear values that represent the relative intensity of each color segment. By subtracting non-opposing pairs of these values (i.e. III. minus I., IV. minus II.), two color scores that summarize each spectrum were plotted as a single point in two-dimensional color space. Hue is determined by the angle of a color score relative to the top-center of the graph, and chroma increases with the distance of a color score from the origin. The greater the distance a color score for a plant part falls from the region of color space occupied by leaf litter, the greater the color contrast and the more conspicuous that plant part should appear irrespective of the visual system viewing it. A one way ANOVA was used to test for differences among distribution means represented as individual color contrast values, with unorthogonal planned contrasts used for post hoc comparisons. Brightness contrast Brightness contrast between a plant part and leaf litter was calculated as the difference between the reflectance spectrum of a plant part and the overall mean leaf litter reflectance value, divided by the sum of the same two quantities. This operation produces a symmetrical index between 1 and -1, where plant parts that are lighter than the background have positive values, and parts that are darker than the background have negative values. Subsequently, a one way ANOVA was used to test for differences among distribution means represented as individual brightness contrast values, with unorthogonal planned contrasts used for post hoc comparisons. 98

109 Results Floral herbivory The control and experimental groups both exhibited herbivory across both years. However, reproductive stems of the experimental group had higher mean overall herbivory rates in 2005 and 2006 (36% and 37% respectively), compared to the mean control group values of 9% (Kruskal Wallace test; Z = 4.49, P < ) and 17% (Z = -2.49, P = ) (Fig. 2). When comparing the same groups across seasons, there was no significant difference in mean herbivory rates within the control group (Z = 0.11, P = ) or the experimental group (Z = , df = 1, P = ). In both groups in both years, 55 85% of herbivory occurred prior to anthesis (March 5 th - early April) with an average of only 23% herbivory occurring post-anthesis but before fruit maturation (mid-april June 6 th ). All three types of herbivory were observed each year, with floral herbivory (FH) followed by stem herbivory (SH) accounting for the highest relative proportion of flower loss (Fig. 2). In 2006, FH accounted for vast majority of flower loss but this trend shifted with SH increasing in frequency in 2007 and accounting for the highest percentage of flower loss in the control group. SH typically resulted in the abortion of all flowers on a reproductive stem, unlike the other types of herbivory that resulted in the loss of individually targeted flowers on a stem. Nectar robbing (NR) was observed as the lowest frequency of herbivory type, remaining negligible across control groups but increasing dramatically from 2006 to 2007 in the experimental groups. Reproductive fitness Plants in the control group produced a higher percentage of mature fruits than the experimental group in both years, leading to a higher overall reproductive output in the control 99

110 groups (Fig. 3). In 2006, the control group produced a significantly higher percentage of mature fruits with a mean of 55%, compared to 35% in the experimental group (Z = 2.89, P = ). The same trend for fruit set was observed for 2007 with a slightly lower control group (45%) than the experimental group (38%). However, due to high levels of variance and a dramatic increase in frequency of control group stem herbivory, the difference between groups was not significant in 2007 (Z = 0.41, P = ). To determine if a fitness cost was associated with the manipulation of bract removal, reproductive stems that experienced any type of herbivory in the control and experimental groups were removed from the analysis. Ratios of mature fruits were then recalculated for each plant, with no significant difference between the ratios of mature fruits produced on herbivoryfree control and experimental reproductive stems in 2006 (means of 56% and 49% respectively; Z = -0.78, P = ) or 2007 (means of 56% and 52% respectively; Z = 0.077, P = ). These data demonstrate that the mere absence of bracts does not account for the differences in fruit set observed. Reflectance analyses The mean petal, bract, and reproductive stem reflectance values produced distinctive wavelengths, each with a unique brightness and chroma (Fig. 4). Bract values had greater brightness and chroma than stems and petals and were nearly identical to mean leaf litter in percent reflectance across wavelengths. The deep purplish-black coloration of the reproductive stem was characterized as a mostly flat spectrum, whereas the petals showed an increase in chroma and brightness between nm, due to the presence of reddish pigmentation. To further visualize and quantify reflectance differences between reproductive structures and leaf litter, the segment classification method was used to plot values in color space (Fig. 5). 100

111 Color scores for stems and petals occupied independent color space and were also the greatest distance from the region occupied by leaf litter values, indicating distinct color contrasts among structures. Bract color scores fell among the values for leaf litter in color space showing very little to negligible differences in color contrast between these structures. Petal color scores were at the greatest angle from the origin of the graph and therefore have the greatest hue, followed by litter and bracts. Bract and litter values were the greatest distance from the origin and have the highest chroma relative to petals and stems. Stem values produced the least chroma and hue of all structures analyzed. Differences among plant parts (petal, stem and bracts) and litter color scores were further examined for color contrast (Euclidian distance; Fig. 6) and brightness contrast (intensity contrast; Fig. 7) using separate one way ANOVAs with unorthogonal planned contrasts. ANOVA analyses revealed significant differences in color contrast (F 3,161 = , P < ) and brightness contrast (F 3,161 = , P < ). Further analyses using post hoc tests revealed that bracts and litter were not significantly different for color contrast (P = 0.347) or for brightness contrast (P < ), but petals and stems differed significantly from leaf litter (P < ) in both analyses. Discussion Cryptic mimicry is a well-documented defense adaptation in animals, functioning to increase individual fitness by reducing attacks from visually guided predators (e.g. Wickler 1968; Weins 1978; Endler 1981; Pastuer 1982). Although cryptic mimicry has also been proposed as a possible defense adaptation in plants (e.g. Barlow & Weins 1977; Givinish 1990; Brown et al. 1991), these anecdotal reports lack functional data and consequently such claims have been met with some skepticism. In this study we have empirically shown, for the first time, 101

112 that cryptic mimicry functions as a plant defense adaptation for herbivore avoidance in the mycoheterotroph, Monotropsis odorata. This species is of particular interest among plants due to its non-photosynthetic life history, which renders the plant free of many constraints in coloration (Leake 1994; Bidartondo 2005). Furthermore, the morphology of this species offered us the ability to experimentally manipulate the appearance and color of reproductive stems without adding artificial compounds. We therefore studied reproductive stems of M. odorata through the novel approach of reflectance spectrophotometry and field manipulations to experimentally determine if cryptic mimicry functions as an effective plant defense strategy. Results show that bracts play a significant role in M. odorata defense by cryptically mimicking leaf litter and concealing conspicuously colored floral and stem tissues, thereby reducing the frequency of herbivore attacks and increasing plant fitness. Studies have shown that herbivory plays a substantial role in reducing fitness in most plant systems (Hawkes & Sullivan 2001), and has functioned as a strong selective force driving the evolution of a wide variety of plant defense adaptations (e.g., Atsatt & O Dowd 1976; Pastuer 1982; Gómez & Zamora 2002; Becerra 2007). Results from this study demonstrate that herbivores can substantially reduce the fitness of M. odorata plants. However, the presence of mimetic bracts significantly decreased the frequency of herbivore attacks when compared to plants from which bracts had experimentally been removed. These results support our initial hypothesis that scarious bracts are a highly adaptive trait for herbivore defense in this system. The use of reflectance spectrophotometry in animal studies has shown that prey exhibiting coloration most similar to the substrate on which they live are less visually discernible to predators, thereby increasing prey fitness (Church et al. 1998; Stuart-Fox et al. 2004; Théry 2007). Our findings support the hypotheses that bracts mimic dry leaf litter in coloration and 102

113 brightness and that petals and stems are more discernable than bracts against a leaf litter background. Subsequently, reproductive stems and flowers covered by bracts are less likely to contrast with leaf litter both in color and brightness, potentially rendering these structures less conspicuous to visually guided herbivores. Unlike other closely related Monotropoid myco-heterotrophs, M. odorata is the only species that produces the unique trait of bracts that dry early in reproductive development. Additionally, the duration of reproductive development and phenology of M. odorata is nearly four times that of other closely related myco-heterotrophs (Wallace 1975; M. Klooster & T. Culley, in prep), rendering reproductive stems highly vulnerable to herbivore attack for up to 36 consecutive weeks. Because M. odorata exhibits a lengthy reproductive cycle and is restricted to a narrow range of endemism by an obligatory reliance upon a mycorrhizal symbiont, it is likely that this taxon has evolved the novel defense adaptation of cryptic bracts due to strong selective pressures imposed by locally abundant herbivores. The distinctive reproductive developmental cycle of reaching three quarters maturity in the early fall and finalizing development during the following spring may be a high-risk strategy that allows M. odorata to gain exclusive access to available pollinators early, while spring ephemerals are still emerging (e.g., Schemske et al. 1978). However, a cost to this strategy exists because reproductive stems are more susceptible to herbivore attacks during this resource-poor portion of the season, when few other palatable plants are accessible for herbivores (Hawkes & Sullivan 2001). The marked decrease in postanthesis/pre-fruit maturation herbivory likely correlates with an increase in the diversity and availability of herbivore resources as spring ephemerals emerge, in addition to the decrease in palatability of M. odorata as stems dry. 103

114 The significant reduction in mature fruit production associated with the absence of bracts in our experimental group, supported our hypothesis that bracts play a role in increasing plant reproductive output and fitness. By removing bracts, more discernable floral and stem tissue was exposed to foraging herbivores and an associated increase in herbivory frequency was observed. This increase in herbivory for plants lacking bracts resulted in an overall decrease in the proportion of viable flowers per plant relative to the control. Consequently, fewer flowers were available for successful fertilization, resulting in a decline in mature fruit set, a component of plant fitness. Additionally, to ensure that the difference in fruit production observed between groups was not solely attributable to the manipulation of bract removal, all stems suffering any types of herbivory were removed from the analysis and the data were reanalyzed. Recalculated fruit ratios in the remaining herbivory-free stems demonstrated that the manipulation of bract removal does not play a significant role in mature fruit production. Furthermore, these results do not support a possible alternative hypothesis that bracts play a significant role in preventing flower desiccation because herbivory, not floral abortion due to dessication, was the only significant ecological factor that appeared to contribute to flower loss. Although specific herbivores were not targeted as part of this study, shifts in the types and frequency of herbivory observed in control and experimental groups indicted that numerous functional groups of herbivores impact this system. Additionally, many field observations further demonstrate that unmanipulated M. odorata reproductive stems are a palatable food source for a diverse array of animal taxa. For example, ants were observed on numerous occasions, removing ovules from a hole in the ovary wall of damaged flowers. Rodent and turkey feces were found scattered among hundreds of predated flowers and reproductive stems from plants in , with flowers and stems showing signs of damage from large 104

115 herbivores. Additionally, lepidopteran larvae were observed to occasionally target reproductive stems, sometimes boring into a stem and selectively targeting the ovary of each flower. Finally, carpenter bees, grasshoppers and numerous other insect taxa functioned as nectar robbers and floral herbivores throughout the three year study (M. Klooster, pers. obs.) An intriguing dichotomy present in this system is the obligatory reliance of M. odorata upon animal pollinators and seed dispersal agents, yet the presence of a cryptic morphology and coloration for herbivore avoidance. It might be assumed that a defense mechanism that functions to conceal a prey item from predatory animals may also function to confound animals that provide a beneficial service. We hypothesize that pollinators and fruit/seed dispersal agents are primarily attracted to flowers and fruits of M. odorata by strong fragrance cues and not primarily by visual cues. Additionally, numerous observations of pollinating Bombus spp. localizing and visiting M. odorata reproductive stems that were entirely concealed by dense layers of leaf litter, offer support for this hypothesis. However, future research concerning herbivore visual systems, chemo-sensory cues, and the fragrance preferences of animals responsible for pollen and seed dispersal will be useful in further addressing this question. This research offers support for cryptic mimicry as a plausible defense adaptation in plant systems. In previous studies addressing crypsis in select South African succulents (Mesembryanthemaceae [Brown et al. 1991; Schmiedel & Jürgens 1999; Ellis et al. 2006; Ellis et al. 2007]) and Australian mistletoes (Loranthaceae [Wickler 1968; Barlow & Weins 1977; Weins 1978; Ehleringer et al. 1986; Bannister 1988; Canyon & Hill 1997]), coloration and morphology were suggested (but not experimentally tested) to mimic an unpalatable object in the environment that renders the plants difficult to discern against ambient substrates. Through the pioneering use of reflectance spectrophotometry and ecological field manipulations to study the 105

116 myco-heterotrophic plant M. odorata, we are now able to offer empirical support for this scenario. Despite the distant phylogenetic relationship between animals and plants, results from this study suggest that the strong selective pressures exerted by predators have perpetuated convergence by some plant and animal taxa upon the shared, effective defense strategy of cryptic mimicry. Acknowledgements We extend thanks to D. Boone, J. Decker, M. Dodson, J. Gibson, M. Pistrang and V. Soukup for assistance with locating populations and field manipulations. We are also grateful to D. Conover, S. Dunford, E. Maurer, R. Olson, V. Soukup and members of the Culley Lab for advice on this project and members of the Clark Lab for assistance with reflectance measurements and data analyses. C. Davis, M. Bidartondo, and J. Macedonia offered critical advice on this manuscript. Permission to conduct this research was granted by Cherokee N.F. and Daniel Boone N.F. Funding used to conduct this research was made possible through the University Research Council Fellowship and the Weiman, Wendel, Benedict Award offered by the University of Cincinnati. References Atsatt, P.R. and O Dowd, D.J Plant defense guilds. Science 193: Bannister, P Nitrogen concentration and mimicry in some New Zealand mistletoes. Oecologia 79(1): Barlow, B.A., and Wiens, D Host-parasite resemblance in Australian mistletoes: the case for cryptic mimicry. Evolution 31:

117 Becerra, J.X The impact of herbivore-plant coevolution on plant community structure. PNAS 104: Bidartondo, M.I The evolutionary ecology of myco-heterotrophy. New Phytologist (Tansley Review) 167: Brown, V.K., Lawton, J.H., and Grubb, P.J Herbivory and the evolution of leaf size and shape (and discussion). Philosophical Transactions: Biological Sciences 333: Campitelli, B.E., Simonsen, A.K., Wolf, A.R., Manson, J.S., and Stinchcombe, J.R Leaf shape variation and herbivore consumption and performance: a case study with Ipomoea hederacea and three generalists. Arthropod-Plant Interactions doi: /s x. Canyon, D.V. and Hill, C.J Mistletoe host-resemblance: A study of herbivory, nitrogen and moisture in two Australian mistletoes and their host trees. Austral Ecology 22(4): Church, S.C., Bennett, A.T.D., Cuthill, I.C., Hunt, S., Hart, N.S., and Partridge, J.C Does lepidopteran larval crypsis extend into the ultraviolet? Naturwissenschaften 85: Cuthill, I., Stevens, M., Sheppard, J., Maddocks, T., Parraga, C., and Troscianko, T Disruptive coloration and background pattern matching. Nature 434: Ehleringer, J.R., Ullmann, I., Lange, O.L., Farquhar, G.D., Cowan, I.R., Schulze, D., and Ziegler, H Mistletoes: a hypothesis concerning morphological and chemical avoidance of herbivory. Oecologia 70(2): Ellis, A.G., Weis, A.E., and Gaut, B.S Evolutionary radiation of stone plants in the genus Argyroderma (Aizoaceae): Unraveling the effects of landscape, habitat, and flowering time. Evolution 60(1):

118 Ellis, A.G., Weis, A.E., and Gaut, B.S Spatial scale local adaptation and population genetic structure in a miniature succulent, Argyroderma pearsonii. New Phytologist 174(4): Endler, J.A An overview of the relationship between mimicry and crypsis. Biological Journal of the Linnean Society 16: Endler, J.A Progressive background matching in moths, and a quantitative measure of crypsis. Biological Journal of the Linnean Society 22: Endler, J.A On the measurement and classification of colour in studies of animal colour patterns. Biological Journal of the Linnean Society 41: Endler, J.A Disruptive and cryptic coloration. Proceedings of the Royal Society Everard, B. and Morley, B.D Wild flowers of the world. London: Ebury Press & Michael Joseph. Fleishman, L.J Cryptic movement in the vine snake Oxybelis aeneus. Copeia 1: Givinish, T.J Leaf mottling: relation to growth form and leaf phenology and possible role as camouflage. Functional Ecology 4: Gómez, J.M. and Zamora, R Thorns as induced mechanical defense in a long-lived shrub (Hormathophylla spinosa, Cruciferae). Ecology 83: Grill, C.P. and Rush, V.N Analyzing spectral data: comparison and application of two techniques. Biological Journal of the Linnean Society 69: Hawkes, C.V. and Sullivan, J.J The impact of herbivory on plants in different resource conditions: A meta-analysis. Ecology 82: Julou, T., Burghardt, B., Gebauer, G., Berveiller, D., Damesin, C., Selosse, M.A Mixotrophy in orchids: insight from a comparative study of green individuals and 108

119 nonphotosynthetic individuals of Cephalanthera damasonium. New Pytologist 166(2): Klooster, M.R. and Culley, T.M. (In prep). Comparative analysis of the reproductive ecology of Monotropa and Monotropsis: Two myco-heterotrophic genera in the Monotropoideae (Ericaceae). Leake, J.R Tansley Review No. 69. The biology of myco-heterotrophic ( saprophytic ) plants. New Phytologist 127: Leake, J.R., McKendrick, S.L., Bidartondo, M., and Read, D.J Symbiotic germination and development of the myco-heterotroph Monotropa hypopitys in nature and its requirement for locally distributed Tricholoma spp. New Phytologist. 163(2): Lev-Yadun, S Aposmatic (warning) coloration associated with thorns in higher plants. Journal of Theoretical Biology 210: Main, K.L Predator Avoidance in Seagrass Meadows: Prey Behavior, Microhabitat Selection, and Cryptic Coloration. Ecology 68: Olson, A.R Observations on the floral shoots of Monotropa hypopitys (Monotropaceae). Rhodora 92: Olson, A.R Pollen tube pathway through the gynoecium of Monotropsis odorata (Monotropaceae). American Journal of Botany 81: Pasteur, G A classification review of mimicry systems. Annual Review of Ecology and Systematics 13: Pietrewicz, A.T., and Kamil, T.D Search images and the detection of cryptic prey: an operant approach. Pages in Kamil and Sargent

120 Rohner, C. and Ward, D Chemical and mechanical defense against herbivory in two sympatric species of desert Acacia. Journal of Vegetation Science 8: Rubino, D.L., and McCarthy, B.C Presence of aposematic (warning) coloration in vascular plants of southeastern Ohio. Journal of the Torrey Botanical Society 131(3): Schemske, D.W., Willson, M.F., Melampy, M.N., Miller, L.J., Verner, L., Schemske, K.M., and Best, L.B Flowering ecology of some spring woodland herbs. Ecology 59: Schmiedel, U. and Jürgens, N Community structure on unusual habitat islands: quartzfields in the Succulent Karoo, South Africa. Plant Ecology 142: Stuart-Fox, D.M., Moussalli, A., Johnston, G.R., and Owens, I.P.F Evolution of color variation in dragon lizards: Quantitative tests of role of crypsis and local adaptation. Evolution 58(7): Tedersoo, L., Pellet, P., Kõljab, U., and Selosse, M.A Parallel evolutionary paths to mycoheterotrophy in understorey Ericaceae and Orchidaceae: ecological evidence for mixotrophy in Pyroleae. Oecologia 151(2): Théry, M Colours of background reflected light and of the prey s eye affect adaptive coloration in female crab spiders. Animal Behaviour 73: Ushimary, A. and Imamura, A Large variation in flower size of the myco-heterotrophic plant, Monotropastrum globosum: effect of floral display on female reproductive success. Plant Species Biology 17: Wallace, G.D Studies of the Monotropoideae (Ericaceae): Taxonomy and distribution. The Wasmann Journal of Biology 33:

121 Wallace, G.D Studies of the Monotropoideae (Ericaceae). Floral nectaries: anatomy and function in pollination ecology. American Journal of Botany 64: Wickler, W Mimicry in Plants and Animals. (Translated from German by R.D. Martin) McGraw-Hill Book Company, New York, pp Weins, D Mimicry in plants. Evolutionary Biology 11: Williams, K.S. and Gilbert, L.E Insects as selective agents on plant vegetative morphology: egg mimicry reduces egg laying by butterflies. Science 212: Wolf, W Notes on Alabama plants. A new Monotropoid plant. American Midland Naturalist. 8:

122 Figure Legends Figure 1. Cryptic reproductive stems of Monotropsis odorata (a) with intact bracts and (b) with bracts experimentally removed. Figure 2. Mean frequency of predated flowers for control and experimental groups subdivided by time increments of pre-anthesis herbivory (March early April) and post-anthesis herbivory (mid-april June) (with + s.e.m for overall predated flowers), with relative proportions of flower loss by herbivory type (FH = floral herbivory, SH = stem herbivory, NR = nectar robbing). Predated flower ratios were calculated as the number of flowers per stem suffering herbivory divided by the total number of flowers on that stem. These values were then compared between groups by year and again by similar groups across years using Kruskal-Wallace tests with letters representing significance (P <0.05). Figure 3. Mean frequency of mature fruits (with + s.e.m) for control and experimental groups. Frequencies of mature fruits (defined as fruits possessing mature seed) were calculated as the number of mature fruits per stem divided by the total number of flowers on that stem. These values were then compared between groups by year and again by similar groups across years using Kruskal-Wallace tests. Letters indicate significant differences (P <0.01). Figure 4. Mean reflectance spectra of petals, stems, and bracts from M. odorata collected during anthesis, and mean dry leaf litter collected from the base of reproductive stems (representing eight indigenous tree species). Grey lines extending above and below spectra represent ± s.e.m.

123 Figure 5. Reflectance color scores of petals, stems, bracts, and leaf litter, plotted in Endler s (1990) color space. Open symbols represent raw color score values and filled symbols represent mean color scores. Figure 6. Color contrast (mean Euclidian distances + s.e.m.) among petals, stems, bracts, and leaf litter color scores when compared to the mean leaf litter color score (as represented by the filled blue diamond in Fig. 3). Statistical results are from an ANOVA using unorthogonol planned contrasts with letters indicating significance (P < ). Figure 7. Brightness contrast (mean intensity contrasts + s.e.m.) among petals, stems, bracts, and leaf litter calculated as the difference between the reflectance spectrum of a plant part and the mean leaf litter reflectance divided by the sum of the same two quantities. Statistical results are from an ANOVA using unorthoganol planned contrasts with letters indicating significance (P < ). 113

124 Figure 1 a b 114