In silico analysis of the NBS protein family in Ectocarpus siliculosus

Size: px
Start display at page:

Download "In silico analysis of the NBS protein family in Ectocarpus siliculosus"

Transcription

1 Indian Journal of Biotechnology Vol 12, January 2013, pp In silico analysis of the NBS protein family in Ectocarpus siliculosus Niaz Mahmood 1 * and Mahdi Muhammad Moosa 1,2 1 Molecular Biology Laboratory, Department of Biochemistry and Molecular Biology, University of Dhaka Ramna, Dhaka 1000, Bangladesh 2 Graduate Program in Biological Sciences, The Scripps Research Institute, North Torrey Pines Road La Jolla, California 92037, USA Nucleotide-binding site (NBS) domain containing proteins belong to one of the most well characterized family of proteins; they are found in almost all higher eukaryotes. Extensive studies have been done on the plant NBS proteins, but similar studies on the brown algae NBS proteins are not available. In the present study, authors examined the diversity of NBS proteins in model brown algae, Ectocarpus siliculosus. A total of twenty six NBS proteins were identified and classified into different subfamilies based on their distinct domain organizations. Although many characteristics of the protein family are similar to those of plant species, several features are quite distinct. One such characteristic is the presence of tetratrico peptide repeat (TPR) motifs at the C-terminal ends of these proteins. Another interesting finding is the presence of two E. siliculosus specific conserved motifs leading to novel combination of the NBS domain. The remarkable structural diversity found among these proteins further strengthens the idea that diversifying selection may have played an important role in their evolution. Keywords: Brown algae, Ectocarpus siliculosus, NBS, TPR Introduction Nucleotide-binding site (NBS) containing proteins have been identified to play a vital role in defense mechanisms in a wide range of species, from humans to plants 1. In metazoans, proteins containing this domain, like the human APAF-1 (apoptotic protease activating factor 1) and Caenorhabditis elegans CED- 4 (cell death 4), are involved in regulating programmed cell death 2. In plants, this domain is found in disease resistant NBS-LRRs (nucleotidebinding site leucine-rich repeats), which are proteins that play role in mediating a hypersensitive response at the site of pathogen infection 3. Typically, the NBS region is well conserved across different species which is marked by the presence of several conserved motifs. These include a p-loop (kinase 1), kinase 2, kinase 3 and other short motifs of unknown functions 2. The function of kinase 1 and kinase 2 is to bind with the phosphates of ATP, whereas kinase 3 interacts with the purine or ribose moiety 4. On the other hand, the C-termini of the *Author for correspondence: niazmahmood.ami@gmail.com Note: After presentation of this paper in the conference, Zambounis et al [Mol Biol Evol, 29 (2012) ] published an article containing detailed analysis of the same family. However, authors would like to declare no conflict of interest with any one. proteins are highly variable and are marked by the presence of different types of protein-protein interacting domains; the most common of which is the leucine-rich repeats (LRRs) found in plant NBS-LRR 5 and human NLR (nucleotide-binding domain, leucinerich repeat containing) family of proteins. However, other domains may also be present; as for example human APAF-1 proteins contain WD-40 repeats at their C-termini 1. A plethora of information on the structural and functional aspect of the NBS proteins in other lineages is available, but not much has been found for their counterparts in brown algae. Ectocarpus siliculosus is the only member of this lineage with full genome sequence available. Thus, a genome wide investigation on the NBS containing sequences in E. siliculosus was performed in the present study. Materials and Methods Identification and Classification of NBS Containing Proteins The E. siliculosus protein sequences were obtained from the database of Bioinformatics Gent Online Genome Annotation System (BOGAS; To identify the NBS domain containing sequences, InterProScan 6 searches using models for the NB-ARC (IPR002182) and disease resistance (IPR000767)

2 MAHMOOD & MOOSA: NBS PROTEINS IN E. SILICULOSUS 99 domains were used. The identified domains were curated manually. The Coiled Coil (CC) motifs were identified by COILS program 7 using a threshold of 0.9. Conserved motifs within the NBS domains were identified using MEME (Multiple Expectation Maximization for Motif Elicitation) 8,9. These detailed data on protein motifs and domains were used to classify the proteins into different subgroups. Sequence Alignment and Phylogenetic Analysis For the alignment, complete predicted protein sequences were trimmed in such a way that only the NBS domain containing regions are present. Then the sequences were aligned by Clustal X version with default options and phylogenetic tree was constructed based on the bootstrap neighbor-joining method 11 using Molecular Evolutionary Genetics Analysis (MEGA) software version The stability of internal nodes was assessed by bootstrap analysis with 10,000 replicates. Substitution Pattern of NBS Region in E. siliculosus Synonymous and non-synonymous substitution pattern was determined using the modified Nei- Gojobori 13 method with the Jukes-Cantor correction as implemented in MEGA Results and Discussion E. siliculosus NBS Proteins are Few in Number but Diverse in Class Thirty one prospective proteins with highly conserved NBS regions were initially identified in E. siliculosus. Five of these proteins were subsequently found to be the products of pseudogenes and were excluded from further analysis. The percentage of pseudogenes (~16%) is quite high considering the total number of NBS proteins identified and is reminiscent of the fast evolution patterns described for plant disease resistance genes 14. Unlike their counterparts in Viridiplantae, the NBS proteins in E. siliculosus do not harbour C-terminal leucine rich repeats (LRRs), which play role in pathogen effector binding and signal transduction regulation. Instead of LRRs they have tetratrico peptide repeats (TPR) at their C-termini. Such TPR motifs are found in proteins from a wide range of organisms, ranging from bacteria to humans, and are involved in mediating protein-protein interactions and the assembly of multi protein complexes 15. With exception to four proteins (GenBank ID CBN79515, CBN74455, CBJ27327 & CBJ33350), all the E. siliculosus NBS proteins have TPRs at their C-termini. The number of TPRs within each members of NBS-TPR subfamily varied greatly, ranging from as high as 18 repeats in CBJ25655 to as low as one repeat in CBN79956 and CBJ26776; with an overall average of seven repeats. However, the exact reason for selecting TPRs instead of LRRs in the NBS proteins is still not clear. It is known that the TPRs can act as scaffolds for signaling proteins for helping in the recognition of their targets; hence, defining a novel mechanism for protein recognition 16. It is possible that different signaling pathways are activated by these proteins upon brown algae specific pathogen attack. Cock et al 17 in their study found that the E. siliculosus NBS proteins do not have any toll interleukin receptor (TIR) at their N-termini 17 and the only known motif found at that region is the CC motif. COILS 7 detected the presence of CC motifs in nine out of the twenty six NBS proteins. Previous studies suggested the involvement of the CC motif in proteinprotein interaction and signaling 18. Based on the differences in the N-terminal and C-terminal regions, the sequences were classified into four classes: NBS, NBS-TPR, CC-NBS-TPR and CC-NBS (Table 1). Clearly, the E. siliculosus NBS proteins are quite different in their structure compared to their counterparts in other species and are also significantly lower in number. NBS accounts for 0.16% of the total number of proteins in E. siliculosus, whereas the percentage is 1.38 and 0.68%, respectively in photosynthetic organisms like rice and Arabidopsis. Ancient duplication of the entire genome and subsequent chromosome rearrangements played a key role in the amplification of resistance genes in Arabidopsis 19,20, and gene duplication caused by expansion of diversity played a role in the amplification of NBS proteins in rice 21. Brown algae had diverged from other multicellular organisms more than a billion years ago and were subjected to Table 1 Classification of E. siliculosus NBS proteins based on the predicted domains Predicted protein Letter code E. siliculosus With TPRs CC-NBS-TPR CNT 08 NBS-TPR NT 14 Without TPRs CC-NBS CN 01 NBS N 03 Total NBS 26

3 100 INDIAN J BIOTECHNOL, JANUARY 2013 different selective pressure 22. So the possibility of developing alternate means of pathogen resistance cannot be over ruled. Conserved Motifs in NBS Region Irrespective of their differential classification, the identified proteins showed conservation in the NBS region. MEME identified several conserved motifs like the p-loop, RNBS-A, kinase 2, kinase 3 and RNBS-C motifs within the NBS regions of E. siliculosus; most of which were previously described in other species (Table 2). The hydrophobic GLPL domain found in other species was slightly modified into GHLPL (example CBN75740, CBJ26207) in E. siliculosus. In addition, we found two E. siliculosus specific conserved motifs within the NBS region. To our knowledge, these two motifs were not described in other organisms. We named the motifs as ENBS 1 and ENBS 2. While the ENBS 1 motif was found between kinase 2 and kinase 3 motifs, the ENBS 2 was mostly found after the GHLPL motif. However, the functions of these two noble motifs remain to be elucidated experimentally. The position of the motifs within the NBS domain is shown in Fig. 1. The length and order of motifs represent the actual organization in each protein. Table 2 Sequence of the major conserved motifs within E. siliculosus NBS domains Motif Motif name Sequence in E. siliculosus 1 P-loop or Kinase 1 GPSGAGKSTIAS 2 RNBS-A VRRHFRDGIFWL 3 Kinase 2 KCLVVADNVWE 4 ENBS 1 GKGAKDRLPALM 5 Kinase 3 or RNBS-B TGFHVLVTTRQR 6 RNBS-C EEEALELLRKTS 7 GHLPL CGHLPLVLAIAG 8 ENBS 2 RWSTVRGRSDRT Fig. 1 Distribution of conserved motifs within the NBS domains as identified by MEME. The name of each member and combined P value are shown on the left side of the figure. Different motifs are indicated with different colour boxes.

4 MAHMOOD & MOOSA: NBS PROTEINS IN E. SILICULOSUS 101 Evolutionary Analyses To clarify the phylogenetic relationship among the NBS proteins and infer the evolutionary history of this family, a phylogenetic tree was constructed using the protein sequences of the NBS region. The tree divided the sequences into two major clusters; with two sequences (CBN79515, CBJ26776) placed outside these clusters due to significant variation in their sequences (Fig. 2a). Most members of the same subfamilies were clustered together in different groups. Another tree has been constructed using the NBS regions of model organisms like rice, human and C. elegans as reference along with their E. siliculosus counterparts (Fig. 2b). This time the tree was generated from the Hidden Markov Model (HMM) based multiple sequence alignments of the sequences done by SATCHMO-JS 23. This tree showed almost similar distribution of the E. siliculosus NBS sequences in consistent with the previous tree (Fig. 2 a) and the sequences from other species were placed separately as out groups (Fig. 2 b). To analyze the selection pressure, nucleotide sequences within the NBS region was retrieved and synonymous and non-synonymous substitution pattern was determined, which was found to be This indicated an overall positive selection within the NBS regions of the genes. Conclusion NBS domains are conserved throughout different eukaryote lineages. Proteins having this domain are known to function in a number of cellular processes, such as, regulating programmed cell death in metazoans and disease resistance in plants. Our analyses of NBS proteins from model brown algae, E. siliculosus, revealed that despite similarities with other lineages, brown algae have distinct NBS domain organization. Further experimental studies can elucidate functional and evolutionary significance of the novel domain organization. Fig. 2 (a & b) (a) Phylogenetic tree of the E. siliculosus NBS sequences based on the amino acid sequences in the NBS domain; & (b) Comparative phylogenetic tree using NBS regions of model organisms like rice (acc.no. NP_ ), human (NP_863651) and C. elegans (CCD66782) as reference along with their E. siliculosus counterparts. This tree does not show the bootstrap values as it was generated by a different algorithm. (Black diamond NBS-TPR; white diamond NBS; black triangle CC-NBS-TPR; white triangle CC-NBS family of proteins; & black circle reference sequences) Acknowledgement The authors would like to thank Professor Haseena Khan, Department of Biochemistry and Molecular Biology, University of Dhaka, Dhaka for her constant support. References 1 Ting J P, Willingham S B & Bergstralh D T, NLRs at the intersection of cell death and immunity, Nat Rev Immunol, 8 (2008)

5 102 INDIAN J BIOTECHNOL, JANUARY van der Biezen E A & Jones J D, The NB-ARC domain: A novel signalling motif shared by plant resistance gene products and regulators of cell death in animals, Curr Biol, 8 (1998) Dhaliwal H & Uchimiya H, Genetic engineering for disease and pest resistance in plants, Plant Biotechnol (Tokyo), 16 (1999) Traut T W, The functions and consensus motifs of nine types of peptide segments that form different types of nucleotidebinding sites, Eur J Biochem, 222 (1994) Dangl J L & Jones J D G, Plant pathogens and integrated defence responses to infection, Nature (Lond), 411 (2001) Quevillon E, Silventoinen V, Pillai S, Harte N, Mulder N et al, InterProScan: Protein domains identifier, Nucleic Acids Res, 33 (2005) Lupas A, Van Dyke M & Stock J, Predicting coiled coils from protein sequences, Science, 252 (1991) Bailey T L & Elkan C, Fitting a mixture model by expectation maximization to discover motifs in biopolymers, Proc Int Conf Intell Syst Mol Biol, 2 (1994) Bailey T L, Williams N, Misleh C & Li W W, MEME: Discovering and analyzing DNA and protein sequence motifs, Nucleic Acids Res, 34 (2006) Larkin M A, Blackshields G, Brown N P, Chenna R, McGettigan P A et al, Clustal W and Clustal X version 2.0, Bioinformatics, 23 (2007) Saitou N & Nei M, The neighbor-joining method: A new method for reconstructing phylogenetic trees, Mol Biol Evol, 4 (1987) Tamura K, Dudley J, Nei M & Kumar S, MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0, Mol Biol Evol, 24 (2007) Zhang J, Rosenberg H F & Nei M, Positive Darwinian selection after gene duplication in primate ribonuclease genes, Proc Natl Acad Sci USA, 95 (1998) Meyers B C, Kaushik S & Nandety R S, Evolving disease resistance genes, Curr Opin Plant Biol, 8 (2005) D'Andrea L D & Regan L, TPR proteins: The versatile helix, Trends Biochem Sci, 28 (2003) Das A K, Cohen P T W & Barford D, The structure of the tetratricopeptide repeats of protein phosphatase 5: Implications for TPR-mediated protein-protein interactions, EMBO J, 17 (1998) Cock J M, Sterck L, Rouzé P, Scornet D, Allen A E et al, The Ectocarpus genome and the independent evolution of multicellularity in brown algae, Nature (Lond), 465 (2010) Martin G B, Bogdanove A J & Sessa G, Understanding the functions of plant disease resistance proteins, Annu Rev Plant Biol, 54 (2003) Meyers B C, Kozik A, Griego A, Kuang H & Michelmore R W, Genome-wide analysis of NBS-LRR-encoding genes in Arabidopsis, Plant Cell, 15 (2003) Richly E, Kurth J & Leister D, Mode of amplification and reorganization of resistance genes during recent Arabidopsis thaliana evolution, Mol Biol Evol, 19 (2002) Zhou T, Wang Y, Chen J-Q, Araki H, Jing Z et al, Genomewide identification of NBS genes in japonica rice reveals significant expansion of divergent non-tir NBS-LRR genes, Mol Genet Genomics, 271 (2004) Yoon H S, Hackett J D, Ciniglia C, Pinto G & Bhattacharya D, A molecular timeline for the origin of photosynthetic eukaryotes, Mol Biol Evol, 21 (2004) Hagopian R, Davidson J R, Datta R S, Samad B, Jarvis G R et al, SATCHMO-JS: A webserver for simultaneous protein multiple sequence alignment and phylogenetic tree construction, Nucleic Acids Res,38 (2010)

Genomewide analysis of NBS-encoding genes in kiwi fruit (Actinidia chinensis)

Genomewide analysis of NBS-encoding genes in kiwi fruit (Actinidia chinensis) c Indian Academy of Sciences RESEARCH NOTE Genomewide analysis of NBS-encoding genes in kiwi fruit (Actinidia chinensis) YINGJUN LI, YAN ZHONG, KAIHUI HUANG and ZONG-MING CHENG College of Horticulture,

More information

Genome-Wide Analysis of NBS-LRR Encoding Genes in Arabidopsis

Genome-Wide Analysis of NBS-LRR Encoding Genes in Arabidopsis The Plant Cell, Vol. 15, 809 834, April 2003, www.plantcell.org 2003 American Society of Plant Biologists GENOMICS ARTICLE Genome-Wide Analysis of NBS-LRR Encoding Genes in Arabidopsis Blake C. Meyers,

More information

Comparison and Analysis of Heat Shock Proteins in Organisms of the Kingdom Viridiplantae. Emily Germain, Rensselaer Polytechnic Institute

Comparison and Analysis of Heat Shock Proteins in Organisms of the Kingdom Viridiplantae. Emily Germain, Rensselaer Polytechnic Institute Comparison and Analysis of Heat Shock Proteins in Organisms of the Kingdom Viridiplantae Emily Germain, Rensselaer Polytechnic Institute Mentor: Dr. Hugh Nicholas, Biomedical Initiative, Pittsburgh Supercomputing

More information

A genomic analysis of disease-resistance genes encoding nucleotide binding sites in Sorghum bicolor

A genomic analysis of disease-resistance genes encoding nucleotide binding sites in Sorghum bicolor Research Article Genetics and Molecular Biology, 33, 2, 292-297 (2010) Copyright 2010, Sociedade Brasileira de Genética. Printed in Brazil www.sbg.org.br A genomic analysis of disease-resistance genes

More information

Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii

Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii Hengling Wei 1,2, Wei Li 1, Xiwei Sun 1, Shuijin Zhu 1 *, Jun Zhu 1 * 1 Key

More information

Objectives. Comparison and Analysis of Heat Shock Proteins in Organisms of the Kingdom Viridiplantae. Emily Germain 1,2 Mentor Dr.

Objectives. Comparison and Analysis of Heat Shock Proteins in Organisms of the Kingdom Viridiplantae. Emily Germain 1,2 Mentor Dr. Comparison and Analysis of Heat Shock Proteins in Organisms of the Kingdom Viridiplantae Emily Germain 1,2 Mentor Dr. Hugh Nicholas 3 1 Bioengineering & Bioinformatics Summer Institute, Department of Computational

More information

Small RNA in rice genome

Small RNA in rice genome Vol. 45 No. 5 SCIENCE IN CHINA (Series C) October 2002 Small RNA in rice genome WANG Kai ( 1, ZHU Xiaopeng ( 2, ZHONG Lan ( 1,3 & CHEN Runsheng ( 1,2 1. Beijing Genomics Institute/Center of Genomics and

More information

Computational approaches for functional genomics

Computational approaches for functional genomics Computational approaches for functional genomics Kalin Vetsigian October 31, 2001 The rapidly increasing number of completely sequenced genomes have stimulated the development of new methods for finding

More information

Computational Biology: Basics & Interesting Problems

Computational Biology: Basics & Interesting Problems Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information

More information

Computational Analysis of the Fungal and Metazoan Groups of Heat Shock Proteins

Computational Analysis of the Fungal and Metazoan Groups of Heat Shock Proteins Computational Analysis of the Fungal and Metazoan Groups of Heat Shock Proteins Introduction: Benjamin Cooper, The Pennsylvania State University Advisor: Dr. Hugh Nicolas, Biomedical Initiative, Carnegie

More information

BIOINFORMATICS: An Introduction

BIOINFORMATICS: An Introduction BIOINFORMATICS: An Introduction What is Bioinformatics? The term was first coined in 1988 by Dr. Hwa Lim The original definition was : a collective term for data compilation, organisation, analysis and

More information

Curriculum Links. AQA GCE Biology. AS level

Curriculum Links. AQA GCE Biology. AS level Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2

More information

Genomes and Their Evolution

Genomes and Their Evolution Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Bioinformatics tools for phylogeny and visualization. Yanbin Yin

Bioinformatics tools for phylogeny and visualization. Yanbin Yin Bioinformatics tools for phylogeny and visualization Yanbin Yin 1 Homework assignment 5 1. Take the MAFFT alignment http://cys.bios.niu.edu/yyin/teach/pbb/purdue.cellwall.list.lignin.f a.aln as input and

More information

CSCE555 Bioinformatics. Protein Function Annotation

CSCE555 Bioinformatics. Protein Function Annotation CSCE555 Bioinformatics Protein Function Annotation Why we need to do function annotation? Fig from: Network-based prediction of protein function. Molecular Systems Biology 3:88. 2007 What s function? The

More information

A bioinformatics approach to the structural and functional analysis of the glycogen phosphorylase protein family

A bioinformatics approach to the structural and functional analysis of the glycogen phosphorylase protein family A bioinformatics approach to the structural and functional analysis of the glycogen phosphorylase protein family Jieming Shen 1,2 and Hugh B. Nicholas, Jr. 3 1 Bioengineering and Bioinformatics Summer

More information

Host-Pathogen interaction-ii. Pl Path 604 PN Sharma Department of Plant Pathology CSK HPKV, Palampur

Host-Pathogen interaction-ii. Pl Path 604 PN Sharma Department of Plant Pathology CSK HPKV, Palampur Host-Pathogen interaction-ii Pl Path 604 PN Sharma Department of Plant Pathology CSK HPKV, Palampur-176062 It was originally believed that gene-for-gene resistance was conferred by a direct interaction

More information

Computational Structural Bioinformatics

Computational Structural Bioinformatics Computational Structural Bioinformatics ECS129 Instructor: Patrice Koehl http://koehllab.genomecenter.ucdavis.edu/teaching/ecs129 koehl@cs.ucdavis.edu Learning curve Math / CS Biology/ Chemistry Pre-requisite

More information

EVOLUTIONARY DISTANCE MODEL BASED ON DIFFERENTIAL EQUATION AND MARKOV PROCESS

EVOLUTIONARY DISTANCE MODEL BASED ON DIFFERENTIAL EQUATION AND MARKOV PROCESS August 0 Vol 4 No 005-0 JATIT & LLS All rights reserved ISSN: 99-8645 wwwjatitorg E-ISSN: 87-95 EVOLUTIONAY DISTANCE MODEL BASED ON DIFFEENTIAL EUATION AND MAKOV OCESS XIAOFENG WANG College of Mathematical

More information

Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST

Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST Introduction Bioinformatics is a powerful tool which can be used to determine evolutionary relationships and

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Icm/Dot secretion system region I in 41 Legionella species.

Nature Genetics: doi: /ng Supplementary Figure 1. Icm/Dot secretion system region I in 41 Legionella species. Supplementary Figure 1 Icm/Dot secretion system region I in 41 Legionella species. Homologs of the effector-coding gene lega15 (orange) were found within Icm/Dot region I in 13 Legionella species. In four

More information

Resistance gene analogues of Arabidopsis thaliana: recognition by structure

Resistance gene analogues of Arabidopsis thaliana: recognition by structure J. Appl. Genet. 44(3), 2003, pp. 311-321 Resistance gene analogues of Arabidopsis thaliana: recognition by structure Jerzy CHE KOWSKI, Grzegorz KOCZYK Institute of Plant Genetics, Polish Academy of Sciences,

More information

Prediction and Classif ication of Human G-protein Coupled Receptors Based on Support Vector Machines

Prediction and Classif ication of Human G-protein Coupled Receptors Based on Support Vector Machines Article Prediction and Classif ication of Human G-protein Coupled Receptors Based on Support Vector Machines Yun-Fei Wang, Huan Chen, and Yan-Hong Zhou* Hubei Bioinformatics and Molecular Imaging Key Laboratory,

More information

Bioinformatics. Dept. of Computational Biology & Bioinformatics

Bioinformatics. Dept. of Computational Biology & Bioinformatics Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. Schematic pipeline for single-cell genome assembly, cleaning and annotation. a. The assembly process was optimized to account for multiple cells putatively

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary information S3 (box) Methods Methods Genome weighting The currently available collection of archaeal and bacterial genomes has a highly biased distribution of isolates across taxa. For example,

More information

Cladistics and Bioinformatics Questions 2013

Cladistics and Bioinformatics Questions 2013 AP Biology Name Cladistics and Bioinformatics Questions 2013 1. The following table shows the percentage similarity in sequences of nucleotides from a homologous gene derived from five different species

More information

Comparative Bioinformatics Midterm II Fall 2004

Comparative Bioinformatics Midterm II Fall 2004 Comparative Bioinformatics Midterm II Fall 2004 Objective Answer, part I: For each of the following, select the single best answer or completion of the phrase. (3 points each) 1. Deinococcus radiodurans

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological

More information

I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes.

I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes. I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes. A. Chemistry of Life B. Cells 1. Water How do the unique chemical

More information

Effects of Gap Open and Gap Extension Penalties

Effects of Gap Open and Gap Extension Penalties Brigham Young University BYU ScholarsArchive All Faculty Publications 200-10-01 Effects of Gap Open and Gap Extension Penalties Hyrum Carroll hyrumcarroll@gmail.com Mark J. Clement clement@cs.byu.edu See

More information

I. Molecules & Cells. A. Unit One: The Nature of Science. B. Unit Two: The Chemistry of Life. C. Unit Three: The Biology of the Cell.

I. Molecules & Cells. A. Unit One: The Nature of Science. B. Unit Two: The Chemistry of Life. C. Unit Three: The Biology of the Cell. I. Molecules & Cells A. Unit One: The Nature of Science a. How is the scientific method used to solve problems? b. What is the importance of controls? c. How does Darwin s theory of evolution illustrate

More information

Research Article Genome Wide Analysis of Nucleotide-Binding Site Disease Resistance Genes in Brachypodium distachyon

Research Article Genome Wide Analysis of Nucleotide-Binding Site Disease Resistance Genes in Brachypodium distachyon Comparative and Functional Genomics Volume, Article ID, pages doi:.// Research Article Genome Wide Analysis of Nucleotide-Binding Site Disease Resistance Genes in Brachypodium distachyon Shenglong Tan,

More information

Biological Networks: Comparison, Conservation, and Evolution via Relative Description Length By: Tamir Tuller & Benny Chor

Biological Networks: Comparison, Conservation, and Evolution via Relative Description Length By: Tamir Tuller & Benny Chor Biological Networks:,, and via Relative Description Length By: Tamir Tuller & Benny Chor Presented by: Noga Grebla Content of the presentation Presenting the goals of the research Reviewing basic terms

More information

Predicting Protein Functions and Domain Interactions from Protein Interactions

Predicting Protein Functions and Domain Interactions from Protein Interactions Predicting Protein Functions and Domain Interactions from Protein Interactions Fengzhu Sun, PhD Center for Computational and Experimental Genomics University of Southern California Outline High-throughput

More information

Dr. Amira A. AL-Hosary

Dr. Amira A. AL-Hosary Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological

More information

Genômica comparativa. João Carlos Setubal IQ-USP outubro /5/2012 J. C. Setubal

Genômica comparativa. João Carlos Setubal IQ-USP outubro /5/2012 J. C. Setubal Genômica comparativa João Carlos Setubal IQ-USP outubro 2012 11/5/2012 J. C. Setubal 1 Comparative genomics There are currently (out/2012) 2,230 completed sequenced microbial genomes publicly available

More information

GATA family of transcription factors of vertebrates: phylogenetics and chromosomal synteny

GATA family of transcription factors of vertebrates: phylogenetics and chromosomal synteny Phylogenetics and chromosomal synteny of the GATAs 1273 GATA family of transcription factors of vertebrates: phylogenetics and chromosomal synteny CHUNJIANG HE, HANHUA CHENG* and RONGJIA ZHOU* Department

More information

Genome-wide analysis of nucleotide-binding site disease resistance genes in Medicago truncatula

Genome-wide analysis of nucleotide-binding site disease resistance genes in Medicago truncatula Chin. Sci. Bull. (2014) 59(11):1129 1138 DOI 10.1007/s11434-014-0155-3 Article csb.scichina.com www.springer.com/scp Bioinformatics Genome-wide analysis of nucleotide-binding site disease resistance genes

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary information S1 (box). Supplementary Methods description. Prokaryotic Genome Database Archaeal and bacterial genome sequences were downloaded from the NCBI FTP site (ftp://ftp.ncbi.nlm.nih.gov/genomes/all/)

More information

AP Biology Essential Knowledge Cards BIG IDEA 1

AP Biology Essential Knowledge Cards BIG IDEA 1 AP Biology Essential Knowledge Cards BIG IDEA 1 Essential knowledge 1.A.1: Natural selection is a major mechanism of evolution. Essential knowledge 1.A.4: Biological evolution is supported by scientific

More information

Chapters AP Biology Objectives. Objectives: You should know...

Chapters AP Biology Objectives. Objectives: You should know... Objectives: You should know... Notes 1. Scientific evidence supports the idea that evolution has occurred in all species. 2. Scientific evidence supports the idea that evolution continues to occur. 3.

More information

Sequence analysis and comparison

Sequence analysis and comparison The aim with sequence identification: Sequence analysis and comparison Marjolein Thunnissen Lund September 2012 Is there any known protein sequence that is homologous to mine? Are there any other species

More information

Supporting Information

Supporting Information Supporting Information Das et al. 10.1073/pnas.1302500110 < SP >< LRRNT > < LRR1 > < LRRV1 > < LRRV2 Pm-VLRC M G F V V A L L V L G A W C G S C S A Q - R Q R A C V E A G K S D V C I C S S A T D S S P E

More information

"Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky

Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky MOLECULAR PHYLOGENY "Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky EVOLUTION - theory that groups of organisms change over time so that descendeants differ structurally

More information

METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.

METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature17991 Supplementary Discussion Structural comparison with E. coli EmrE The DMT superfamily includes a wide variety of transporters with 4-10 TM segments 1. Since the subfamilies of the

More information

MOLECULAR PHYLOGENY AND GENETIC DIVERSITY ANALYSIS. Masatoshi Nei"

MOLECULAR PHYLOGENY AND GENETIC DIVERSITY ANALYSIS. Masatoshi Nei MOLECULAR PHYLOGENY AND GENETIC DIVERSITY ANALYSIS Masatoshi Nei" Abstract: Phylogenetic trees: Recent advances in statistical methods for phylogenetic reconstruction and genetic diversity analysis were

More information

7. Tests for selection

7. Tests for selection Sequence analysis and genomics 7. Tests for selection Dr. Katja Nowick Group leader TFome and Transcriptome Evolution Bioinformatics group Paul-Flechsig-Institute for Brain Research www. nowicklab.info

More information

MATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME

MATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME MATHEMATICAL MODELING AND THE HUMAN GENOME Hilary S. Booth Australian National University, Australia Keywords: Human genome, DNA, bioinformatics, sequence analysis, evolution. Contents 1. Introduction:

More information

Introduction to Molecular and Cell Biology

Introduction to Molecular and Cell Biology Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What

More information

VCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design

VCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and

More information

Hiromi Nishida. 1. Introduction. 2. Materials and Methods

Hiromi Nishida. 1. Introduction. 2. Materials and Methods Evolutionary Biology Volume 212, Article ID 342482, 5 pages doi:1.1155/212/342482 Research Article Comparative Analyses of Base Compositions, DNA Sizes, and Dinucleotide Frequency Profiles in Archaeal

More information

Introduction to Bioinformatics Online Course: IBT

Introduction to Bioinformatics Online Course: IBT Introduction to Bioinformatics Online Course: IBT Multiple Sequence Alignment Building Multiple Sequence Alignment Lec1 Building a Multiple Sequence Alignment Learning Outcomes 1- Understanding Why multiple

More information

Protein Architecture V: Evolution, Function & Classification. Lecture 9: Amino acid use units. Caveat: collagen is a. Margaret A. Daugherty.

Protein Architecture V: Evolution, Function & Classification. Lecture 9: Amino acid use units. Caveat: collagen is a. Margaret A. Daugherty. Lecture 9: Protein Architecture V: Evolution, Function & Classification Margaret A. Daugherty Fall 2004 Amino acid use *Proteins don t use aa s equally; eg, most proteins not repeating units. Caveat: collagen

More information

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology 2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the

More information

Temporal Trails of Natural Selection in Human Mitogenomes. Author. Published. Journal Title DOI. Copyright Statement.

Temporal Trails of Natural Selection in Human Mitogenomes. Author. Published. Journal Title DOI. Copyright Statement. Temporal Trails of Natural Selection in Human Mitogenomes Author Sankarasubramanian, Sankar Published 2009 Journal Title Molecular Biology and Evolution DOI https://doi.org/10.1093/molbev/msp005 Copyright

More information

O 3 O 4 O 5. q 3. q 4. Transition

O 3 O 4 O 5. q 3. q 4. Transition Hidden Markov Models Hidden Markov models (HMM) were developed in the early part of the 1970 s and at that time mostly applied in the area of computerized speech recognition. They are first described in

More information

Quantifying sequence similarity

Quantifying sequence similarity Quantifying sequence similarity Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, February 16 th 2016 After this lecture, you can define homology, similarity, and identity

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/1/8/e1500527/dc1 Supplementary Materials for A phylogenomic data-driven exploration of viral origins and evolution The PDF file includes: Arshan Nasir and Gustavo

More information

Divergence Pattern of Duplicate Genes in Protein-Protein Interactions Follows the Power Law

Divergence Pattern of Duplicate Genes in Protein-Protein Interactions Follows the Power Law Divergence Pattern of Duplicate Genes in Protein-Protein Interactions Follows the Power Law Ze Zhang,* Z. W. Luo,* Hirohisa Kishino,à and Mike J. Kearsey *School of Biosciences, University of Birmingham,

More information

Bio 1B Lecture Outline (please print and bring along) Fall, 2007

Bio 1B Lecture Outline (please print and bring along) Fall, 2007 Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution

More information

Figure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and

Figure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and Figure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and counterclockwise for the inner row, with green representing coding

More information

Computational methods for predicting protein-protein interactions

Computational methods for predicting protein-protein interactions Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational

More information

Warm Up. What are some examples of living things? Describe the characteristics of living things

Warm Up. What are some examples of living things? Describe the characteristics of living things Warm Up What are some examples of living things? Describe the characteristics of living things Objectives Identify the levels of biological organization and explain their relationships Describe cell structure

More information

Phylogenetic Tree Generation using Different Scoring Methods

Phylogenetic Tree Generation using Different Scoring Methods International Journal of Computer Applications (975 8887) Phylogenetic Tree Generation using Different Scoring Methods Rajbir Singh Associate Prof. & Head Department of IT LLRIET, Moga Sinapreet Kaur Student

More information

Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr

Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A

More information

Sequence Alignment Techniques and Their Uses

Sequence Alignment Techniques and Their Uses Sequence Alignment Techniques and Their Uses Sarah Fiorentino Since rapid sequencing technology and whole genomes sequencing, the amount of sequence information has grown exponentially. With all of this

More information

Microbiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms

Microbiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms 1 2 Bergey s Manual of Systematic Bacteriology differs from Bergey s Manual of Determinative Bacteriology in that the former a. groups bacteria into species. b. groups bacteria according to phylogenetic

More information

PAMP-triggered immunity (PTI)

PAMP-triggered immunity (PTI) PAMP-triggered immunity (PTI) PAMP-triggered immunity (PTI) Recognition of danger signals - Distinguish self or damaged self versus non-self fundamental to any immune system - PAMP or MAMP pathogen/microbe-associated

More information

Comparative genomics: Overview & Tools + MUMmer algorithm

Comparative genomics: Overview & Tools + MUMmer algorithm Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first

More information

Evidence for dynamically organized modularity in the yeast protein-protein interaction network

Evidence for dynamically organized modularity in the yeast protein-protein interaction network Evidence for dynamically organized modularity in the yeast protein-protein interaction network Sari Bombino Helsinki 27.3.2007 UNIVERSITY OF HELSINKI Department of Computer Science Seminar on Computational

More information

AP BIOLOGY SUMMER ASSIGNMENT

AP BIOLOGY SUMMER ASSIGNMENT AP BIOLOGY SUMMER ASSIGNMENT Welcome to EDHS Advanced Placement Biology! The attached summer assignment is required for all AP Biology students for the 2011-2012 school year. The assignment consists of

More information

Introduction to Bioinformatics

Introduction to Bioinformatics CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics

More information

Statistical Machine Learning Methods for Bioinformatics II. Hidden Markov Model for Biological Sequences

Statistical Machine Learning Methods for Bioinformatics II. Hidden Markov Model for Biological Sequences Statistical Machine Learning Methods for Bioinformatics II. Hidden Markov Model for Biological Sequences Jianlin Cheng, PhD Department of Computer Science University of Missouri 2008 Free for Academic

More information

08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega

08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments

More information

InDel 3-5. InDel 8-9. InDel 3-5. InDel 8-9. InDel InDel 8-9

InDel 3-5. InDel 8-9. InDel 3-5. InDel 8-9. InDel InDel 8-9 Lecture 5 Alignment I. Introduction. For sequence data, the process of generating an alignment establishes positional homologies; that is, alignment provides the identification of homologous phylogenetic

More information

Quantitative Measurement of Genome-wide Protein Domain Co-occurrence of Transcription Factors

Quantitative Measurement of Genome-wide Protein Domain Co-occurrence of Transcription Factors Quantitative Measurement of Genome-wide Protein Domain Co-occurrence of Transcription Factors Arli Parikesit, Peter F. Stadler, Sonja J. Prohaska Bioinformatics Group Institute of Computer Science University

More information

a,bD (modules 1 and 10 are required)

a,bD (modules 1 and 10 are required) This form should be used for all taxonomic proposals. Please complete all those modules that are applicable (and then delete the unwanted sections). For guidance, see the notes written in blue and the

More information

Chapter 18 Lecture. Concepts of Genetics. Tenth Edition. Developmental Genetics

Chapter 18 Lecture. Concepts of Genetics. Tenth Edition. Developmental Genetics Chapter 18 Lecture Concepts of Genetics Tenth Edition Developmental Genetics Chapter Contents 18.1 Differentiated States Develop from Coordinated Programs of Gene Expression 18.2 Evolutionary Conservation

More information

Grouping of amino acids and recognition of protein structurally conserved regions by reduced alphabets of amino acids

Grouping of amino acids and recognition of protein structurally conserved regions by reduced alphabets of amino acids Science in China Series C: Life Sciences 2007 Science in China Press Springer-Verlag Grouping of amino acids and recognition of protein structurally conserved regions by reduced alphabets of amino acids

More information

5/4/05 Biol 473 lecture

5/4/05 Biol 473 lecture 5/4/05 Biol 473 lecture animals shown: anomalocaris and hallucigenia 1 The Cambrian Explosion - 550 MYA THE BIG BANG OF ANIMAL EVOLUTION Cambrian explosion was characterized by the sudden and roughly simultaneous

More information

ADVANCED PLACEMENT BIOLOGY

ADVANCED PLACEMENT BIOLOGY ADVANCED PLACEMENT BIOLOGY Description Advanced Placement Biology is designed to be the equivalent of a two-semester college introductory course for Biology majors. The course meets seven periods per week

More information

Molecular evolution - Part 1. Pawan Dhar BII

Molecular evolution - Part 1. Pawan Dhar BII Molecular evolution - Part 1 Pawan Dhar BII Theodosius Dobzhansky Nothing in biology makes sense except in the light of evolution Age of life on earth: 3.85 billion years Formation of planet: 4.5 billion

More information

1 of 13 8/11/2014 10:32 AM Units: Teacher: APBiology, CORE Course: APBiology Year: 2012-13 Chemistry of Life Chapters 1-4 Big Idea 1, 2 & 4 Change in the genetic population over time is feedback mechanisms

More information

Genome-wide analysis of the MYB transcription factor superfamily in soybean

Genome-wide analysis of the MYB transcription factor superfamily in soybean Du et al. BMC Plant Biology 2012, 12:106 RESEARCH ARTICLE Open Access Genome-wide analysis of the MYB transcription factor superfamily in soybean Hai Du 1,2,3, Si-Si Yang 1,2, Zhe Liang 4, Bo-Run Feng

More information

Tiffany Samaroo MB&B 452a December 8, Take Home Final. Topic 1

Tiffany Samaroo MB&B 452a December 8, Take Home Final. Topic 1 Tiffany Samaroo MB&B 452a December 8, 2003 Take Home Final Topic 1 Prior to 1970, protein and DNA sequence alignment was limited to visual comparison. This was a very tedious process; even proteins with

More information

Subfamily HMMS in Functional Genomics. D. Brown, N. Krishnamurthy, J.M. Dale, W. Christopher, and K. Sjölander

Subfamily HMMS in Functional Genomics. D. Brown, N. Krishnamurthy, J.M. Dale, W. Christopher, and K. Sjölander Subfamily HMMS in Functional Genomics D. Brown, N. Krishnamurthy, J.M. Dale, W. Christopher, and K. Sjölander Pacific Symposium on Biocomputing 10:322-333(2005) SUBFAMILY HMMS IN FUNCTIONAL GENOMICS DUNCAN

More information

Lecture Notes for Fall Network Modeling. Ernest Fraenkel

Lecture Notes for Fall Network Modeling. Ernest Fraenkel Lecture Notes for 20.320 Fall 2012 Network Modeling Ernest Fraenkel In this lecture we will explore ways in which network models can help us to understand better biological data. We will explore how networks

More information

Understanding relationship between homologous sequences

Understanding relationship between homologous sequences Molecular Evolution Molecular Evolution How and when were genes and proteins created? How old is a gene? How can we calculate the age of a gene? How did the gene evolve to the present form? What selective

More information

CHAPTERS 24-25: Evidence for Evolution and Phylogeny

CHAPTERS 24-25: Evidence for Evolution and Phylogeny CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology

More information

Research Proposal. Title: Multiple Sequence Alignment used to investigate the co-evolving positions in OxyR Protein family.

Research Proposal. Title: Multiple Sequence Alignment used to investigate the co-evolving positions in OxyR Protein family. Research Proposal Title: Multiple Sequence Alignment used to investigate the co-evolving positions in OxyR Protein family. Name: Minjal Pancholi Howard University Washington, DC. June 19, 2009 Research

More information

Origins of Life. Fundamental Properties of Life. Conditions on Early Earth. Evolution of Cells. The Tree of Life

Origins of Life. Fundamental Properties of Life. Conditions on Early Earth. Evolution of Cells. The Tree of Life The Tree of Life Chapter 26 Origins of Life The Earth formed as a hot mass of molten rock about 4.5 billion years ago (BYA) -As it cooled, chemically-rich oceans were formed from water condensation Life

More information

Sequence Based Bioinformatics

Sequence Based Bioinformatics Structural and Functional Analysis of Inosine Monophosphate Dehydrogenase using Sequence-Based Bioinformatics Barry Sexton 1,2 and Troy Wymore 3 1 Bioengineering and Bioinformatics Summer Institute, Department

More information

Essential knowledge 1.A.2: Natural selection

Essential knowledge 1.A.2: Natural selection Appendix C AP Biology Concepts at a Glance Big Idea 1: The process of evolution drives the diversity and unity of life. Enduring understanding 1.A: Change in the genetic makeup of a population over time

More information

Letter to the Editor. Department of Biology, Arizona State University

Letter to the Editor. Department of Biology, Arizona State University Letter to the Editor Traditional Phylogenetic Reconstruction Methods Reconstruct Shallow and Deep Evolutionary Relationships Equally Well Michael S. Rosenberg and Sudhir Kumar Department of Biology, Arizona

More information

What can sequences tell us?

What can sequences tell us? Bioinformatics What can sequences tell us? AGACCTGAGATAACCGATAC By themselves? Not a heck of a lot...* *Indeed, one of the key results learned from the Human Genome Project is that disease is much more

More information

Leber s Hereditary Optic Neuropathy

Leber s Hereditary Optic Neuropathy Leber s Hereditary Optic Neuropathy Dear Editor: It is well known that the majority of Leber s hereditary optic neuropathy (LHON) cases was caused by 3 mtdna primary mutations (m.3460g A, m.11778g A, and

More information

Tracing the origin and evolutionary history of plant nucleotide-binding site leucine-rich repeat (NBS-LRR) genes

Tracing the origin and evolutionary history of plant nucleotide-binding site leucine-rich repeat (NBS-LRR) genes Research Tracing the origin and evolutionary history of plant nucleotide-binding site leucine-rich repeat (NBS-LRR) genes Jia-Xing Yue 1,2, Blake C. Meyers 3, Jian-Qun Chen 1, Dacheng Tian 1 and Sihai

More information

Biological Systems: Open Access

Biological Systems: Open Access Biological Systems: Open Access Biological Systems: Open Access Liu and Zheng, 2016, 5:1 http://dx.doi.org/10.4172/2329-6577.1000153 ISSN: 2329-6577 Research Article ariant Maps to Identify Coding and

More information