Title: Bile Acids Function Synergistically to Repress Invasion Gene Expression in

Transcription

1 IAI Accepted Manuscript Posted Online 16 May 2016 Infect. Immun. doi: /iai Copyright 2016, American Society for Microbiology. All Rights Reserved Title: Bile Acids Function Synergistically to Repress Invasion Gene Expression in Salmonella by Destabilizing the Invasion Regulator HilD Running Title: Bile Destabilizes HilD Authors: Colleen R. Eade a#, Chien-Che Hung a, Brian Bullard b, Geoffrey Gonzalez- Escobedo b, John S. Gunn b, Craig Altier a Affiliations: a Department of Population Medicine and Diagnostic Sciences, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853, USA b Center for Microbial Interface Biology, Department of Microbial Infection and Immunity, The Ohio State University, Columbus, OH 43210, USA # Address correspondence to: Colleen R. Eade, Cornell University College of Veterinary Medicine, Ithaca, NY 14853, USA cre43@cornell.edu; Telephone: (607) ; Fax: (607) Abstract word count- 249 Text word count- Keywords: Invasion, Salmonella Pathogenicity Island 1, Bile, Deoxycholate, Synergy 1

2 ABSTRACT Salmonella spp. are carried by and can acutely infect agricultural animals and humans. After ingestion, Salmonellae traverse the upper digestive tract and initiate tissue invasion of the distal ileum, a virulence process carried out by the type-three secretion system encoded within Salmonella Pathogenicity Island 1 (SPI-1). Salmonellae coordinate SPI-1 expression with anatomical location via environmental cues, one of which is bile, a complex digestive fluid that exhibits potent repression of SPI-1 genes. The individual components of bile responsible for SPI-1 repression have not been previously characterized, nor have been the bacterial signaling processes that modulate their effects. Here we characterize the mechanism by which bile represses SPI-1 expression. Individual bile acids exhibit repressive activity on SPI-1 regulated genes that requires neither passive diffusion nor OmpF-mediated entry. Using genetic methods, the effects of bile and bile acids were shown to require the invasion gene transcriptional activator hild and function independently of known upstream signaling pathways. Protein analysis techniques showed that SPI-1 repression by bile acids is mediated by post-translational destabilization of HilD. Finally, we demonstrated that bile acids function synergistically to achieve the overall repressive activity of bile. These studies demonstrate a common mechanism by which diverse environmental cues (e.g. certain short chain fatty acids and bile acids) inhibit SPI-1 expression. These data provide information relevant to Salmonella pathogenesis during acute infection in the intestine and during chronic infection of the gallbladder, and inform the basis for development of therapeutics to inhibit invasion as a means of repressing Salmonella pathogenicity. 2

3 INTRODUCTION In the animal host, Salmonella invades the intestinal epithelium as part of its pathogenic process (1). Invasion requires the type three secretion system (TTSS) encoded by genes of Salmonella Pathogenicity Island 1 (SPI-1). Once ingested, SPI-1 induction must be properly synchronized to optimize invasion, and the regulation of SPI- 1 in vivo is influenced by environmental factors (2, 3). These factors are thought to provide anatomical cues to Salmonella, such that compounds found in the distal ileum (e.g. formate and acetate) increase SPI-1 expression (4, 5), whereas compounds from the upper and lower intestinal tract (e.g. bile and butyrate/propionate, respectively) repress invasion gene expression (6-8). While the regulatory cascades responsible for communicating these signals are unknown, a number of characterized pathways integrate into a complex regulatory system that controls SPI-1 expression (Supplemental Figure S1A). These include the transcription factors FliZ, HilC and RtsA, which have each been demonstrated to positively regulate invasion gene expression by promoting expression of the SPI-1 regulator hild (9, 10). Additionally, the two-component regulatory systems EnvZ/OmpR and BarA/SirA positively regulate SPI-1 (11-13). Regulation by the latter system is achieved by induction of the small RNAs csrb and csrc, which titrate CsrA protein from the hild transcript to prevent CsrAmediated destabilization of the hild mrna (13). Posttranslational regulators of invasion gene expression have also been identified. These include HilE, which binds to HilD and sequesters it from target promoters, and Lon protease, which degrades HilD protein (14, 15). 3

4 Importantly, these regulators all converge at HilD, which induces SPI-1 genes encoding the secreted effectors and structural components of the TTSS by directly activating their transcription, and indirectly through induction of the downstream transcriptional activator HilA (9, 16). Our previous work has shown that certain short chain fatty acids (SCFAs) (e.g. propionate) that are present in the large intestine repress invasion gene expression by posttranslational destabilization and Lon-mediated proteolysis of HilD (6). Yet degradation of HilD is not necessary to repress HilD activity, as SCFAs continue to inhibit SPI-1 expression in a lon mutant (6). This suggests that certain SCFAs repress HilD-mediated SPI-1 activation by a dual-faceted mechanism: first, by inactivating HilD protein, and second, by concomitant destabilization of HilD protein and degradation by Lon. Like select SCFAs, bile has also been shown to act as an environmental signal that represses SPI-1 expression (17, 18). Bile is a potent detergent that aids in emulsification of nutritional lipids and fat-soluble vitamins (19, 20). Composed primarily of water, bilirubin, fats and bile acids, bile is produced in the liver, where hepatocytes synthesize two primary bile acids in humans: cholate and chenodeoxycholate (19). These bile acids undergo subsequent modification, mediated by both the host and microbial inhabitants, as they pass through the intestinal tract. First, bile acids may be modified in the liver by N-acyl amidation to append taurine or glycine at the C24 position, yielding the conjugated bile salts (19). The resulting pool of bile acid variants is stored in the gallbladder, until hormone release during digestion prompts the release of bile into the duodenum. High bile acid concentrations (up to 2%) are maintained in the duodenum, jejunum, and proximal ileum (21, 22). In the ileum and colon, 95% of 4

5 bile acids are recovered by the host and returned to the liver. This enterohepatic circulation replenishes the bile acid pool (19, 23). At the same time, microbial inhabitants of the ileum and colon initiate another molecular modification: 7- dehydroxylation. The removal of the C7 hydroxyl group, a highly efficient process performed by resident genera, including Clostridia, converts cholate to deoxycholate, a secondary bile acid (24, 25). These secondary bile acids are also recovered via enterohepatic circulation and returned to the gallbladder to be released in the duodenum upon gallbladder contraction. This cycle results in a gradient of bile acids with the potential to impose intricate control on Salmonella invasion. Thus, to define the effects of bile acids on Salmonella gene regulation, we characterized individual bile acids for their effects on SPI-1 gene expression, and investigated implications of bile acid synergy that result from enterohepatic circulation. We demonstrate that the effects of bile on invasion are mediated via the SPI-1 transcriptional regulator HilD, and, similar to SCFAs, bile acids affect HilD by posttranslational destabilization of HilD protein. We further show that synergistic activity between specific bile acids contributes to the potency of bile. These studies thus demonstrate a common intracellular mechanism by which Salmonella integrates diverse environmental cues to optimize pathogenicity. MATERIALS AND METHODS Bacterial Strains and Reagents All experiments were performed using Salmonella enterica subspecies enterica serovar Typhimurium 14028s (hereafter Salmonella Typhimurium) unless otherwise noted. All strains used are described in Table 1. Ox bile extract (sodium choleate) and 5

6 bile salt products were purchased from Sigma Aldrich, and were dissolved in water prior to use. Concentrations reported are given as weight per volume. β-galactosidase Assays Salmonella was inoculated into LB buffered with 100 mm MOPS ph 6.7 or 100 mm HEPES ph 8.0 with added treatments. Cultures were incubated at 37 C without aeration for 16.5 hr, then β-galactosidase expression was quantified by the method of Miller using the equation: Miller Unit = (OD 420 *1000)/(OD 600 *T*V) where T is the time the assay reaction proceeded before adding stop solution, and V is the volume of culture assayed in microliters (28). For conditions containing deoxycholate at ph 6.7, culture density was determined by serial dilution and colony forming unit (cfu) enumeration rather than OD 600 measurement and normalized to the corresponding vehicle condition. For cultures containing 3% bile, we found that the absorbance of bile alone altered our OD 600 readings of bacterial density. To correct this problem, we generated a standard curve by resuspending equal amounts of bacteria in LB media with or without 3% bile across a range of densities. An equation was generated to convert the OD 600 reading in bile-containing media to the corresponding reading in plain media (Supplemental Figure 2). This equation was used to adjust all OD 600 measurements made in 3% bile. Lux Reporter Assay To monitor SPI-1 expression, a reporter strain containing the plasmid psopb::luxcdabe (derived from prg61, a gift from Brain Ahmer) was grown overnight in minimal media, then centrifuged and resuspended at OD 600 = in LB media with 20 µg/ml tetracycline (to maintain plasmid selection) and 100 mm MOPS ph 6.7 or 100 mm HEPES ph 8.0. This resuspension was combined with an equal volume of 6

7 appropriate 2X treatment prepared in the same media compositions, and 50 µl aliquots of culture were transferred to replicate wells of a 384-well black-walled clear-bottom plate. Luminescence and OD 600 were measured every 30 min for 16 hours on a Biotek Synergy H1 reader. OD 600 measurements in 3% bile were corrected as previously described. Real Time Quantitative PCR Salmonella were cultured at 37 C without aeration for 16.5 hr in LB buffered with 100 mm MOPS ph 6.7, with or without 3% bile added. One ml of culture was centrifuged, washed once in PBS, and resuspended in 500 µl water (one volume). To this, a half volume of lysis buffer (2% SDS, 16mM EDTA, 200mM NaCl) was added, and samples were boiled for 5 minutes to lyse. One volume of acid phenol/chloroform was added to the lysate, and samples were incubated at 65 C for 10 min with periodic vortexing. Samples were separated on Phase Lock heavy Gel Tubes, then the aqueous phase was extracted a second time with one volume of chloroform/isoamyl alcohol. 700 µl of the aqueous layer was precipitated by the addition of 2 ml ethanol, 70 µl 3M sodium acetate ph 5.2 and 70 µl 100 mm EDTA at -80 C. Precipitated nucleic acid was centrifuged to pellet, then washed in 70% ethanol. After resuspending extract and measuring OD260/280, equivalent amounts of nucleic acid were treated with Turbo DNase (Ambion), followed by enzyme inactivation, then reverse transcribed using Superscript II (Thermo Fisher). Resulting cdna was analyzed by qpcr using Bio- Rad s iq or itaq SybrGreen Supermix. The ΔΔCt method was used to calculate relative expression of sopb (primers: AACCTTATACAACGGAATGC and 7

8 CGCCTTCTGATGCTGTAG) to housekeeping gene dnan (primers: GAGATTGCCGTTCAGTTG and TGCCAGTCGTCAAGATTC). Deoxycholate Solubility Assay To quantitate deoxycholate solubility, deoxycholate with or without other bile acids was added to LB buffered with 100 mm MOPS ph 6.7, and was serially diluted in the same medium. The samples were allowed to stand for 30 min at ambient temperature before OD 600 was measured on a Biotek Synergy H2 plate reader. Readings were corrected by background subtraction of media control-well readings. Transposon Mutagenesis To generate a recipient strain, the plasmid pnk2880 (encoding the transposase gene) was introduced by electroporation into a Salmonella strain (JSG2471) containing a sopb::lacz reporter fusion. The donor strain (TH3923) was a S. Typhimurium LT2 derivative strain carrying a plasmid that encodes a tail-less mud phage harboring the T- POP (Tn10dTc[del-25]; mtn10δ25, one of the T-POP series of transposons) (29), and a P22 9 gene encoding a functional tail (gift from Dr. Kelly Hughes). TH3923 was grown to exponential phase when mitomycin C was added (4 µg/ml) and the culture was incubated at 30 C until lysis was observed (~4 hr). The culture was then lysed with chloroform, and this lysate was used to transduce the recipient strain, which was then plated onto LB plates containing 1% bile, 15 µg/ml tetracycline (to induce the T-POP tet-induced outward promoter), 10 mm EGTA and 80 µg/ml X-Gal. Approximately 28,000 transduced colonies were screened for a blue phenotype (activation of the sopb::lacz reporter fusion in the presence of bile). Blue colonies were back-transduced for phenotype verification, and then genomic DNA was isolated and sequenced using a 8

9 primer binding 42 bp from the 3 end of T-POP element and extending outward (5 CCTTTTTCCGTGATGGTA 3 ). HilD Half-life Assay HilD half-life was assessed as previously described (6, 10). Salmonella harboring chromosomally-encoded tetracycline-inducible hild with a C-terminal 3X- FLAG-tag (in place of the native hild sequence) and a hila -lacz fusion (for invasion gene assessment) was grown overnight, then diluted 1:100 into LB media buffered with 100 mm MOPS ph 6.7 with appropriate treatments. After 2.5 hours growth, samples were taken to quantitate hila -lacz expression by β-galactosidase assay. Then, individual cultures were equilibrated to OD 600 = 1 to ensure equal density of all cultures at the half-life starting point. These cultures were treated with rifampin (100 µg/ml), streptomycin (200 µg/ml), and spectinomycin (50 µg/ml), to halt gene transcription and protein translation. A sample of the culture was collected at this beginning timepoint, and then every 30 minutes for 3 hours, during which time cultures were kept at 37 C. Samples were lysed in sample buffer, boiled, and subjected to Western blotting with an anti-flag antibody to monitor HilD. Densitometry was performed to quantitate the HilD-3X-FLAG-tag signal using UVP VisionWorks LS software. Half-life was calculated from the difference between the first time point and the last time point (or the last time point at which signal could be detected) using the equation: h = (t*ln(2))/(ln(n o /N f )) where: h = half-life in minutes, t = time elapsed between measurements, N o = initial amount and N f = final amount. Statistical Analyses 9

10 In all figures, error bars indicate standard error of the mean. For statistical analysis, data were log transformed prior to parametric comparisons. To assess the suitability of transformation, residuals from transformed data points were visualized by histogram plot, and Shapiro Wilk s test was used to evaluate the normality of residuals. Transformed data were analyzed by Dunnet s method (when comparing treated conditions to an untreated control) or by ANOVA with Tukey s honest significant difference post-tests (for comparisons between multiple conditions). IC 50 values were computed from inhibition data, where the treatment concentration was plotted on a log scale. Synergistic and antagonistic effects were determined using equations for Bliss independence. RESULTS Bile and Specific Bile Acids Repress Invasion Gene Expression To confirm and further characterize the repressive effects of bile on Salmonella invasion gene expression, we tested a Salmonella Typhimurium strain carrying a chromosomal sipc::laczy reporter in the presence of bile at various concentrations. Concentrations of 3% bile and lower were chosen to approximate the range of bile concentration found in the intestine, and to allow comparison to previously published works, in which 3% bile is most often used (17, 18, 21, 30-32). This assessment was performed in media buffered to ph 6.7, similar to that of the upper intestinal tract into which bile would be secreted (19, 33). We found that bile exhibits potent repression of invasion gene expression, inhibiting sipc::laczy expression with an IC 50 (the concentration at which 50% of expression is inhibited) of 0.001% (Figure 1). We next tested individual bile acids to determine their contributions to the repressive effects of 10

11 bile. Three of the four bile acids we tested demonstrated >50% repression of sipc::laczy when applied at concentrations of <1.0%. The primary bile acid cholate, which is also the physiologically most abundant bile acid in the upper intestine (19, 34), inhibited sipc::laczy expression with an IC 50 of 0.179%. Based on its inhibitory profile, a concentration of 0.5% cholate was chosen for future experiments, as this concentration inhibited sipc expression as well as 1% treatment, while the 1% treatment slightly inhibited bacterial growth (data not shown). Furthermore, this concentration is well within the range reported for the upper intestine. Conjugated bile acids glycocholate and taurocholate were less potent; glycocholate demonstrated an IC 50 of 0.486%, while taurocholate failed to exhibit significant repression at concentrations as high as 1%. The secondary bile acid deoxycholate exhibited the most potent repression of invasion gene expression among the bile acids, with an IC 50 value of 0.003%. As this bile acid is present at 20% the concentration of cholate in the upper intestine, deoxycholate was used at 0.1% in the following experiment. To verify the inhibitory effects of bile, cholate and deoxycholate on SPI-1 expression, we assayed the expression of a sopb::luxcdabe reporter plasmid in the presence of these compounds (35). This assay, which provides temporal dynamics of sopb induction in Salmonella, demonstrated significant inhibition of sopb expression by all three treatments when applied at concentrations found in the upper intestine (Figure 2). Similar to previous reports (17, 18, 36), these results verified that the repression exhibited by bile was not unique to sipc expression but rather that it applied to invasion genes in general. Of note, in these assays deoxycholate was assayed at a higher ph than the other compounds (ph 8.0 instead of ph 6.7), necessary to maintain 11

12 deoxycholate solubility (37, 38). The implications of this altered solubility became apparent in our later assessments. Bile-mediated repression of SPI-1 transcription is not mediated by bile acid passive diffusion or OmpF/C transport We next investigated the mechanism by which bile and bile acids are sensed or imported by Salmonella. In exploring potential import mechanisms, we focused on the effects of bile and the bile acid cholate, as the latter is the most abundant primary bile acid and is readily soluble in the tested ph range. We first compared the effects of bile and cholate at ph 6.7 versus ph 8.0. In addition to the 3% bile and 0.5% cholate treatments, we also assessed the effects of bile treatment at 0.002%, a concentration near the IC 50 of bile that represents a sub-saturating treatment. At an elevated ph, the great majority of cholate in solution (having a pka of ~6.4) is expected to exist in a charged, deprotonated state, and therefore should not cross the bacterial membrane by passive diffusion (20, 39). As shown in Supplemental Figure S3, bile and cholate showed only slight attenuation of their repressive effects at an elevated ph, suggesting that passive diffusion is not required for these compounds to have their effects. We next created mutants of the outer membrane porins ompf and ompc, as these channels are implicated in bile acid import and export, respectively, in E. coli. In that organism, mutants of ompf demonstrate increased bile resistance, whereas mutants of ompc exhibit increased bile sensitivity (40). These porins have also been shown to mediate bile resistance and virulence after oral infection by Salmonella, and accordingly represent likely transport avenues for bile (41). Yet Supplemental Figure S3 shows that mutants of ompf or ompc continued to demonstrate inhibition of invasion gene 12

13 expression by bile or cholate. These mutants were also tested at a ph of 8.0 to exclude the possibility of redundant entry mechanisms by both OmpF and passive diffusion. As no condition demonstrated restored gene expression, we could not conclude that either passive diffusion or OmpF/OmpC-mediated entry/export was essential for effects of bile and cholate on invasion gene expression. HilD is Required for the Repressive Activity of Bile To determine the genetic basis for the effects of bile, we next undertook an unbiased genetic screen to identify genes involved in the repression of SPI-1 by bile. For this we created a library of mutants containing random insertions of the T-POP transposon throughout the bacterial genome. The T-POP transposon contains an outward facing promoter, and therefore has the potential to identify genes whose disruption or overexpression would circumvent the effects of bile on expression of invasion genes. Mutagenized bacteria were plated on LB agar containing 1% bile and X-gal, and screened for mutants that continued to express a chromosomal sopb::laczy reporter in the presence of bile. This concentration of bile was used as it is sufficient to achieve significant repression of invasion genes, yet also permitted adequate blue/white colony distinction. This approach yielded 30 colonies, which were subjected to sequencing to determine the insertion sites. Of these, one mutant produced poor sequence and could not be mapped with confidence. Seven mutants contained T-POP insertions that mapped to regions outside SPI-1: two insertions occurred upstream of sopb, suggesting that they directly induced expression of the sopb:laczy reporter, while another five insertions outside of SPI-1 (three of which were found to be siblings) mapped to trpb, a structural gene of the tryptophan biosynthesis machinery. 13

14 Phenotypic characterization revealed that these insertions positively upregulated sopb expression irrespective of bile treatment. Therefore, while the general mechanism by which the trp operon acts as a positive regulator of sopb remains to be determined, these mutants were not pursued further in this study. In agreement with our previous assessment of ompf/ompc mutants, no mutations in genes potentially involved in bile acid transport were identified. Furthermore, no mutations in genes homologous to bile acid processing enzymes found in other organisms were found. The remaining 22 mutants contained transposon insertions surrounding the SPI-1 transcriptional regulator hild. (Figure 3A). To confirm the involvement of HilD in bile-mediated repression of SPI-1, we assessed chromosomal sipc::laczy expression in a hild mutant (Figure 3B). Here we returned to 3% bile treatment to ensure that any inhibition that might occur would be measured. In this mutant, treatment by 3% bile caused a slight reduction in sipc::laczy expression, yet this difference was not significant, and was considerably less than the repression by bile observed in strains containing an intact copy of hild (Figure 1, Supplemental Figure 1C). As a control, we also included a ΔhilD, ΔinvF double mutant. In this strain, the deletion of invf removes a positive feedback pathway for sip expression (42, 43), and demonstrates that this assay is still capable of detecting further reduction in sipc::laczy expression. We next assessed whether the loss of known regulators of hild affected repression by bile to determine if bile acted at or above hild (Supplemental Figure S1). All mutants of known hild regulators tested, both positive (ΔhilC, ΔhilA, ΔrtsA, ΔrtsB, ΔcrsB, ΔcsrC, ΔsirA, ΔfliZ, and ΔompR) and negative 14

15 (ΔhilE, Δhha, and Δlon), had no effect on the repressive effects of bile and cholate, confirming that bile-mediated repression occurred at the level of HilD. Cholate and Bile Decrease HilD Posttranslational Stability To parse the mechanism by which bile regulates hild, we first asked whether hild expression was affected by bile acids. As shown in Supplemental Figure S4, we tested the effects of bile and cholate on the expression of a chromosomal translational fusion of hild to laczy. This construct, expressed under the control of the native hild promoter, encodes the first 296 bp of hild fused to the laczy genes. This construct includes the CsrA-binding sites located near the start codon in the hild transcript.(44) Accordingly, both promoter-mediated transcriptional and CsrA-mediated translational control of hild-laczy can be detected by this reporter. Of note, the translated chimeric HilD-LacZ protein fusion results in a nonfunctional HilD molecule. This is important as HilD is known to induce its own expression. Accordingly, treatments affecting HilD posttranslationally will not alter expression of the hild - lacz reporter. Upon treatment with bile or cholate, we observed no difference in hild - lacz expression. To demonstrate the ability of our assay to detect differences in hild translation, we also included a ΔcsrB, ΔcsrC double mutant, which decreases HilD translation due to enhanced CsrA-mediated transcript degradation. This mutant exhibited an ~3-fold reduction in hild - lacz expression, demonstrating that expression was still subject to regulation by the Csr system and that the assay was capable of detecting further reductions in reporter expression. This observation indicated that neither bile nor cholate affects hild by transcriptional regulation or by post-transcriptional, pretranslational mechanisms. 15

16 Next we investigated possible posttranslational effects of bile and its components on HilD by assessing the stability of HilD in the presence of bile or cholate using a halflife quantitation assay. Here, the expression of chromosomally-encoded hild was induced via a tetracycline-inducible promoter. This regulated induction of hild eliminates the auto-induction of hild expression by the HilD protein and thus ensures that the effects observed are not attributable to the control of hild transcription. This hild construct also contained a C-terminal 3X-FLAG-tag for protein assessment by Western blot. Cultures of this strain were grown in media containing tetracycline, with no additive, 3% bile, or cholate. An uninduced culture was also included as a control to demonstrate that the expression of hild was properly regulated by the tetracyclineinducible promoter. After 2.5 hours of growth in the appropriate media, gene transcription and protein synthesis were halted using an antibiotic cocktail, such that protein quantitation reflected the stability of existing HilD rather than ongoing protein production. HilD half-life was quantitated by immunoblotting with an anti-flag antibody over time. As seen in the otherwise wild type background, Figure 4A demonstrates a considerably reduced HilD half-life in the presence of bile or cholate. The average HilD half-life for bacteria grown in medium alone was 63 min, but was reduced to 16 min in the presence of bile, and 8 min in the presence of cholate, revealing a mechanism in which bile and bile acids represses SPI-1 gene expression and protein levels by posttranslational destabilization of HilD. The reduction in protein concentration was specific to HilD, as loading controls demonstrated equal protein content in all samples (Supplemental Figure 5). Concomitant with HilD degradation, expression of a chromosomal hila -lacz was decreased 6.8-fold in the bile-treated condition, and

17 fold in the cholate-treated condition, indicating that reduced SPI-1 expression accompanied the decreased HilD levels (Figure 4B). We have previously characterized compounds (including propionate and other SCFAs) that repress SPI-1 by posttranslational destabilization of HilD (6). Importantly, for many of these compounds HilD destabilization appears to be a consequence of prerequisite HilD inactivation. This mechanism of inactivation can be confirmed by assessing HilD activity in a mutant of lon protease. In the absence of Lon, HilD protein is not degraded, and therefore accumulates irrespective of SCFA treatments. However, some such treatments continue to repress HilD activity despite its accumulation, demonstrating a mechanism of HilD inactivation that is independent of HilD degradation. To determine the mechanism of repression exerted by bile and cholate, we interrogated HilD activity along with HilD half-life in a lon mutant. In the absence of lon, HilD protein accumulated to high levels in bacteria grown in the presence of cholate (Figure 4A). This is in agreement with the literature, which demonstrates that Lon protease degrades HilD. The calculated half-life of the protein was also dramatically increased, by fold compared to the wild type strain, to 212 minutes. This increase in protein was accompanied by an increase in the expression of a chromosomal hila lacz reporter, with the lon mutant expressing hila at a level 8.5-fold greater than the wild type when strains were grown in cholate, and only modestly reduced from that of the lon mutant grown without additive (Figure 4B). Conversely, although the half-life of HilD in the lon mutant rose greatly (17.5-fold) when grown in bile in comparison to the wild type, the amount of HilD present in this mutant remained low (Figure 4A). Coincident with this reduction in HilD protein, hila -lacz expression was potently repressed by bile (9.7-fold repression). 17

18 These results, taken together, thus indicate both that the amount of HilD present within the bacterium is key to the control of invasion by bile and its components, and that bile itself functions to regulate HilD by both lon-dependent and -independent means. Bile Acids Synergistically Repress Salmonella Invasion Gene Expression To understand how individual bile acids contribute to the potent biological repression of SPI-1, we next asked whether bile acids function synergistically to achieve the potency of bile. To address this, we mixed four bile acids according to the proportions at which they exist in commercially available bile. Figure 5 demonstrates that when assayed at a ph of 6.7 the repression exhibited by this mixture (90%), was similar to that of bile (98%). We therefore evaluated the bile acids singly, or in combination with cholate, again in the same proportions as bile. We found that glycocholate exhibited modest activity (52% repression), while taurocholate exhibited no significant repression. Yet both glychocholate and taurocholate slightly increased the repressive activity of cholate (65% alone) when applied in combination with this bile acid (87% for either combination). Deoxycholate demonstrated a moderate but significant 37% repression when supplied alone, but also exhibited potent repression in combination with cholate (98%). The repression exhibited by cholate and deoxycholate applied in combination was statistically equivalent to the mixture of all four bile acids, demonstrating that these two acids can recapitulate the activity of bile. We next asked whether the combined activity of cholate and deoxycholate resulted from the additive activity of each acid, or if instead the potency of this combination indicated synergistic interactions between the two compounds. Using assessments for Bliss independence, we determined the bile acids to function 18

19 synergistically, with the activity of the combined acids being greater than the additive activity of the individual acids (Supplemental Calculation 1) (45, 46). To evaluate the mechanism by which cholate and deoxycholate functioned synergistically, we reexamined the effect of bile acid solubility. We found that deoxycholate was poorly soluble at ph 6.7 when supplied alone, yet was maintained in solution when added in combination with cholate (Supplemental Figure S6). We hypothesized that the synergistic effects we observed for this combination may have been a result of the assisted solubility of deoxycholate by cholate and thus the improved availability to bacteria. If indeed this were the case, the combined activity of these acids would not exhibit synergism when assayed under conditions in which deoxycholate was readily soluble. When assayed at ph 8.0, a ph at which both deoxycholate and cholate are readily soluble, each exhibited significant repression when applied individually (89% and 47%, respectively), yet the repression exhibited by the combination was less than that of deoxycholate alone (73%) (Figure 5). The activity of the combined bile acids at ph 8.0 was indicative of antagonism, rather than synergy, indicating that the synergy between cholate and deoxycholate at ph 6.7 was mediated by the assisted solubility of deoxycholate (Supplemental Calculation 1). Of note, the treatment concentrations we used in this experiment were increased from prior assays in order to achieve reliable precipitation and solubilization dynamics of deoxycholate, yet these concentrations are still well within the physiologically relevant range. This mechanism is in agreement with previous biochemical analyses of deoxycholate, which demonstrate precipitation dynamics influenced by ph, micelle formation, and calcium concentration (38, 47). These reports also implicated mixed micelle formation in the maintenance of 19

20 deoxycholate solubility in the upper intestinal tract, and suggest that heterogeneous micelle formation is not specific to deoxycholate and cholate mixtures only, but instead show that other bile acids also contribute to deoxycholate solubility by forming mixed micelle complexes. Accordingly, we assessed the facilitated solubility of deoxycholate by bile acids glycocholate and taurocholate, and found that they too were capable of maintaining deoxycholate solubility (Supplemental Figure S6). These findings imply that the synergistic activity of cholate and deoxycholate at ph 6.7 (and, by extension, the potent repression of invasion genes exhibited by bile under physiological conditions) is achieved by a chemically facilitated delivery of deoxycholate by mixed bile acid micelle formation. DISCUSSION In the human host, Salmonella infection typically manifests as self-limiting gastroenteritis, but infection by some serovars of the bacterium (specifically S. Typhi) can result in typhoid fever, which poses more serious disease consequences. Additionally, S. Typhi gastrointestinal infection can facilitate gallbladder colonization and long-term carriage in 3-5% of infected individuals (48). Gallbladder carriage has been shown to be a result of biofilm formation on gallstones and the gallbladder epithelium and to increase the risk for gallbladder carcinoma (21, 49, 50). Bile enhances Salmonella biofilm formation on gallstone surfaces, implicating a bacterial response to bile that promotes persistence (51, 52). We have also shown, here and elsewhere (17, 30), that bile represses invasion gene expression in S. Typhimurium. Of interest is whether this inhibition also occurs in serovar Typhi. Salmonella Typhi and Salmonella Typhimurium both transit the intestinal epithelium in order to mediate disease, and the 20

21 invasion pathways of these serovars are conserved, as is the HilD protein (99.4% identity). Furthermore, biofilm and growth assays of both serovars in the presence of bile are similar (51). Thus, although we have not tested it, we expect this mechanism to be analogous in S. Typhi. Here we focus on the components of bile that repress the genes of Salmonella Typhimurium essential for the penetration of the intestinal epithelium. We found that three of the four bile acids we tested demonstrated repressive activity. The fourth variant, taurocholate, lacked activity at concentrations as high as 1%, which exceeds the range at which this compound is present biologically (19). Interestingly, this observation may lend insight into the mechanism by which Salmonella converts bile acids to regulatory signals. In clostridial species, prominent members of the intestinal microbiota, the bile acid-inducible (bai) genes implement bile-acid processing including import, modification and export (24). Here, modification begins with conjugation of the C24 carboxyl group to a CoA carrier molecule. Should a similar pathway exist in Salmonella, the addition of taurocholate to the C24 position would prevent such a reaction (19, 53, 54). Yet if such genes exist in Salmonella and are necessary to process bile acids as a prerequisite for SPI-1 inactivation, they were not identified by our screen, suggesting that they are either essential (and perhaps conditionally essential for growth on the bile-containing selective media) or functionally redundant (55, 56). Similarly, our random and directed mutagenesis approaches failed to identify entry mechanisms for bile acids. This suggests that if gene products do facilitate bile acid entry as a requisite for SPI-1 repression, they too are either redundant or essential. The former is especially likely considering the plethora of outer membrane proteins and 21

22 porins expressed by Salmonella with the potential to permit bile acid entry (57, 58). This is supported by the finding that exposure of Salmonella to deoxycholate is accompanied by downregulation of ompd. A potential explanation is that OmpD may facilitate deoxycholate import, and therefore the downregulation of ompd in response to bile acid exposure may represent the means by which Salmonella adapts to the presence of bile. Thus, other omp gene products may provide redundant entry pathways for bile acids to access the bacterial cytoplasm in Salmonella. Further work is required to characterize the entry and metabolism of bile acids in Salmonella. Though transposon mutagenesis failed to identify genes involved in bile acid processing, it did reveal a number of insertions within SPI-1 that conferred resistance to the effects of bile on invasion gene expression. Consistent with our data and the role of HilD in bile sensing, no insertions were identified in hild; however, these insertions occurred in various locations and orientations in SPI-1, suggesting that their effects were mediated by more than one mechanism. For T-POP insertions located upstream of hild or hila with outward facing promoters oriented in the same direction as those genes, we surmise that reporter expression is a result of direct induction of hild or hila. For insertions surrounding hila and hild yet oriented oppositely to these genes, it is likely that disruption of chromosomal architecture by the T-POP insertions imparted derepression of SPI-1, a region whose repression relies upon extensive modification of DNA topology and interactions with repressive proteins, such as Hha and H-NS. This model is well supported by our unpublished observations that insertions surrounding hild enhance invasion gene expression. 22

23 We also identified ten insertion sites that occurred in or upstream of the prg operon, with promoters oriented in the same direction as that operon. Similar to the insertions surrounding hild, these mutations possess the potential to derepress SPI-1 by altering chromosomal topology (59, 60). Yet it is also possible that these mutations enhance invasion gene expression via induction of prg/org/hilc genes. This notion is supported by previous works demonstrating that perturbation of this region can positively regulate hila expression (61)(our unpublished studies). It is unclear from our work and prior studies whether this upregulation results from activation of the hilc regulator, or if instead the poorly characterized org operon exhibits regulatory capability. In contrast to the inactivity of taurocholate, the bile acids cholate and deoxycholate were found to be the primary active components of bile with regard to invasion gene regulation. Interestingly, the intricate interplay between these bile acids may generate a gradient of varying inhibition as Salmonella traverses the host intestinal tract. Upon exiting the stomach, the bile secreted into the duodenum contains both cholate and deoxycholate (19), with the activity of the latter potentiated by the former. This provides potent repression of invasion genes in the upper intestinal tract. By the time Salmonella reaches the distal ileum, 95% of bile acids will begin to undergo active transport to be recirculated to the liver (19). Thus it is likely that bacteria in this organ will be exposed to a decreasing concentration gradient of bile acids. Not surprisingly, this is the anatomical niche at which Salmonella expresses SPI-1 genes and invades host tissue (62). For Salmonella that remain within the intestinal lumen, eventual passage through the lower intestine is accompanied by the introduction of repressive SCFAs. Here, 23

24 remaining cholate is dehydroxylated to deoxycholate by Clostridia and other bacteria (19, 23, 63). This is likely to reduce invasion gene repression for two reasons: first, the conversion of soluble cholate to the less soluble deoxycholate would create an obvious shift toward precipitation (19); and second, as we have shown here, elimination of other bile acids from the environment would preclude the synergistic solubility they impart upon deoxycholate. Such delivery-based mechanisms of synergy are well characterized in the drug development field, where facilitated delivery formulations are widespread (64). Indeed, it is commonplace to employ cholate for micelle-based delivery of hydrophobic drugs (65, 66). However, in contrast to the intentional formulation of cholate-based delivery formulations, the interaction we observed here is unique in that it contributes to a naturally occurring solubility switch. The observed solubility of bile in the gallbladder and documented precipitation of deoxycholate in the lower intestinal tract demonstrates that our observations are likely to represent a physiologically important switch in the intestinal environment. It is thus tempting to speculate that the loss of intestinal bacteria (including 7-α-dehydroxylating Clostridia) might prevent the conversion of cholate to deoxycholate, reducing the repression of invasion in the upper intestinal tract (67). It is indeed widely known that mice treated with streptomycin are more susceptible to infection with Salmonella due to the ablation of the native microbiota (68). This is thought to emanate from an elimination of competitors for intestinal nutrients, and to a loss of SCFA production, which are known to repress Salmonella invasion in the lower intestine. It remains plausible, however, that the elimination of native microbiota prevents conversion of cholate to the more potent deoxycholate, which would also enhance Salmonella virulence. Oppositely, 24

25 Salmonella infection in the presence of the native microbiota is subject to invasion regulation by both SCFAs and bile. Our inquiry into the mechanism by which bile acids inhibit SPI-1 demonstrated that repression is achieved primarily by destabilizing the HilD protein. Our results suggest that the repressive activity of cholate is achieved primarily by Lon-mediated degradation of HilD, whereas complex bile causes destabilization of HilD even in a mutant of lon, implicating additional proteases in the degradation of HilD. Of note, it seems unlikely that the increased degradation of HilD is mediated by changes in protease expression or activity, as the expression of lon is not increased by bile treatment (18). Further, our work did not demonstrate generalized degradation of bacterial proteins upon bile treatment (Supplemental Figure 5), suggesting that the enhanced degradation of HilD is specific, and is mediated by changes in HilD rather than protease activity. It is unknown whether this mechanism is mediated by direct interaction between HilD and bile acids, or if instead the destabilization of HilD is mediated by regulatory intermediaries. Further, though no pathways have been identified to metabolize bile acids in Salmonella, it is possible that SPI-1 repression is effected by a product of bile acid processing, rather than bile acids themselves. Taken together, these studies reveal a common regulatory event mediated in response to diverse anatomical environments. These studies also lend insight into the complex mechanisms by which Salmonella utilizes molecular cues to optimize invasion, and accordingly provide apt avenues for usurping endogenous bacterial signaling pathways to prevent carriage and pathogenicity in the animal host. ACKNOWLEDGEMENTS 25

26 The authors would like to thank Lynn Johnson for her assistance with statistical analysis REFERENCES 1. Tsolis, R. M., Adams, L. G., Ficht, T. A., Baumler, A. J Contribution of Salmonella typhimurium virulence factors to diarrheal disease in calves. Infect Immun. 67: Ellermeier, J. R., Slauch, J. M Adaptation to the host environment: regulation of the SPI1 type III secretion system in Salmonella enterica serovar Typhimurium. Curr Opin Microbiol. 10: Altier, C Genetic and environmental control of salmonella invasion. J Microbiol. 43 Spec No: Lawhon, S. D., Maurer, R., Suyemoto, M., Altier, C Intestinal short-chain fatty acids alter Salmonella typhimurium invasion gene expression and virulence through BarA/SirA. Mol Microbiol. 46: Huang, Y., Suyemoto, M., Garner, C. D., Cicconi, K. M., Altier, C Formate acts as a diffusible signal to induce Salmonella invasion. J Bacteriol. 190: Hung, C. C., Garner, C. D., Slauch, J. M., Dwyer, Z. W., Lawhon, S. D., Frye, J. G., McClelland, M., Ahmer, B. M., Altier, C The Intestinal Fatty Acid Propionate Inhibits Salmonella Invasion through the Post-translational Control of HilD. Mol Microbiol. 87: Durant, J. A., Corrier, D. E., Ricke, S. C Short-chain volatile fatty acids modulate the expression of the hila and invf genes of Salmonella typhimurium. J Food Prot. 63: Gantois, I., Ducatelle, R., Pasmans, F., Haesebrouck, F., Hautefort, I., Thompson, A., Hinton, J. C., Van Immerseel, F Butyrate specifically down-regulates salmonella pathogenicity island 1 gene expression. Appl Environ Microbiol. 72: Ellermeier, C. D., Ellermeier, J. R., Slauch, J. M HilD, HilC and RtsA constitute a feed forward loop that controls expression of the SPI1 type three secretion system regulator hila in Salmonella enterica serovar Typhimurium. Mol Microbiol. 57: Chubiz, J. E., Golubeva, Y. A., Lin, D., Miller, L. D., Slauch, J. M FliZ regulates expression of the Salmonella pathogenicity island 1 invasion locus by controlling HilD protein activity in Salmonella enterica serovar typhimurium. J Bacteriol. 192: Lucas, R. L., Lostroh, C. P., DiRusso, C. C., Spector, M. P., Wanner, B. L., Lee, C. A Multiple factors independently regulate hila and invasion gene expression in Salmonella enterica serovar typhimurium. J Bacteriol. 182: Altier, C., Suyemoto, M., Ruiz, A. I., Burnham, K. D., Maurer, R Characterization of two novel regulatory genes affecting Salmonella invasion gene expression. Mol Microbiol. 35: Altier, C., Suyemoto, M., Lawhon, S. D Regulation of Salmonella enterica serovar typhimurium invasion genes by csra. Infect Immun. 68: Baxter, M. A., Fahlen, T. F., Wilson, R. L., Jones, B. D HilE interacts with HilD and negatively regulates hila transcription and expression of the Salmonella enterica serovar Typhimurium invasive phenotype. Infect Immun. 71:

27 Takaya, A., Kubota, Y., Isogai, E., Yamamoto, T Degradation of the HilC and HilD regulator proteins by ATP-dependent Lon protease leads to downregulation of Salmonella pathogenicity island 1 gene expression. Mol Microbiol. 55: Akbar, S., Schechter, L. M., Lostroh, C. P., Lee, C. A AraC/XylS family members, HilD and HilC, directly activate virulence gene expression independently of HilA in Salmonella typhimurium. Mol Microbol. 47: Prouty, A. M., Gunn, J. S Salmonella enterica serovar typhimurium invasion is repressed in the presence of bile. Infect Immun. 68: Kroger, C., Colgan, A., Srikumar, S., Handler, K., Sivasankaran, S. K., Hammarlof, D. L., Canals, R., Grissom, J. E., Conway, T., Hokamp, K., Hinton, J. C An infection-relevant transcriptomic compendium for Salmonella enterica Serovar Typhimurium. Cell Host Microbe. 14: Ridlon, J. M., Kang, D. J., Hylemon, P. B Bile salt biotransformations by human intestinal bacteria. J Lipid Res. 47: Philipp, B Bacterial degradation of bile salts. Appl Microbiol Biotechnol. 89: Gunn, J. S Mechanisms of bacterial resistance and response to bile. Microbes Infect. 2: Tsai, M. H., Wu, S. R., Lee, H. Y., Chen, C. L., Lin, T. Y., Huang, Y. C., Chiu, C. H Recognition of mechanisms involved in bile resistance important to halting antimicrobial resistance in nontyphoidal Salmonella. Int J Antimicrob Agents. 40: Hirano, S., Nakama, R., Tamaki, M., Masuda, N., Oda, H Isolation and characterization of thirteen intestinal microorganisms capable of 7 alpha-dehydroxylating bile acids. Appl Environ Microbiol. 41: Ridlon, J. M., Hylemon, P. B Identification and characterization of two bile acid coenzyme A transferases from Clostridium scindens, a bile acid 7alpha-dehydroxylating intestinal bacterium. J Lipid Res. 53: Masuda, N., Oda, H., Hirano, S., Masuda, M., Tanaka, H alpha-dehydroxylation of bile acids by resting cells of a Eubacterium lentum-like intestinal anaerobe, strain c- 25. Appl Environ Microbiol. 47: Bajaj, V., Lucas, R. L., Hwang, C., Lee, C. A Co-ordinate regulation of Salmonella typhimurium invasion genes by environmental and regulatory factors is mediated by control of hila expression. Molecular Microbiology. 22: Fortune, D. R., Suyemoto, M., Altier, C Identification of CsrC and characterization of its role in epithelial cell invasion in Salmonella enterica serovar Typhimurium. Infect Immun. 74: Miller, J. H Experiments in Molecular Genetics. Cold Spring Harbor, New York. 29. Rappleye, C. A., Roth, J. R A Tn10 derivative (T-POP) for isolation of insertions with conditional (tetracycline-dependent) phenotypes. Journal of Bacteriol. 179: Prouty, A. M., Brodsky, I. E., Manos, J., Belas, R., Falkow, S., Gunn, J. S Transcriptional regulation of Salmonella enterica serovar Typhimurium genes by bile. FEMS Immunol Med Microbiol. 41: Crawford, R. W., Gibson, D. L., Kay, W. W., Gunn, J. S Identification of a bileinduced exopolysaccharide required for Salmonella biofilm formation on gallstone surfaces. Infect Immun. 76: Prouty, A. M., Brodsky, I. E., Falkow, S., Gunn, J. S Bile-salt-mediated induction of antimicrobial and bile resistance in Salmonella typhimurium. Microbiology. 150: Perez de la Cruz Moreno, M., Oth, M., Deferme, S., Lammert, F., Tack, J., Dressman, J., Augustijns, P Characterization of fasted-state human intestinal fluids collected from duodenum and jejunum. J Pharm Pharmacol. 58:

28 Service, S.-A. T Personal Communication. 35. Teplitski, M., Goodier, R. I., Ahmer, B. M. M Pathways Leading from BarA/SirA to Motility and Virulence Gene Expression in Salmonella. Journal of Bacteriology. 185: Antunes, L. C., Wang, M., Andersen, S. K., Ferreira, R. B., Kappelhoff, R., Han, J., Borchers, C. H., Finlay, B. B Repression of Salmonella enterica phop expression by small molecules from physiological bile. J Bacteriol. 194: Bril, C., Van Der Horst, D. J., Poort, S. R., Thomas, J. B Fractionation of spinach chloroplasts with sodium deoxycholate. Biochim Biophys Acta. 172: Hofmann, A. F., Mysels, K. J Bile acid solubility and precipitation in vitro and in vivo the role of conjugation, ph, and Ca2 ions. J of Lipid Res. 33: Hills, A. G ph and the Henderson-Hasselbalch equation. Am J Med. 55: Thanassi, D. G., Cheng, L. W., Nikaido, H Active efflux of bile salts by Escherichia coli. J Bacteriol. 179: Chatfield, S. N., Dorman, C. J., Hayward, C., Dougan, G Role of ompr-dependent genes in Salmonella typhimurium virulence: mutants deficient in both ompc and ompf are attenuated in vivo. Infect Immun. 59: De Keersmaecker, S. C., Marchal, K., Verhoeven, T. L., Engelen, K., Vanderleyden, J., Detweiler, C. S Microarray analysis and motif detection reveal new targets of the Salmonella enterica serovar Typhimurium HilA regulatory protein, including hila itself. J Bacteriol. 187: Darwin, K. H., Miller, V. L InvF is required for expression of genes encoding proteins secreted by the SPI1 type III secretion apparatus in Salmonella typhimurium. Journal of Bacteriology. 181: Martinez, L. C., Yakhnin, H., Camacho, M. I., Georgellis, D., Babitzke, P., Puente, J. L., Bustamante, V. H Integration of a complex regulatory cascade involving the SirA/BarA and Csr global regulatory systems that controls expression of the Salmonella SPI-1 and SPI-2 virulence regulons through HilD. Mol Microbiol. 80: Zhao, W., Sachsenmeier, K., Zhang, L., Sult, E., Hollingsworth, R. E., Yang, H A New Bliss Independence Model to Analyze Drug Combination Data. J Biomol Screen. 19: Greco, W. R., Bravo, G., Parsons, J. C The Search for Synergy: A Critical Review Response Surface Perspective. Pharmacol Rev. 47: Lichtenberg, D., Younis, N., Bor, A., Kushnir, T., Shefi, M., S., A., S., N On the solubility of calcium deoxycholate kinetics of precipitation and the effect of conjugated bile salts and lecithin. Chem Phys Lipids. 46: Levine, M. M., Black, R. E., Lanata, C Precise Estimation of the Numbers of Chronic Carriers of Salmonella typhi in Santiago, Chile, an Endemic Area. J Infect Dis. 146: Scanu, T., Spaapen, R. M., Bakker, J. M., Pratap, C. B., Wu, L. E., Hofland, I., Broeks, A., Shukla, V. K., Kumar, M., Janssen, H., Song, J. Y., Neefjes-Borst, E. A., te Riele, H., Holden, D. W., Nath, G., Neefjes, J Salmonella Manipulation of Host Signaling Pathways Provokes Cellular Transformation Associated with Gallbladder Carcinoma. Cell Host Microbe. 17: Gonzalez-Escobedo, G., La Perle, K. M., Gunn, J. S Histopathological analysis of Salmonella chronic carriage in the mouse hepatopancreatobiliary system. PLoS One. 8:e Gonzalez-Escobedo, G., Gunn, J. S Identification of Salmonella enterica serovar Typhimurium genes regulated during biofilm formation on cholesterol gallstone surfaces. Infect Immun. 81:

29 Prouty, A. M., Gunn, J. S Comparative analysis of Salmonella enterica serovar Typhimurium biofilm formation on gallstones and on glass. Infect Immun. 71: Mallonee, D. H., Adams, J. L., Hylemon, P. B The Bile Acid-Inducible baib Gene from Eubacterium sp. Strain VPI Encodes a Bile Acid-Coenzyme A Ligase. J Bacteriol. 174: Batta, A. K., Salen, G., Arora, R., Shefer, S., Batta, M., Person, A Side Chain Conjugation Prevents Bacterial 7-Dehydroxylation of Bile Acids. J Biol Chem. 265: Khatiwara, A., Jiang, T., Sung, S. S., Dawoud, T., Kim, J. N., Bhattacharya, D., Kim, H. B., Ricke, S. C., Kwon, Y. M Genome scanning for conditionally essential genes in Salmonella enterica Serotype Typhimurium. Appl Environ Microbiol. 78: Langridge, G. C., Phan, M. D., Turner, D. J., Perkins, T. T., Parts, L., Haase, J., Charles, I., Maskell, D. J., Peters, S. E., Dougan, G., Wain, J., Parkhill, J., Turner, A. K Simultaneous assay of every Salmonella Typhi gene using one million transposon mutants. Genome Res. 19: Chooneea, D., Karlsson, R., Encheva, V., Arnold, C., Appleton, H., Shah, H Elucidation of the outer membrane proteome of Salmonella enterica serovar Typhimurium utilising a lipid-based protein immobilization technique. BMC Microbiol. 10: Futoma-Koloch, B., Bugla-Ploskonska, G., Doroszkiewicz, W Isolation of outer membrane proteins (OMP) from Salmonella cells using zwitterionic detergent and their separation by two-dimensional electrophoresis (2-DE). Pol J Microbiol. 58: Olekhnovich, I. N., Kadner, R. J Role of nucleoid-associated proteins Hha and H- NS in expression of Salmonella enterica activators HilD, HilC, and RtsA required for cell invasion. J Bacteriol. 189: Prajapat, M. K., Saini, S Interplay between Fur and HNS in controlling virulence gene expression in Salmonella typhimurium. Comput Biol Med. 42: Fahlen, T. F., Mathur, N., Jones, B. D Identification and characterization of mutants with increased expression of hila, the invasion gene transcriptional activator of Salmonella typhimurium. FEMS Immunol Med Microbiol. 28: Carter, P. B., Collins, F. M The route of enteric infection in normal mice. J Exp Med. 139: Doerner, K. C., Takamine, F., LaVoie, C. P., Mallonee, D. H., Hylemon, P. B Assessment of fecal bacteria with bile acid 7 alpha-dehydroxylating activity for the presence of bai-like genes. Appl EnvironMicrobiol. 63: Jia, J., Zhu, F., Ma, X., Cao, Z., Li, Y., Chen, Y. Z Mechanisms of drug combinations: interaction and network perspectives. Nat Rev Drug Discov. 8: Mooranian, A., Negrulj, R., Mathavan, S., Martinez, J., Sciarretta, J., Chen-Tan, N., Mukkur, T. K., Mikov, M., Lalic-Popovic, M., Stojancevic, M., Golocorbin-Kon, S., Al-Salami, H An advanced microencapsulated system: a platform for optimized oral delivery of antidiabetic drug-bile acid formulations. Pharm Dev Technol Shao, Z., Mitra, A. K Nasal membrane and intracellular protein and enzyme release by bile salts and bile salt-fatty acid mixed micelles: correlation with facilitated drug transport. Pharml Res. 9: Buffie, C. G., Bucci, V., Stein, R. R., McKenney, P. T., Ling, L., Gobourne, A., No, D., Liu, H., Kinnebrew, M., Viale, A., Littmann, E., van den Brink, M. R., Jenq, R. R., Taur, Y., Sander, C., Cross, J. R., Toussaint, N. C., Xavier, J. B., Pamer, E. G Precision microbiome reconstitution restores bile acid mediated resistance to Clostridium difficile. Nature. 517:

30 Garner, C. D., Antonopoulos, D. A., Wagner, B., Duhamel, G. E., Keresztes, I., Ross, D. A., Young, V. B., Altier, C Perturbation of the small intestine microbial ecology by streptomycin alters pathology in a Salmonella enterica serovar typhimurium murine model of infection. Infect Immun. 77: FIGURE LEGENDS Figure 1. Invasion Gene Expression Is Repressed by Bile and by Individual Bile Acids. Salmonella were grown with indicated concentration of bile or individual bile acids in media buffered with HEPES ph 8.0 (for deoxycholate) or MOPS ph 6.7 (all others). Invasion gene expression was monitored by a sipc::laczy chromosomal reporter. Reporter expression was determined by β-galactosidase assay. The data are compiled from multiple (n=3-7) experimental repeats. Asterisks indicated a significant difference (p<0.05) from the untreated condition. Graph insets depict structures of corresponding bile acids. Figure 2. Bile and Bile Acids Repress Invasion Gene Induction Over Time. Salmonella containing a plasmid-borne sopb::luxcdabe reporter were grown with the indicated concentration of bile or bile acids in media buffered to ph 8.0 (for deoxycholate) or MOPS ph 6.7 (all others). Expression of sopb::luxcdabe was determined by luminescent measurement, while culture density was monitored by OD 600 reading. Normalized luminescence is the luminescent signal divided by the OD 600. Asterisks, shown in the key, indicate treatments for which significant inhibition (compared to vehicle treatment, p<0.05) of normalized luminescence is observed for any time point. The data are compiled from multiple (n=4) experimental repeats. 30

31 Figure 3. hild is Required for Bile to Repress Invasion Gene Expression. (A) Map of transposon insertions imparting resistance to repression of sopb::lacz by bile. Grey arrows represent the open reading frames of indicated genes, and black arrow heads represent the location of identified T-Pop insertions, pointing in the orientation of the outward facing promoter. Numbers above or below the arrowheads indicate the number of insertions at that location. The relative sizes of the represented genes are drawn to scale. (B) A ΔhilD mutant strain carrying a sipc::laczy reporter was grown with 3% bile or vehicle. As a control, a ΔhilD, ΔinvF double mutant was assayed in vehiclecontaining media for comparison. Reporter expression was determined by β- galactosidase assay. The data are compiled from multiple (n=3-4) experimental repeats. Asterisk indicates a significant difference (p<0.05) from the untreated ΔhilD condition. Figure 4. Bile and Cholate Affect HilD Posttranslational Stability and Activity. A Salmonella strain containing a tetracycline-inducible hild-3xflag construct and a hila - lacz reporter was grown to log phase in 3% bile, 0.5% cholate or vehicle. During this growth, hild expression was induced with 1 µg/ml tetracycline, except in the No Tet control. For comparison, the same strain with a Δlon mutation was treated in parallel. (A) Transcription and translation were halted by an antibiotic cocktail, and protein halflife was assessed by western blotting for HilD-3XFLAG over time. Half-life values are averaged from two independent experiments; blots from one of these experiments are shown. (B) Upon addition of antibiotics, invasion gene expression was assessed by the hila -lacz reporter. Reporter expression was determined by β-galactosidase assay. The 31

32 data are compiled from multiple (n=5-18) experimental repeats. Asterisks indicate a significant difference (p<0.05) from the vehicle treated condition Figure 5. Bile Acids Function Synergistically to Repress Invasion Gene Expression. Salmonella carrying a sipc::laczy reporter was grown with a mixture of four bile acids that recapitulates the composition of bile (Mixed Acids). For comparison, separate cultures were grown in an equivalent concentration of bile, or in bile acid combinations at the indicated concentrations, corresponding to the concentration at which they were provided in the Mixed Acid treatment. All cultures were buffered with MOPS ph 6.7 (A) or HEPES ph 8.0 (B). Reporter expression was determined by β- galactosidase assay. The data are compiled from multiple (n=3-6) experimental repeats. Asterisks indicated a significant difference (p<0.05) from the untreated condition, except where brackets denote other comparisons. 32

33 Designation Genotype Reference CA412 sipc::laczy (26) CA2289 psopb::luxcdabe (6) JSG2471 sopb::lacz This study CA3127 sipc::laczy, ΔompC::cam This study CA3128 sipc::laczy, ΔompF::cam This study CA1983 sipc::laczy, ΔhilD::cam (6) CA1984 sipc::laczy, ΔhilC::kan This study CA3568 sipc::laczy, ΔrtsA This study CA921 sipc::laczy, ΔsirA::tet::cam (5) CA2122 sipc::laczy, ΔfliZ::kan (6) CA2615 sipc::laczy, ΔompR This study CA749 sipc::laczy, ΔhilE::Tn5 (6) CA2294 sipc::laczy, Δlon::kan (6) CA32 WT 14028s ATCC RM6373 ΔhilA339::kan (12) CA1959 ΔhilC::kan (6) CA1661 ΔhilD::cam This study CA747 ΔhilE::Tn5 This study CA1524 ΔcsrB::kan (12) CA1000 ΔcsrC::cam (27) CA2922 ΔrtsB::kan This study CA1696 Δhha::kan This study CA2293 Δlon::kan This study CA3018 ΔrtsA::kan This study CA773 ΔsirA::tet::cam (12) CA1854 ΔfliZ::kan (6) CA2614 ΔompR This study JS893 hild'_'lacz (6) CA1976 hild'_'lacz, ΔcsrB, ΔcsrC This study JS1180 tetra-hild-3-flag, attλ::pdx1::hila'_lacz (6) CA2790 tetra-hild-3-flag, attλ::pdx1::hila'_lacz, Δlon::kan (6) Table 1. Strains Used in this Study. All strains were constructed in the 14028s background.

34

35

36

37