Comparative analysis of complete chloroplast genome sequences of two subtropical trees, Phoebe sheareri and Phoebe omeiensis (Lauraceae)

Transcription

1 Tree Genetics & Genomes (2017) 13:120 DOI /s y ORIGINAL ARTICLE Comparative analysis of complete chloroplast genome sequences of two subtropical trees, Phoebe sheareri and Phoebe omeiensis (Lauraceae) Yu Song 1,2 & Xin Yao 1,2 & Yunhong Tan 1,2 & Yi Gan 3 & Junbo Yang 4 & Richard T. Corlett 1,2 Received: 12 April 2016 /Revised: 10 August 2017 /Accepted: 26 September 2017 # Springer-Verlag GmbH Germany 2017 Abstract Phoebe is an economically important genus from the family Lauraceae. It is widely distributed in tropical and subtropical Asia, but systematics of the genus is unclear, and currently there is no species-level phylogeny. Here, we determined the complete chloroplast genome sequences of two species with long-range PCR and next genome sequencing technologies, and identified mutation sites and highly variable regions. These highly variable sites were used to reconstruct the phylogeny. The plastomes of Phoebe sheareri and P. omeiensis were 152, 876, and 152, 855 bp, respectively. Comparative genomic analysis indicated that there are 222 mutation sites including 146 substitutions, 73 indels, and 3 microinversions in both plastomes. Fifty-six single-nucleotide changes were identified in genecoding regions, and 45 microsatellite sites were found for use in species identification. Fourteen divergence hotspots of 38 variable regions were located. Phylogeny was reconstructed using a Bayesian and maximum likelihood approach for 12 Phoebe species and other five related Lauraceae based on 15 of the highly variable regions including accd-psai, atpb-rbcl, ndhc-trnv, ndhf-rpl32, peta-psbj, psaa, psba-trnh, rbcl, rps8-rpl14, rps16-trnq, rpl32-trnl, trnc-petn, trnl-trnf, trnstrng,and ycf1 indicated that variability in the chloroplast regions proposed as variable is enough to detect divergence events among12taxaofphoebe, and that maybe also useful to help to elucidate further relationships among other taxa of the genus. Keywords Phoebe. Lauraceae. Chloroplast. Genome. Phylogenetic relationship Yu Song, Xin Yao, and Yunhong Tan are equal contributors to this work. Communicated by G. G. Vendramin Electronic supplementary material The online version of this article ( contains supplementary material, which is available to authorized users. * Junbo Yang jbyang@mail.kib.ac.cn * Richard T. Corlett corlett@xtbg.org.cn Center for Integrative Conservation, Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences, Mengla , China Southeast Asia Biodiversity Research Institute, Chinese Academy of Science, Yezin, Nay Pyi Taw, Myanmar School of Agriculture and Food Science, Zhejiang A & F University, Hangzhou , China Germplasm Bank of Wild Species, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming , China Introduction The genus Phoebe Nees in the family Lauraceae includes around 100 tree species distributed in tropical and subtropical Asia. The name was also previously used for the tropical American species of Cinnamomum, which have since been excluded (Huang et al. 2016). Phoebe is part of the Persea group of the Lauraceae and is probably monophyletic (Li et al. 2011; Song et al. 2017), although the precise generic boundaries are currently unclear and the correct application of many published names in this genus is still uncertain (www. theplantlist.org). Phoebe species provide commercially important timbers which are highly valued because of their brilliant color and remarkable durability (Wei and Werff 2008). Several species of Phoebe are used as medicinal plants and contain alkaloids, terpenoids, flavonoids, lignans, and steroids (Semwal and Semwal 2013). To distinguish these Phoebe species, molecular diagnostic methods were continuously improved in the past decade.

2 120 Page 2 of 10 Tree Genetics & Genomes (2017) 13:120 Molecular methods, including DNA barcoding and molecular phylogenetics, provide effective information for identification and comparison of closely related genera, using both chloroplast genomic markers and nuclear sequences. Rohwer (2000) used the chloroplast genomic marker matk to investigate the relationships of genera of Lauraceae and indicate that Phoebe formosana and Persea americana formed a weakly supported clade with Persea indica, Persea lingue, Apollonias barbujana, Dehaasia cuneata, andalseodaphne perakensis (Rohwer 2000). Chanderbali et al. (2001) used chloroplast sequences (trnltrnf, psba-trnh, trnt-trnl, andrpl16) and nuclear barcoding markers (26S ribosomal DNA (rdna) and ITS rdna) to reconstruct the phylogenetic relationships of Lauraceae and show that P. formosana is most closely related to Alseodaphne semecarpifolia (Chanderbalietal.2001). Rohwer et al. (2009) usedits to investigate the relationships within the Persea group, including ten Phoebe species which form an apparently monophyletic clade with a sister species Persea nudigemma (Rohwer et al. 2009), and Li et al. (2011) assessed the phylogenetic interrelationships of the Persea group using two nuclear markers ITS and LEAFY intron and supported the relationship between P. nudigemma and Phoebe species (Li et al. 2011). Although the sequence data of nuclear markers used in these studies allowed a clearer resolution of phylogeny of the Phoebe species, they were much less successful using chloroplast genomic markers such as matk, trnk, accd, ndhj, psbc-trns, rpob, rpoc1, trnd-trnt2, trnh-trnk, psba-trnh, psbb-psbh, trns-trng, rpob-trnc, and trns-trnfm (Rohwer et al. 2009; Song et al. 2015). This raises a question if there are other molecular markers from chloroplast genomes of Phoebe useful to reconstruct the phylogeny of the genus. The comparisons of the entire genome are useful to find variable regions that are helpful to resolve phylogenetic relationships among species complexes. Comparative analysis among four plastid genomes across the Solanaceae identified the 21 most variable intergenic regions within the family (Bausher et al. 2006). Four highly variable intergenic regions for Solanum species, trnk-rps16, rps16-trmq, trns-trng,and petn-psbm, were further identified through comparing the chloroplast genomes of Solanum tuberosum and S. bulbocastanum (Gargano et al. 2012). For species of the genus Camellia (Theaceae), 13 chloroplast genomes were sequenced and phylogenetic relationships among the representative species were successfully reconstructed (Huang et al. 2014). For the bamboo tribe Arudinarieae (Poaceae), 25 complete plastomes were successfully used for reconstructing the phylogenetic structure of the major lineages (Ma et al. 2014). Lauraceae includes over 3500 species all over the world; however, only six species have assembled chloroplast genome sequences (Song et al. 2015; Song et al. 2016). From the plastomes of two Machilus species, seven highly variable regions such as the second intron of clpp, ndhf-rpl32, trnqpsbi, rps8-rpl14, ycf2, rpl32-trnl, and ycf1 were precisely located for phylogenetic studies at the species level in Machilus (Song et al. 2015). Here, we sampled two species of Phoebe (Lauraceae) for sequencing the complete chloroplast genomes. Phoebe sheareri (Hemsl.) Gamble, under second-class national protection in China (IUCN 2012), is widely distributed in South China and Vietnam, while Phoebe omeiensis R.H. Miao, incorrectly treated as a synonym of Phoebe faberi (Wei and Werff 2008), occurs mainly at low elevations in Sichuan of SW China (Miao 1993). Entire chloroplast genomes of both Phoebe species were used to examine mutation events for species delineation and to identify the divergence hotspots for DNA barcoding and phylogenetic reconstruction. Materials and methods DNA extraction and sequencing We collected fresh leaves of P. sheareri and P. omeiensis from trees planted in the Xishuangbanna Tropical Botanical Garden (XTBG) on December 12, We also took photos of the types (Supplementary Fig. S1) and compared them with the fruiting branches (Supplementary Fig. S2) of both trees to confirm their identifications. Genomic DNA was extracted from 2-g young leaves using the CTAB method (Doyle and Doyle 1987), in which 4% CTAB was used, and approximately 1% polyvinyl polypyrrolidone (PVP) and 0.2% DL-dithiothreitol (DTT) were added. Long-range PCR was performed following Yang et al. 2014), with their nine pairs of novel universal primers. Purified PCR products were mixed with equal parts. According to the manufacturer s instructions (Illumina Nextera XT Library), the mixture was fragmented and used to construct 500-bp short-insert libraries. DNA from both species was indexed by tags and pooled together in one lane of a Genome Analyzer (Illumina HiSeq 2000) for sequencing at the Germplasm Bank of Wild Species, Kunming Institute of Botany (KIB) in Kunming, China. We also sampled other 17 individuals of 12 Phoebe taxawhich belong to two traditionally groups distinguished by the absence (P. lanceolata and P. neuranthoides) or presence (other 11 taxa) of hairs on the outside of the tepals in flower (Wei and Werff 2008). Six of 12 Phoebe taxa were sampled in Yunnan of SW China; P. omeiensis and P. zhennan weresampledinsichuanofsw China; P. hungmaoensis was sampled in Hainan of SE China; P. sheareri was sampled in Anhui and Hubei of central China; P. neuranthoides was sampled in Gansu of NW China; and P. megacalyx was sampled in Ha Giang of North Vietnam (Supplementary Fig. S1). Their leaves were used to extract DNA. Effective PCR products were purified by DNA gel

3 Tree Genetics & Genomes (2017) 13:120 Page 3 of extraction kit (Axygen) and sent for Sanger sequencing subsequently. Chloroplast genome assembly and annotation We applied stringent sequence filtering with the NGS QC Tool Kit to select clean reads (Patel and Jain 2012), as the algorithms used in de novo chloroplast genome construction from short reads may be severely inhibited by sequencing errors. Chloroplast genome assembly was first carried out with the high-quality short read de novo assembling program CLC Genomics Workbench version 6.5 (Qiagen), and then the contigs were aligned with a very similar reference sequence (Song et al. 2015), the complete chloroplast genome of Machilus balansae (in a related genus in the Persea group of the Lauraceae) in BioEdit software ( ncsu.edu/bioedit/bioedit.html). Finally, we used the Dual Organellar Genome Annotator (DOGMA) software to annotate the genes encoding proteins, transfer RNAs (trnas), and ribosomal RNAs (rrnas) on the Phoebe plastomes (Wyman et al. 2004). The genome map of P. sheareri and P. omeiensis was drawn by OrganellarGenomeDRAW tool (OGDRAW) (Lohse et al. 2013). Mutation event detection and sliding window analysis of the plastomes After alignment using MAFFT version 7 software (Katoh and Standley 2013), the sequences were manually adjusted with BioEdit, especially for inversion sites. We then performed microstructural mutation detection and sliding window analysis to assess the variability (Pi) all over the plastomes in DnaSP version 5 software (Librado and Rozas 2009). The window length was set to 600 bp and the step size to 200 bp. Phylogenetic analyses DNA fragments for accd-psai, atpb-rbcl, ndhc-trnv, ndhfrpl32, peta-psbj, psaa, psba-trnh, rbcl, rps8-rpl14, rps16- trnq, rpl32-trnl, trnc-petn, trnl-trnf, trns-trng, andycf1 were PCR amplified from these samples with the reported primers and new primers (Supplementary Table S2). DNA sequences were aligned with MAFFT version 7 software and manually adjusted to account for obvious or missing inserts with BioEdit software. The combined chloroplast DNA dataset, including accd-psai, atpb-rbcl, ndhc-trnv, ndhfrpl32, peta-psbj, psaa, psba-trnh, rbcl, rps8-rpl14, rps16- trnq, rpl32-trnl, trnc-petn, trnl-trnf, trns-trng, andycf1, was tested using the jmodeltest 2.0 program, and the optimal model of BTPM1uf+G^ (freqa = , freqc = , freqg = , freqt = , R(a) [AC] = , R(b) [AG] = , R(c) [AT] = , R(d) [CG] = , R(e) [CT] = , R(f) [GT] = , gamma shape = ) wasselected(darribaetal.2012). Phylogenetic relationships were reconstructed using Bayesian inference (BI) and maximum likelihood (ML) methods in MrBayes version (Ronquist and Huelsenbeck 2003) and RAxML version 8 program (Stamatakis 2014). Machilus balansae (GenBank accession No. KT348517), Machilus yunnanensis (GenBank accession No. KT348516), P. americana (GenBank accession No. KX437771), Cinnamomum kanehirae (GenBank accession No. KR014245), and Litsea glutinosa (GenBank accession No. KU382356) in the Lauraceae were used as outgroups (Song et al. 2016) for analysis of the sequences including accd-psai, atpb-rbcl, ndhc-trnv, ndhf-rpl32, peta-psbj, psaa, psba-trnh, rbcl, rps8-rpl14, rps16-trnq, rpl32-trnl, trnc-petn, trnl-trnf, trns-trng, andycf1 from their plastomes. For BI analysis, the combined data was run for one million generations, and a burn-in of 25% was used for the analysis. For ML analysis, 1000 bootstrap replicates were performed in each analysis to obtain the confidence support. Results General features of Phoebe sheareri and P. omeiensis chloroplast genomes The chloroplast genome of P. sheareri (deposited in GenBank: KX437773), with a length of 152,876 bp, was 21 bp larger than that of P. omeiensis (deposited in GenBank: KX437772) (Fig. 1). The G+C content is 39% in both species. Both Phoebe chloroplast genomes include a pair of inverted repeats (IRs) of 20,093 bp in P. sheareri and 20,076 bp in P. omeiensis, separated by a small single copy (SSC) region of 18,915 bp in P. sheareri and18,928bpinp. omeiensis,and alargesinglecopy(lsc)regionof93,775bpinboth P. sheareri and in P. omeiensis (Table 1). A total of 128 genes were detected on both Phoebe plastomes, 113 of which are single copy, while 15 are duplicated in IRs (Supplementary Table S3). Among these genes, there are 84 protein-coding genes, 36 transfer RNA (trna) genes, and eight ribosome (rrna) genes (Fig. 1). In addition, the ycf15 gene located in the LSC of both genomes was pseudogenized (Supplementary Table S3). Genome substitutions between Phoebe sheareri and P. omeiensis In the plastomes of P. sheareri and P. omeiensis, we detected 132 SNPs in the LSC region, 9 in the SSC region, and 5 in the IR regions. There were 56 SNPs, including 34 transition (Ts) and 22 transversion (Tv) events in the gene coding regions, and 90 SNPs, including 46 Ts and 44 Tv in non-coding regions (Supplementary Table S3). Among the Tv, seven were between T and A, seven were between C and G, and the other

4 120 Page 4 of 10 Tree Genetics & Genomes (2017) 13:120 Fig. 1 Structure of the plastomes of Phoebe sheareri and P. omeiensis (Lauraceae). The annotation of the genome was performed using DOGMA. The genome map was drawn by OGDRAW. The genes that are drawn outside of the circle are transcribed clockwise, while those inside are counterclockwise Table 1 Summary of two complete plastomes of Phoebe Phoebe sheareri Phoebe omeiensis Total cpdna size 152, ,855 Length of large single copy (LSC) region 93,775 93,775 Length of inverted repeat (IRs) region 20,093 20,076 Length of small single copy (SSC) region 18,915 18,928 Total GC content (%) LSC IR SSC Total number of genes Protein encoding trna rrna 4 4

5 Tree Genetics & Genomes (2017) 13:120 Page 5 of were related to GC content change (Fig. 2). Further, we compared the transition/transversion ratio (Ts/Tv) on different regions. Exon regions have the highest Ts/Tv ratio of 1.545, while intergenic regions have the rate and intron regions have the value Genome indels between Phoebe sheareri and P. omeiensis We detected 68 indels in the LSC region and 5 in the SSC region. Sizes of the 73 indels varied from 1 to 40 bp. There were 61 in intergenic regions, 12 in introns, and none in exons. From these indels (Table 2), we applied a length threshold greater than 8 bp for mono- and 8 bp for di-nucleotide repeat patterns and further identified a total of 45 simple sequence repeats (SSRs). All of these SSRs are single-nucleotide repeats A/T ranging from 8 to 16 bp. From the other 28 non- SSR indels (Table 3), we detected the largest indel with the size of 40 bp located in the peta-psbj intergenic region. In addition, three microinversions were detected in the rps4-trnt, ycf4-cema, andccsa-ndhd intergenic regions (Table 3). Identification of the most variable regions in Phoebe sheareri and P. omeiensis SNP and indel markers are not randomly distributed in the genome but cluster in divergence hot spots. Between the two Phoebe species, these values varied from 0 to , with a mean of Thirty eight variable loci (Pi > 0.002) were identified (Fig. 3), of which 14 hypervariable regions (Pi > 0.004), including psba-trnh, rps16-trnq, trncpetn, trns-trng, ndhc-trnv, atpb-rbcl, rbcl, accdpsai, peta-psbj, rps8-rpl14, andpsaa, and three regions of ycf2 were precisely located (Fig. 3). Among these variable loci, ndhc-trnv and rbcl had the highest values of all (Pi > 0.008); rps16-trnq, accd-psai, and rps8- rpl14 had much higher values than the other nine variable loci (Pi > 0.006). All of these 14 variable loci lie in the LSC region and are excellent candidate markers for phylogenetic analysis. Highly variable markers for evaluating Phoebe phylogeny at the species level PCR success levels for the 15 highly variable non-coding regions in all 19 Phoebe individuals were 100% (Supplementary Table S2). Phylogenetic relationships were obtained with matrices of the 15 highly variable regions (Fig. 4). The alignment is characters 14,177 bp long, and the matrix is characterized by extremely low sequence diversity, with only 138 variable sites (0.97%) and 104 parsimony-informative characters (0.73%) across ingroup taxa. The topologies using the Bayesian inference (BI) and maximum likelihood (ML) methods were highly similar, and the 12 taxa were divided into four clades (Fig. 4). The first divergent clade contained P. hungmaoensis, P. glaucophylla, P. macrocarpa, and P. megacalyx with bootstrap (BS) 100% and posterior probability (PP) 1.00, the second contained P. sheareri and P. zhennan with BS 100% and PP 1.00, the third contained P. puwenensis and P. rufescens with BS 100% and PP 1.00, and the fourth clade contained P. neurantha, P. lanceolata, P. omeiensis, and P. neuranthoides with BS 100% and PP Discussion This study presents two complete chloroplast genomes for rare woody plants in the genus Phoebe obtained by using Illumina high-throughput sequencing technology (Fig. 1). Both genomes are very similar in structure and size, but the IR regions of P. omeiensis are 17 and 38 bp shorter than those of P. sheareri and C. kanehirae, while they are 2 bp larger than those of M. balansae and M. yunnanensis (Song et al. 2015; Wu et al. 2017). The IR regions of these five species in the Lauraceae are much shorter than those of Calycanthus floridus (23,295 bp) in the Calycanthaceae, which is in the Fig. 2 The patterns of nucleotide substitutions among Phoebe sheareri and P. omeiensis (Lauraceae). The patterns were divided into six types as indicated by the six non-strand-specific base-substitution types. The plastome of P. sheareri was used as a reference

6 120 Page 6 of 10 Tree Genetics & Genomes (2017) 13:120 Table 2 Location of simple sequence repeats in the Phoebe plastomes No. of repeats No. Location Region Motif P. sheareri P. omeiensis 1 matk-trnk Intergenic A trnk-rps16 Intergenic T trnk-rps16 Intergenic T trnk-rps16 Intergenic A trnk-rps16 Intergenic T rps16 Intron A rps16 Intron T rps16-trnq Intergenic T psbk-psbi Intergenic A trng-trng Intergenic T trng-trng Intergenic T atpa-atpf Intergenic A atpf-atpf Intergenic A atph-atpi Intergenic A rps2-rpoc2 Intergenic T rpoc1 Intron T rpob-trnc Intergenic A psbm-trnd Intergenic T psbm-trnd Intergenic A trnd-trny Intergenic A trne-trnt Intergenic T trng-trnm Intergenic A psaa-ycf3 Intergenic T ycf3 Intron T ycf3-trns Intergenic A trns-rps4 Intergenic A ndhc-trnv Intergenic T trnm-atpe Intergenic T ycf4-cema Intergenic A psbe-petl Intergenic T rps18-rpl20 Intergenic T rpl20-rps12 Intergenic A clpp Intron T clpp Intron A clpp Intron T petb-petb Intergenic A rps8-rpl14 Intergenic T rpl14-rpl16 Intergenic T rpl16 Intron A rpl16-rps3 Intergenic T rpl2-rpl23 Intergenic T rpl2-rpl23 Intergenic T rpl32-trnl Intergenic T rpl32-trnl Intergenic A rps15-ycf1 Intergenic T same order Laurales (Goremykin et al. 2003). Similar-length variations in the IR regions of chloroplast genomes resulting from IR contraction have been reported previously in date palm and species from the subclass Commelinidae (Yang et al. 2014; Redwan et al. 2015). The boundaries of the IR regions with LSC and SSC in the reported chloroplast genomes of Laurales are located in two gene sequences, ycf1 and ycf2, which showed incomplete duplication. Comparative analysis indicated that the length of the truncated ycf1 gene differed among the chloroplast genomes from six species in the Laurales. The length of the truncated ycf1 gene of P. omeiensis is 17 and 27 bp shorter than those of P. sheareri and C. kanehirae, and 1 bp longer than those of M. balansae and M. yunnanensis. This confirms that the cause of the IR contraction in the Laurales is the truncation of the ycf1 gene at the IR boundary. Although the IR regions experience significant variations in length at high taxonomic levels, we only detected five SNPs in the IR regions of the Phoebe plastid genomes, indicating that microstructural mutations are rare in these regions. In the SSC region, nine SNPs and four indels were detected, but most variations were located in the LSC region, with 132 SNPs (90.4%) and 71 indels (93.4%). The LSC region contained 65 protein-coding and 22 trna genes, which was separated into dozens of coding and non-coding regions. A total of 83 SNPs and 69 indels were located in non-coding regions, compared with 49 SNPs and no indel in coding regions. SNPs and indels are useful for species delineation, population studies, and phylogenetic analysis. Both markers, especially the detected 45 SSRs, could be selected for species delineation and population studies within Phoebe. All of the mutational dynamics including SNPs and indels created the highly variable regions in the genome. For coding regions, rbcl, psaa, and ycf2 were particularly variable (Fig. 3) in both Phoebe plastid genomes. Among them, the rbcl locus is a core DNA barcode in land plants (CBOL Plant Working Group(A DNA barcode for land plants 2009), psaa takes part in photosystem II, and ycf2 has an unknown function. For non-coding regions, we identified nine variable regions (rps16-trnq, ndhc-trnv, accd-psai, rps8-rpl14, psbatrnh, trns-trng, peta-psbj, atpb-rbcl, andtrnc-petn) in both Phoebe plastid genomes. The psba-trnh, rps16- trnq, trns-trng, ndhc-trnv, atpb-rbcl, accd-psai, and peta-psbj loci have been reported before as highly variable regions in seed plants (Dong et al. 2012), and the trnc-petn locus was screened for Solanum (Gargano et al. 2012). The rps8-rpl14 locus has been reported as highly variable in Machilus and other plants (Song et al. 2015; Prince2015).Thesehighlyvariableregionswere successfully used for phylogenetic studies among the five genera and the main clades within Phoebe (Fig. 4), but they are limited to resolve the species delineation within Phoebe. All of these loci showed very little variation and

7 Tree Genetics & Genomes (2017) 13:120 Page 7 of Table 3 Forms and numbers of indel mutation events in the plastome between the two Phoebe species No. Location Region Motif Size Direction a 1 trnh-psba Intergenic ca 2 Deletion 2 trnh-psba Intergenic ctttg 5 Deletion 3 matk-trnk Intergenic t 1 Insertion 4 rps16-trnq Intergenic atttat 6 Insertion 5 rps16-trnq Intergenic a 1 Deletion 6 trng intron t 1 Insertion 7 rpob-trnc Intergenic tttaattatggat 13 Insertion 8 rpob-trnc Intergenic aaat 4 Deletion 9 psbm-trnd Intergenic tacatggaccaggagcaatcg 21 Insertion 10 trnt-psbd Intergenic tatatataggatact 15 Insertion 11 psbc-trns Intergenic ttagg 5 Insertion 12 psaa-ycf3 Intergenic agtcattaataagaga 16 Insertion 13 trnt-trnl Intergenic g 1 Insertion 14 trnt-trnl Intergenic aa 2 Deletion 15 trnf-ndhj Intergenic ttcctcactccctcttac 18 Insertion 16 trnv-trnm Intergenic t 1 Deletion 17 rbcl-accd Intergenic tatgtatatgg 11 Insertion 18 ycf4-cema Intergenic attaatattttt 12 Deletion 19 ycf4-cema Intergenic ttctat 6 Deletion 20 peta-psbj Intergenic aaagt 5 Deletion 21 peta-psbj Intergenic tcc 3 Insertion 22 peta-psbj Intergenic ataataaataaggatttgga ataataaataaggatttgga 40 Deletion 23 peta-psbj Intergenic gcggaacagatactatg gcggaacagatactatg 17 Deletion 24 psbe-petl Intergenic cctttctt 8 Deletion 25 psbe-petl Intergenic tgaat 5 Deletion 26 trnp-psaj Intergenic tttggttt 8 Deletion 27 rpl16-rps3 Intergenic cattttt 7 Deletion 28 trnv-rrn16 Intergenic ataaccaagaagataaga 18 Deletion 29 rps4-trnt Intergenic ga 2 Inversion 30 ycf4-cema Intergenic ag 2 Inversion 31 ccsa-ndhd Intergenic ctact 5 Inversion a The plastome of P. sheareri was used as a reference Fig. 3 Sliding window analysis of the whole plastomes of Phoebe sheareri and P. omeiensis (Lauraceae). (Window length 600 bp, step size 200 bp) X-axis: position of the midpoint of a window, Y-axis: nucleotide diversity of each window. Blue circles identify the positions of indels, red circles identify the positions of SNPs, and the line segments parallel to the X-axis identify the location of the LSC, SSC, and IR regions

8 120 Page 8 of 10 Tree Genetics & Genomes (2017) 13:120

9 Tree Genetics & Genomes (2017) 13:120 Page 9 of R Fig. 4 Phylogenetic relationships of 19 individuals of 12 taxa of Phoebe constructed by Bayesian inference (BI) (a) and maximum likehood (ML) (b) withcinnamomum kanehirae, Litsea glutinosa, Persea americana, Machilus yunnanensis, and Machilus balansae as outgroups. Sequencecombined matrix based on accd-psai, atpb-rbcl, ndhc-trnv, ndhfrpl32, peta-psbj, psaa, psba-trnh, rbcl, rps8-rpl14, rps16-trnq, rpl32-trnl, trnc-petn, trnl-trnf, trns-trng, and ycf1 used to construct the phylogenetic trees. In BI and ML methods, the evolutionary model was TPM1uf+G which is determined by the jmodeltest 2.0 program. The BI analysis was run for 1,000,000 generations, and a burn-in of 25% was used for the analysis. The ML method used 1000 reiterations for bootstrapping analysis the lack of phylogenetically informative sites. Besides the highly variable regions mentioned here, other 14 chloroplast genomic markers including accd, matk, ndhj, psbatrnh, psbb-psbh, psbc-trns, rpob, rpob-trnc, rpoc1, trnd-trnt2, trnh-trnk, trnk, trns-trng, andtrns-trnfm only partially resolve the phylogenetic and species identification problems within the Phoebe, Persea, and Machilus genera with over 100 taxa (Rohwer et al. 2009; Li et al. 2011), suggesting that the chloroplast markers may not be phylogenetically informative for species-rich, morphologically diverse lineages. Based on two variable regions from nuclear ITS and LEAFY intron II, previous molecular phylogenetic analyses indicated that the genus Phoebe might be monophyletic (Rohwer et al. 2009; Li et al. 2011), which is further confirmed in the present study. Twelve species of the genus Phoebe are found in four relatively well-supported clades (100% PP and 1.00 BS, respectively). One of the four clades consists of P. omeiensis, P. neuranthoides, P. lanceolata, and P. neurantha, implying that there are close relationships between P. omeiensis and another three Phoebe species. And P. omeiensis differs from P. neuranthoides, by its infructescence sparse pubescent and tepals densely pubescent on both sides as in previously described traits (Miao 1993). Acknowledgements We would like to acknowledge Jing Yang, Juanhong Zhang, Chun-yan Lin, and Ji-xiong Yang at Germplasm Bank of Wild Species of Kunming Institute of Botany, Chinese Academy Sciences, for sequencing technology. This work was supported by the National Natural Science Foundation of China (No ), the CAS BLightofWestChina^Program, the 1000 Talents Program (WQ ), the scientific research fund of Zhejiang A&F University (2014FR007), and the Zhejiang Provincial Natural Science Foundation of China (LQ15C020002). We sincerely thank five anonymous referees and Dr. Giovanni Vendramin for their critical and invaluable comments that greatly improved our manuscript. Compliance with ethical standards Data archiving statement The complete chloroplast genome sequence data of Phoebe sheareri and Phoebe omeiensis and the Sanger sequence data of accd-psai, atpb-rbcl, ndhc-trnv, ndhf-rpl32, peta-psbj, psaa, psba-trnh, rbcl, rps8-rpl14, rps16-trnq, rpl32-trnl, trnc-petn, trnltrnf, trns-trng, and ycf1 of 12 Phoebe species will be submitted to GenBank of NCBI through the revision process. All of the accession numbers from NCBI must be supplied prior to final acceptance of the manuscript. Conflict of interest statement The authors declare that they have no conflicts of interest. The authors alone are responsible for the content and writing of this article. References CBOL Plant Working Group A DNA barcode for land plants (2009) Proc. Natl Acad Sci U S A 106(31): /pnas Bausher MG, Singh ND, Lee SB, Jansen RK, Daniell H (2006) The complete chloroplast genome sequence of Citrus sinensis (L.) Osbeck var Ridge Pineapple : organization and phylogenetic relationships to other angiosperms. BMC Plant Biol 6:21 Chanderbali AS, van der Werff H, Renner SS (2001) Phylogeny and historical biogeography of Lauraceae: evidence from the chloroplast and nuclear genomes. Ann Mo Bot Gard 88(1): org/ / Darriba D, Taboada GL, Doallo R, Posada D (2012) jmodeltest 2: more models, new heuristics and parallel computing. Nat Methods 9(8): Dong W, Liu J, Yu J, Wang L, Zhou S (2012) Highly variable chloroplast markers for evaluating plant phylogeny at low taxonomic levels and for DNA barcoding. PLOS ONE 7: e35071 Doyle JJ, Dickson EE (1987) Preservation of Plant-Samples for DNA Restriction Endonuclease Analysis. Taxon 36 (4): doi: Gargano D, Scotti N, Vezzi A, Bilardi A, Valle G, Grillo S, Cozzolino S, Cardi T (2012) Genome-wide analysis of plastome sequence variation and development of plastidial CAPS markers in common potato and related Solanum species. Genet Resour Crop Evol 59(3): Goremykin V, Hirsch-Ernst K, W lfl S, Hellwig F (2003) The chloroplast genome of the Bbasal^ angiosperm Calycanthus fertilis structural and phylogenetic analyses. Plant Syst Evol 242(1): Huang JF, Li L, van der Werff H, Li HW, Rohwer JG, Crayn DM, Meng HH, van der Merwe M, Conran JG, Li J (2016) Origins and evolution of cinnamon and camphor: A phylogenetic and historical biogeographical analysis of the Cinnamomum group (Lauraceae). Mol Phylogenet Evol 96:33 44 Illumina HiSeq (2000) IUCN (2012) Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol 30(4): Li L, Li J, Rohwer JG, van der Werff H, Wang ZH, Li HW (2011) Molecular phylogenetic analysis of the Persea group (Lauraceae) and its biogeographic implications on the evolution of tropical and subtropical amphi-pacific disjunctions. Am J Bot 98(9): Librado P, Rozas J (2009) DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25(11): Lohse M, Drechsel O, Kahlau S, Bock R (2013) OrganellarGenomeDRAW a suite of tools for generating physical maps of plastid and mitochondrial genomes and visualizing expression data sets. Nucleic Acids Res 41(Web Server issue):w575 W Ma PF, Zhang YX, Zeng CX, Guo ZH, Li DZ (2014) Chloroplast phylogenomic analyses resolve deep-level relationships of an intractable bamboo tribe Arundinarieae (Poaceae). Syst Biol 63(6):

10 120 Page 10 of 10 Tree Genetics & Genomes (2017) 13:120 Miao RH (1993) New species from Chinese flora. Acta Sci Nat Univ Sunyatseni 132:56 68 Patel RK, Jain M (2012) NGS QC Toolkit: a toolkit for quality control of next generation sequencing data. PLoS One 7(2): e Prince LM (2015) Plastid primers for angiosperm phylogenetics and phylogeography. Appl Plant Sci 3(6) Redwan RM, Saidin A, Kumar SV (2015) Complete chloroplast genome sequence of MD-2 pineapple and its comparative analysis among nine other plants from the subclass Commelinidae. BMC Plant Biol 15: Rohwer JG (2000) Toward a phylogenetic classification of the Lauraceae: evidence from matk sequences. Syst Bot 25(1): Rohwer JG, Li J, Rudolph B, Schmidt SA, van der Werff H, Li HW (2009) Is Persea (Lauraceae) monophyletic? Evidence from nuclear ribosomal ITS sequences. Taxon 58(4): Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19(12): Semwal DK, Semwal RB (2013) Ethnobotany, pharmacology and phytochemistry of the genus Phoebe (Lauraceae). Mini-Rev Organic Chem 10(1):12 26 Song Y, Dong WP, Liu B, Xu C, Yao X, Gao J, Corlett RT (2015) Comparative analysis of complete chloroplast genome sequences of two tropical trees Machilus yunnanensis and Machilus balansae in the family Lauraceae. Front Plant Sci 6. Fpls Song Y, Yao X, Tan YH, Gan Y, Corlett RT (2016) Complete chloroplast genome sequence of the avocado: gene organization, comparative analysis, and phylogenetic relationships with other Lauraceae. Can J For Res 46(11): Song Y, Yu WB, Tan YH, Liu B, Yao X, Jin JJ, Padmanaba M, Yang JB, Corlett RT (2016) Evolutionary comparisons of the chloroplast genome in Lauraceae and insights into loss events in the Magnoliids. Genome Biol Evol 9 (9): doi: evx180 Stamatakis A (2014) RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30(9): Wei FN, Werff HVD (2008) Flora of China, in Dipterocarpaceae, Vol. 13, eds Z. Y. Wu, P. H. Raven, and D. Y. Hong (St. Louis, MO: Science Press, Beijing, and Missouri Botanical Garden Press), Wu CC, Chu FH, Ho CK, Sung CH, Chang SH (2017) Comparative analysis of the complete chloroplast genomic sequence and chemical components of Cinnamomum micranthum and Cinnamomum kanehirae. Holzforschung 71: Wyman SK, Jansen RK, Boore JL (2004) Automatic annotation of organellar genomes with DOGMA. Bioinformatics 20(17): Yang JB, Li DZ, Li HT (2014) Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs. Mol Ecol Resour 14 (5): doi: