OCTOBER 28, 2005 VOLUME 280 NUMBER 43 JOURNAL OF BIOLOGICAL CHEMISTRY 36065

Transcription

1 THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 280, NO. 43, pp , October 28, by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Essential Mechanisms in the Catalysis of Peptide Bond Formation on the Ribosome * Received for publication, July 21, 2005, and in revised form, August 22, 2005 Published, JBC Papers in Press, August 29, 2005, DOI /jbc.M Malte Beringer 1, Christian Bruell 1, Liqun Xiong, Peter Pfister, Peter Bieling 2, Vladimir I. Katunin, Alexander S. Mankin, Erik C. Böttger, and Marina V. Rodnina 3 From the Institute of Physical Biochemistry, University of Witten/Herdecke, Stockumer Strasse 10, Witten, Germany, the Institute of Medical Microbiology, University of Zurich, Gloriastrasse 30/32, 8006 Zurich, Switzerland, the Center for Pharmaceutical Biotechnology, University of Illinois, Chicago, Illinois 60607, and the Petersburg Nuclear Physics Institute, Russian Academy of Sciences, Gatchina, Russia Peptide bond formation is the main catalytic function of the ribosome. The mechanism of catalysis is presumed to be highly conserved in all organisms. We tested the conservation by comparing mechanistic features of the peptidyl transfer reaction on ribosomes from Escherichia coli and the Gram-positive bacterium Mycobacterium smegmatis. In both cases, the major contribution to catalysis was the lowering of the activation entropy. The rate of peptide bond formation was ph independent with the natural substrate, aminoacyl-trna, but was slowed down 200-fold with decreasing ph when puromycin was used as a substrate analog. Mutation of the conserved base A2451 of 23 S rrna to U did not abolish the ph dependence of the reaction with puromycin in M. smegmatis, suggesting that A2451 did not confer the ph dependence. However, the A2451U mutation alters the structure of the peptidyl transferase center and changes the pattern of ph-dependent rearrangements, as probed by chemical modification of 23 S rrna. A2451 seems to function as a pivot point in ordering the structure of the peptidyl transferase center rather than taking part in chemical catalysis. * The work was supported by grants from the Deutsche Forschungsgemeinschaft (to M. V. R.), European Union (to M. V. R.), Alfried Krupp von Bohlen und Halbach-Stiftung (to M. V. R.), Fonds der Chemischen Industrie (to M. V. R.), Swiss National Science Foundation (to E. C. B.), Bonizzi-Theler Stiftung (to E. C. B.), Russian Foundation for Basic Research (to V. I. K.), and National Institutes of Health Grant RO1 GM59028 (to A. S. M.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 Both authors contributed equally to this work. 2 Present address: EMBL Heidelberg, Meyerhofstrasse 1, Heidelberg, Germany. 3 To whom correspondence should be addressed: Inst. of Physical Biochemistry, University of Witten/Herdecke, Stockumer Str. 10, Witten, Germany. Tel.: ; Fax: ; rodnina@uni-wh.de. 4 The abbreviations used are: aa-trna, aminoacyl-trna; DMS, dimethyl sulfate; CMCT, 1-cyclohexyl-3-(2-morpholinoethyl)-carbodiimide metho-p-toluenesulfonate; Me 2 SO, dimethyl sulfoxide; EF-Tu, elongation factor Tu; HPLC, high pressure liquid chromatography; Bicine, N,N-bis(2-hydroxyethyl)glycine; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; Pipes, 1,4- piperazinediethanesulfonic acid; WT, wild type. Ribosomes catalyze peptide bond formation between aminoacyltrna (aa-trna) 4 bound to the A site of the ribosome and peptidyltrna at the P site. The active site for peptide bond formation, the peptidyl transferase center, is located on the large (50 S) ribosomal subunit. High-resolution crystal structures of the 50 S subunit have revealed that the peptidyl transferase center is composed of RNA (23 S rrna), with no protein within 15 Å of the active site (1, 2). This implies that peptide bond formation is catalyzed by RNA and, thus, the ribosome is a ribozyme. The peptide bond is formed as a result of nucleophilic attack by the -amino group of aa-trna on the ester carbonyl group of peptidyltrna. The first step is the deprotonation of the -NH 3 group to create the nucleophilic NH 2 group. The pk a of the -NH 3 group in aa-trna is estimated to be around 8, and it is likely that the proton is accepted by water (3). Subsequent nucleophilic attack of the -NH 2 group on the electrophilic carbonyl group leads to the formation of the zwitterionic tetrahedral intermediate, which, by deprotonation, forms the negatively charged tetrahedral intermediate. The breakdown of the tetrahedral intermediate is initiated by donating a proton back to the leaving oxygen to form the products, i.e. P-site deacylated trna and A-site peptidyl-trna. In principle, the ribosome may catalyze the reaction by several mechanisms, such as proper positioning of the peptidyl and aminoacyl ends of the trnas in the active site in a conformation suitable for the spontaneous reaction, general base-acid catalysis during deprotonation and protonation, or electrostatic stabilization of the transition state(s) (4 9). The ph dependence of peptidyl transfer reaction catalyzed by Escherichia coli ribosomes suggested the importance of an ionizing group of the ribosome with a pk a of 7.5, which could contribute to chemical catalysis (10). Based on the crystal structure of the 50 S subunit from Haloarcula marismortui, a model was proposed suggesting that one of the RNA bases located within the peptidyl transferase center takes part in the chemical mechanism of peptide bond formation (2). In this model, A2451 was proposed to function as a general base that abstracts a proton from the attacking -amino group and/or stabilizes the oxyanion of the tetrahedral intermediate, thereby accelerating the intermediate formation. As general base catalysis in an aqueous medium of neutral ph requires that the base is ionizing at that ph, it was postulated that the pk a of A2451 is shifted toward neutrality by a network of interactions within the peptidyl transferase center (2). Another likely role of A2451 is to correctly position the substrate in the active center by forming a hydrogen bond between the attacking -NH 2 group and the 2 OH group of A2451 (11, 12). A number of studies were performed to examine these models. Crystal structures of 50 S subunits with different substrate analogs (11) and biochemical experiments (13) provided evidence against stabilization of the transition state oxyanion by a pk a -perturbed RNA base in the peptidyl transferase center but did not exclude other potential roles of A2451 in catalysis. In E. coli, any mutation of A2451 is lethal (14, 15), which supports an important functional role of the base. Nevertheless, ribosomes carrying mutations at A2451 exhibited considerable catalytic activity in vitro (14, 16). Rapid kinetic analysis has shown that although the major part of the catalysis is contributed by substrate positioning (10, 17), the A2451U mutation reduced the rate of puromycin reaction by about 150-fold (10, 18) and eliminated the inhibition of the reaction by ionization of a ribosomal group with a pk a of 7.5 (10). These effects could be explained either by A2451 acting as a general acid/base or by OCTOBER 28, 2005 VOLUME 280 NUMBER 43 JOURNAL OF BIOLOGICAL CHEMISTRY 36065

2 conformational changes in the peptidyl transferase center caused by the A2451U mutation. Further biochemical and genetic work has shown that mutations of G2447, a residue implied in shifting the pk a of A2451 to neutrality, had little effect in vivo and in vitro (14, 16, 19). This suggested that A2451 does not participate in catalysis by the mechanism suggested (2), but it could not entirely exclude a function of A2451 as a general acid/base, in particularly in conjunction with other charged groups (20, 21). It is reasonable to assume that the mechanism of peptide bond formation is essentially the same on ribosomes from all organisms, although most of the biochemical data available so far have been obtained using E. coli ribosomes and little information on the mechanism of reaction in other organisms is available. The Gram-positive bacterium Mycobacterium smegmatis has significant advantages over E. coli as a model system for genetic experiments, particularly for introducing mutations in rrna. Several rrna mutations that are lethal in E. coli have viable phenotypes in M. smegmatis (22 24), 5 which allows for the preparation of homogeneous mutant ribosomes without the use of tag systems (25). These advantages prompted us to use M. smegmatis ribosomes to analyze the mechanism of peptide bond formation, identify evolutionary conserved features of the mechanism, and further assess the functional role of A2451. We show that the major conserved contribution to catalysis comes from the lowering of the activation entropy of peptide bond formation. The effects of A2451U are different in E. coli and M. smegmatis, which argues against a mechanism for peptidyl transfer in which A2451 acts as a conserved chemical catalyst; rather, A2451 has an important function in determining the structure of the peptidyl transferase center. MATERIALS AND METHODS Chemicals and Buffers Chemicals for ribosome preparation and activity assays were purchased from Merck (Darmstadt, Germany) or Sigma (Steinheim, Germany) unless stated otherwise. Chemicals for RNA probing were from Fisher. Dimethyl sulfate (DMS) and 1-cyclohexyl-3-(2-morpholinoethyl)-carbodiimide metho-p-toluenesulfonate (CMCT) were from Sigma. MFT-mRNA (5 -GGCAAGGAGGUAAA- UAAUGUUCACGAUU-3, underlined sequence coding for fmet-phe- Thr) was purchased from Dharmacon Research, Inc. (Boulder, CO). Radioactive amino acids were from MP Biomedicals (Eschwege, Germany) or Hartmann Analytic (Braunschweig, Germany). Radioactive nucleoside triphosphates used for primer extension were from ICN (Costa Mesa, CA). Buffer A consisted of: 50 mm Tris-HCl, ph 7.5, 70 mm NH 4 Cl, 30 mm KCl, 7 mm MgCl 2. Buffer B consisted of: 50 mm Tris-HCl, 20 mm BisTris-HCl (at indicated ph), 70 mm NH 4 Cl, 30 mm KCl, 7 mm MgCl 2. M. smegmatis Bacterial Strains and Mutagenesis The parental strain used was a single rdna allelic strain of M. smegmatis, mc SMR5 rrnb, with one remaining functional operon, rrna, whereas the rrnb operon was removed completely. No additional resistance determinants were introduced in the genome (23). The integrative vector pmv361 Kan-Gm, which integrates into the genome of M. smegmatis at the unique attb site, was constructed by deletion of the aph cassette of pmv361 with NheI/SpeI and insertion of the gentamicin resistance cassette of pmv361-gm carried on a 3-kb PstI fragment. An 1.4-kbp rrna gene fragment starting at 23 S RNA position 1929 (E. coli numbering) up to a position 82 bp downstream of the 5 S RNA gene and containing point mutation A2451U was generated by fusion PCR and verified by sequencing. The PCR fragments were subcloned into the 5 C. Bruell, P. Pfister, and E. C. Böttger, unpublished observations. pgemteasy vector according to the manufacturer s instructions (Promega, Madison, WI). Subsequently, the PCR fragments were isolated by EcoRI digestion and integrated into the single EcoRI site of pmv361 Kan- Gm. The resulting plasmid was named pmv361 Kan-Gm-rRNA2451U. The plasmid pmv361 Kan-Gm-rRNA2451U was transformed into M. smegmatis mc SMR5 rrnb. Transformants were selected on LB plates containing 5 g/ml gentamicin. RecA-mediated homologous recombination was used to introduce the point mutation A2451U into the functional rrn operon (rrna) as described previously (26). Recombinants were colony purified twice; the presence of the mutation was verified by sequencing the 23 S rrna gene as well as the 23 S rrna in the ribosome preparations. M. smegmatis mc SMR5 rrnb and A2451U were grown on LB agar plates and plates containing linezolid (16 g/ml), respectively, preventing the loss of the point mutation. For cultivation of bacteria, large flasks with a total volume of 20 liters of LB medium containing Tween 80 (0.05%) were inoculated with colonies collected from plates. After 6 7 generations and an A 600 of 0.7, the cells were harvested and shock-frozen as dry pellets. Ribosome Preparation Twenty grams of frozen cells were resuspended in 50 ml of 20 mm Tris-HCl, ph 7.5, 100 mm NH 4 Cl, 10 mm MgCl 2, 0.5 mm EDTA, and 3 mm 2-mercaptoethanol. Cells were opened by passing them through a French press (Thermo Spectronic, Rochester, NY) at 18,000 p.s.i. DNase (RNase-free; Sigma; 3 g/ml) and precooled alumina (20 g) were added to the cell lysate. Alumina and cell debris were removed by low-speed centrifugation (JA14 rotor; Beckman Coulter Inc., Fullerton, CA; 9,000 g, 30 min), and the S-30 fraction was prepared by centrifugation at 16,000 rpm in a Beckman Ti50.2 rotor for 60 min. 16-ml portions of the S-30 extract were layered on 9-ml sucrose cushions (1.1 M sucrose in 20 mm Tris-HCl, ph 7.5, 500 mm NH 4 Cl, 10 mm MgCl 2, 0.5 mm EDTA, 3 mm 2-mercaptoethanol). After centrifugation at 33,000 g in the Ti50.2 rotor for 16 h, ribosome pellets were washed with 20 mm Tris-HCl, ph 7.5, 350 mm NH 4 Cl, 10 mm MgCl 2, 0.5 mm EDTA, and 3 mm 2-mercaptoethanol, dissolved in the same buffer, and incubated for 30 min at 4 C. Ribosomes were pelleted through 1 ml of sucrose cushion as before (Ti 50.2, 6 h, 50,000 rpm), and washed and dissolved in the same buffer. Finally, the ribosomes were centrifuged through 1.5-ml sucrose cushions (Beckman SW28; 28,000 rpm, 13 h). Ribosome pellets were dissolved in buffer A and stored after shockfreezing in liquid nitrogen. The concentration was determined by absorption measurements on the basis of 23 pmol/a 260 units. The integrity of 70 S ribosomes was verified by analytical ultracentrifugation. 50 pmol each of 70 S ribosomes from M. smegmatis, E. coli 70 S ribosomes, or E. coli 30 S and 50 S subunits were layered on a 5 40% sucrose gradient in buffer A (association conditions) or in 50 mm Tris-HCl, 20 mm BisTris-HCl at ph 7.5, 30 mm KCl, 70 mm NH 4 Cl, 1 mm MgCl 2 (dissociation conditions). The gradients were centrifuged in a Beckman SW41 rotor at 22,000 g for 17 h. Gradients were pumped out from the bottom of the tubes and ribosome fractions were detected by absorption at 254 nm. Ribosome Activity and Complex Formation Purified trna and translation factors from E. coli were prepared as described (27, 28). Initiation complexes were prepared in buffer A by incubating 70 S ribosomes (1.5 M), MFT-mRNA (1.7-fold excess over ribosomes), and [ 3 H]fMet-tRNA fmet (1.7-fold excess over ribosomes) in the presence of initiation factors 1, 2, and 3 (each in a 1.7-fold excess over ribosomes) for 60 min at 37 C. To form the ternary complex, EF-Tu GTP [ 14 C]PhetRNA Phe, EF-Tu (2.4 M) was incubated with GTP (1 mm), phosphoenolpyruvate (3 mm), and pyruvate kinase (0.1 g/ml) for 15 min at 37 C followed by the addition of [ 14 C]Phe-tRNA Phe (1.2 M). Equal volumes of initiation and ternary complexes were mixed at 14 mm JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 280 NUMBER 43 OCTOBER 28, 2005

3 MgCl 2, resulting in pretranslocation complexes. The extent of binding of [ 3 H]fMet-tRNA fmet to the P site and [ 14 C]Phe-tRNA Phe to the A site was controlled by nitrocellulose filtration. Filters were dissolved in 10 ml of scintillation liquid (Quickszint 361; Zinsser Analytic, Frankfurt, Germany) and counted in a TriCarb counter (PerkinElmer Life Sciences). Post-translocation complexes were prepared by adding 0.1 M EF-G to pretranslocation complexes and incubating for 5 min at 20 C. Posttranslocation complexes were purified and concentrated by centrifugation through 1.1 M sucrose cushions in buffer A at 259,000 g for 2 h (M120GX rotor; Sorvall, Asheville, NC). Pellets were dissolved in buffer B to a concentration of 3 M, shock-frozen in liquid nitrogen, and stored at 80 C. Kinetic Measurements of Peptide Bond Formation For the measurement of tripeptide formation, stock solutions of post-translocation complexes and puromycin were diluted into buffer B; for studying ph dependence, the buffer was adjusted to various ph values ranging from 6 to 9 (37 C). Puromycin solutions at concentrations of mm (see Fig. 1) contained 5 10% Me 2 SO; Me 2 SO up to 20% had no effect on the rate of puromycin reaction (data not shown). The final ph of both ribosome and puromycin solutions was measured directly using a smallsized ph electrode. Quench-flow experiments were carried out at 37 C by mixing equal volumes (13 l) of ribosome and puromycin solutions in a quench-flow apparatus (KinTek Corp, Austin, TX). After mixing, the concentration of the post-translocation complex was 0.15 M. Reactions were quenched with 0.5 M KOH. The [ 3 H]fMet[ 14 C]Phe-puromycin formed in the reaction and unreacted [ 3 H]fMet[ 14 C]Phe, set free from [ 3 H]fMet[ 14 C]Phe-tRNA Phe by alkaline hydrolysis (30 min, 37 C), were separated by reverse phase-hplc on a RP-8 column and quantified by double label radioactivity counting (10). Alternatively, reactions were quenched with 25% formic acid, and [ 3 H]fMet[ 14 C]Phe-puromycin was extracted in 750 l of ethyl acetate in the presence of 500 l of 1.5 M sodium acetate saturated with MgSO 4 at ph 4.5. Double label radioactivity counting was used to analyze 500 l of the organic phase. The rate of dipeptide formation was measured with 0.1 M initiation complex and 0.6 M ternary complex, both in buffer B of the desired ph, at 37 C. The reaction products were released from [ 3 H]fMet-PhetRNA Phe by alkaline hydrolysis, separated by reverse phase-hplc, and quantified by double label radioactivity counting. Time courses of the reaction were evaluated by single exponential fitting. Chemical Probing RNA probing was carried out generally following the standard procedure (29, 30) with some modifications. Five l of vacant ribosomes, isolated as described earlier and stored at 1 M concentration in a buffer of 50 mm HEPES (adjusted with KOH to ph 6.5, 7.5, or 8.5), 70 mm NH 4 Cl, 30 mm KCl, and 7 mm MgCl 2 were combined with 45 l of a modification buffer with a ph corresponding to that at which the ribosomes were stored. The following buffers were used for ribosome dilution and probing: 50 mm PIPES-KOH, ph 6.5, 150 mm KCl, 7 mm MgCl 2 ; 50 mm HEPES-KOH, ph 7.5, 150 mm KCl, 7 mm MgCl 2 ; 50 mm Bicine-KOH, ph 8.5, 150 mm KCl, 7 mm MgCl 2. After dilution with modification buffer, ribosome solutions were incubated for 5 min at 37 C and stored on ice before use. For DMS modification, 2 l of DMS:ethanol mixture (1:5, v/v) was added (2 l of ethanol was added to the control samples) and samples were incubated for 1 h on ice. The reactions were quenched by the addition of 50 l of 0.6 M sodium acetate, ph 5.5, 1 M 2-mercaptoethanol, and ribosomes were precipitated by the addition of 300 l of cold ethanol and incubation for 10 min at 70 C. Ribosomes were pelleted by centrifugation at 20,000 g for 10 min at 2 C. For CMCT modification, 5 l of 1 M ribosome solution in storage buffer, ph 8.5, were combined with 45 l of Bicine modification buffer, ph 8.5 (see earlier). After 5 min of incubation at 37 C, 50 l of CMCT solution (10.5 mg/ml) in Bicine modification buffer, ph 8.5, was added and samples were incubated for 1 h on ice. Reactions were stopped by adding 100 l of 0.6 M sodium acetate, ph 5.5, and 600 l of cold ethanol and placing samples at 70 C for 10 min. Ribosomes were precipitated by centrifugation at 20,000 g for 10 min at 2 C. Ribosome pellets were dissolved in 200 l of 0.3 M sodium acetate, ph 5.5, 5 mm EDTA, 0.5% SDS. rrna was isolated by successive extractions with equal volumes of phenol, phenol/chloroform, and chloroform, followed by ethanol precipitation of the aqueous phase. RNA pellets were dissolved in 50 l of H 2 O. The distribution of modified nucleotides in 23 S rrna was assessed by primer extension analysis essentially as described (29) using the DNA primers MS2720 (GTCCTCTCGTAC- TAGGGACAG), MS2550 (CCAACCCTTGGGACCTGCT), and MS2390 (CAGAGTGGTATTTCAACAACGAC), which allowed for scanning of the entire domain V of M. smegmatis 23 S rrna. RESULTS 70 S Ribosomes from M. smegmatis The 70 S ribosomes were prepared from the M. smegmatis mc SMR5 rrnb strain, which has a single rrna operon, rrna (25). The A2451U mutation was introduced into the 23 S rrna gene by RecA-mediated homologous recombination. The resulting cells, which contained a pure population of ribosomes carrying the A2451U mutation, were viable in liquid culture and formed colonies on agar plates. However, introduction of the A2451U mutation had a major effect on the cell growth: compared with the wild-type (WT), the generation time increased from 3 4 to h. Notably, the A2451U mutation conferred resistance to chloramphenicol and linezolid (to be discussed in detail elsewhere). Wild-type and mutant M. smegmatis ribosomes were prepared as described earlier for E. coli ribosomes (27) with some alterations (see Materials and Methods ). Whereas most of the ribosomal material prepared from WT M. smegmatis was represented by 70 S particles, 60% of the mutant ribosome preparation was represented by a 70 S peak and the rest sedimented as free 30 and 50 S ribosomal subunits during gradient centrifugation. The 70 S ribosomes prepared from mc SMR5 rrnb or mc SMR5 rrnb A2451U cells were 50% active in forming the initiation complex, 70S-mRNA-fMet-tRNA fmet. EF-Tu-dependent binding of Phe-tRNA Phe to the A site and translocation by EF-G resulted in post-translocation complexes with 40% of peptidyl-trna, fmet-phetrna Phe, in the P site both for WT and mutant ribosomes. Peptide Bond Formation on M. smegmatis Ribosomes with Puromycin as Substrate The peptidyl transferase activity of WT and A2451U M. smegmatis ribosomes was tested in a rapid kinetic assay (10) (Fig. 1A). Post-translocation complexes loaded with fmet-phe-trna Phe in the P site were mixed with puromycin and time courses of fmet-phepuromycin formation were monitored. Because puromycin binds very rapidly to the A site, the chemistry step appears to be rate-limiting (10, 17). In the presence of 10 mm puromycin at ph 7.5, the rate of fmet- Phe-puromycin formation was 2.3 s 1 on WT ribosomes (Fig. 1B), and the A2451U mutation reduced the rate 15-fold to 0.15 s 1. This rate effect could be because of a decreased rate of the chemistry step or to impaired puromycin binding. To distinguish between these possibilities, the rate of fmet-phe-puromycin formation was determined at increasing puromycin concentrations (Fig. 1C). The apparent affinity for puromycin, K m 8 3 mm, was identical for the WT and mutant M. smegmatis post-translocation complexes and similar to that observed for E. coli ribosomes, 3 4 mm (10). The rates of peptide bond formation at substrate saturation were 4 and 0.25 s 1 for the M. smegmatis WT and A2451U mutant ribosomes, respectively. The rates on E. coli ribo- OCTOBER 28, 2005 VOLUME 280 NUMBER 43 JOURNAL OF BIOLOGICAL CHEMISTRY 36067

4 FIGURE 1. Kinetics of peptide bond formation on ribosomes from M. smegmatis with puromycin as substrate. A, preparation of ribosome complexes and rapid kinetic assay of peptidyl transferase activity. B, time courses of peptide bond formation with WT (closed circles) and A2451U (open circles) M. smegmatis ribosomes at 10 mm puromycin and ph 7.5; Pmn, puromycin. C, dependence of k pep on puromycin concentration measured with WT (closed circles, left-hand ordinate) and A2451U ribosomes (open circles, right-hand ordinate). Fitting the data to a two-step model in which a rapid binding equilibrium is followed by irreversible peptide bond formation yields k pep 4 s 1 (WT) and k pep 0.25 s 1 (A2451U) at puromycin saturation and a K m of 8 3 mm (WT and A2451U). TABLE ONE Activation parameters for the second-order ribosome-catalyzed peptide bond formation and uncatalyzed ester aminolysis (k non ) (25 C) Standard deviation of rate constants is 10%, that of activation parameters about 1 kcal/mol. Ribosomes from Amine Ester Rate constant Activation parameters G H T S Uncatalyzed Tris fmet-trna fmet E. coli a Puromycin fmet-phe-trna Phe M. smegmatis Puromycin fmet-phe-trna Phe a Data from Ref. 17. M 1 s 1 kcal/mol somes were 30 s 1 (on WT ribosomes) and 0.2 s 1 (on A2451U mutant ribosomes) under the same conditions (ph 7.5, 37 C) (10). To obtain further insight into the mechanism of catalysis, activation parameters of peptide bond formation on M. smegmatis ribosomes were measured and compared with those of an uncatalyzed model reaction using Tris as the reacting nucleophile. The rate of peptide bond formation with fmet-phe-trna Phe and puromycin was measured at different temperatures; activation parameters ( G, H, and T S ) were calculated as described (17) (TABLE ONE). The activation parameters of fmet-phe-puromycin formation were very similar on M. smegmatis and JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 280 NUMBER 43 OCTOBER 28, 2005

5 E. coli ribosomes. The results indicate that the rate enhancement produced by the ribosome is achieved predominantly by lowering the activation entropy, whereas the activation enthalpy is almost the same on the ribosome and in solution. ph Dependence of Peptide Bond Formation with Puromycin Peptidyl transfer reaction on E. coli ribosomes exhibited a strong ph dependence that results from the ionization of both the nucleophilic NH 2 group of puromycin (pk a 6.9) and a ribosomal group with a pk a of 7.5 (10, 19). On M. smegmatis ribosomes, the rates of peptide bond formation increased with ph in a similar fashion to the rates on E. coli ribosomes (Fig. 2). A maximum rate of 22 2 s 1 was observed with WT ribosomes, which is comparable with the rate of 50 s 1 reported for E. coli (10, 19) (TABLE TWO). As with E. coli, the kinetic data obtained with M. smegmatis ribosomes fit a model with 2 ionizing groups involved in the reaction; in addition to the pk a of puromycin, an ionizing group with a pk a of was found, which is slightly higher than the pk a of the ionizing group in E. coli ribosomes (10, 19). Ionization of the group with pk a of leads to an 200-fold decrease of the reaction rate. If A2451 were an evolutionarily conserved general acid/base involved in the peptide bond formation or if A2451 were the base with a pk a of 8 involved in a ph-dependent conformational change, mutations of A2451 in ribosomes of different species would be expected to change, or eliminate, the ph dependence of the reaction in a similar manner. However, in contrast to E. coli, the shape of the ph dependence was not changed by the A2451U mutation in M. smegmatis (Fig. 2). Again, 2 ionizing groups were found, with pk a values of 6.9 (puromycin) and , whereas the maximum rate of the reaction was decreased to s 1 (TABLE TWO). Thus, although the A2451U mutation in M. smegmatis moderately decreased the rate of peptide bond formation FIGURE 2. Effect of the A2451U mutation on the ph dependence of peptide bond formation. The rate of fmet-phe-puromycin formation was measured at 20 mm puromycin on WT (closed circles) and A2451U (open circles) M. smegmatis ribosomes. A model with 2 ionizing groups influencing the reaction was used for fitting the data, with pk a1 6.9 for puromycin (10) (fixed parameter in fitting) and fitting the pk a value of the second ionizing group; the values for pk a1, pk a2, and k pep at ph 6.5 and 8.5 are given in TABLE TWO. (about 10-fold), it did not affect the ionization of group(s) presumably involved in catalysis. Peptide Bond Formation with aa-trna as Substrate Peptidyl transfer reaction with aa-trna as the substrate was measured on M. smegmatis ribosomes by mixing 70 S ribosomes loaded with mrna and fmet-trna fmet with the ternary complex, EF-Tu GTP Phe-tRNA Phe. The observed rate of the reaction catalyzed by WT ribosomes, 3 s 1, was comparable with the respective rate on E. coli ribosomes observed previously, 7 s 1 (31), and was independent of ph (Fig. 3), as also observed with E. coli ribosomes. 6 Introducing the A2451U mutation in M. smegmatis ribosomes had no discernible effect on the rate of peptide bond formation with aa-trna, and the reaction was ph-independent as with WT ribosomes, suggesting very little or no contribution of A2451 to the catalysis of peptide bond formation with aa-trna within the neutral ph range. ph-dependent Conformational Changes of the Peptidyl Transferase Center The conformation of 23 S rrna in the peptidyl transferase center was probed using DMS and CMCT modification. To monitor ph-dependent changes in RNA conformation, DMS modification reactions were carried out at 3 ph values. Because RNA modification with carbodiimide is drastically inhibited at lower ph, CMCT probing was done only at ph 8.5. Comparison of the DMS and CMCT modification patterns of WT and mutant 23 S rrna at ph 8.5 shows that the A2451U mutation causes significant alteration in conformation of rrna in the peptidyl transferase center. The most prominent differences were observed at positions U2506 and U2585, which are much more reactive to CMCT in WT than in mutant, and positions A2060 and A2572, which are more accessible to DMS modification in mutant than in WT. In addition, positions U2506 and U2584 showed somewhat enhanced reactivity to DMS in WT (Fig. 4, TABLE THREE). Several groups at the active site of WT ribosomes showed ph-dependent changes of reactivity (Fig. 4). The extent of DMS modification of U2584 and U2506 increased between ph 7.5 and ph 8.5 (TABLE THREE), suggesting an apparent pk a close to the kinetic pk a. However, the increase in reactivity of C2474 occurred between ph 6.5 and 7.5, which is not reflected in the ph dependence of the peptidyl transferase rate. Thus, conformation of several nucleotides in the active center may exhibit ph dependence, only one of which affected the rate of peptide bond formation. The ph-dependent changes seemed to be different on WT and mutant ribosomes. For example, accessibility of A2572 in mutant ribosomes is drastically increased between ph 6.5 and 7.5 but is ph independent in the WT (Fig. 4B, TABLE THREE). Thus, whereas the phdependent rearrangements were not abolished by the A2451U mutation, the general structure of the peptidyl transferase center and structural transitions in rrna were altered. 6 S. Adio and M. V. Rodnina, unpublished results. TABLE TWO ph dependence of peptide bond formation on ribosomes from M. smegmatis and E. coli with puromycin as A-site substrate Data for E. coli ribosomes were taken from Ref. 10. pk a1 reflects ionization of the -amino group of puromycin (10); pk a2 reflects apparent pk a of a ribosome group affecting the peptidyl transfer reaction; k pep (ph 8.5) is the maximum rate of reaction. Ribosomes pk a1 pk a2 k pep (ph 6.5) k pep (ph 8.5) M. smegmatis (WT) M. smegmatis (A2451U) a E. coli (WT) E. coli (A2451U) a The value was extrapolated from the data of Fig. 2. s 1 OCTOBER 28, 2005 VOLUME 280 NUMBER 43 JOURNAL OF BIOLOGICAL CHEMISTRY 36069

6 DISCUSSION FIGURE 3. ph dependence of fmet-phe formation on M. smegmatis ribosomes. Time courses of dipeptide formation between fmet-trna fmet and Phe-tRNA Phe at ph 6.75 (closed circles) and 7.75 (closed triangles) on WT ribosomes and at ph 7.75 on A2451U (open circles) ribosomes. Dipeptide formation on A2451U ribosomes at ph 6.75 was as fast as at ph 7.75 (not shown for clarity). Conserved Features of the Catalytic Mechanism The ribosome is an ancient RNA-based enzyme whose function is to synthesize polypeptides. Despite a high degree of sequence conservation of rrna, in particular at the peptidyl transferase center (1, 32, 33), the positioning of groups in the peptidyl transferase active site may differ in detail among species (1, 34). Interaction of the conserved nucleotides with the less conserved RNA residues may influence the orientation of the rrna bases in the active site of the peptidyl transferase. For instance, a somewhat different neighborhood of the reactive -amino group of puromycin attached to a short RNA hairpin was reported for the Deinococcus radiodurans 50 S subunit (35) as compared with a similar substrate analog on H. marismortui 50 S (11). This can also explain species-specific spectra of mutations conferring antibiotic resistance (24). The present data provide the first insight into the degree of mechanistic conservation of peptide bond formation among different species. The reaction rate was slightly lower in the M. smegmatis system as compared with E. coli, which is compatible with the slower growth rate of M. smegmatis. On both E. coli and M. smegmatis ribosomes, the catalysis of peptide bond formation was mainly because of a large favorable contribution to the activation entropy as compared with an uncatalyzed model reaction in solution. These results further support the view that the ribosome enhances the rate of peptide bond formation predominantly by positioning the substrates and/or water exclusion within the FIGURE 4. Chemical probing of 23 S rrna in the peptidyl transferase center of M. smegmatis ribosomes. C and A, sequencing lanes; K, control without modification; M, after chemical modification. WT, WT M. smegmatis ribosomes; MUT, A2451U mutant. 6.5, 7.5, 8.5, ph during modification. A, DMS modification, primer MS2390. B, DMS modification, primer MS2720. C, DMS modification, primer MS2550. D, CMCT modification, primer MS2720. TABLE THREE ph-dependent changes in the chemical reactivity of rrna bases in the peptidyl transferase center of ribosomes from M. smegmatis Position Reagent WT A2451U A2060 DMS C2474 DMS A2572 DMS U2506 DMS U2506 CMCT ND a ND ND ND U2584 DMS U2585 CMCT ND ND ND ND a ND, not determined JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 280 NUMBER 43 OCTOBER 28, 2005

7 active site rather than by chemical catalysis (9, 14, 16, 17, 19). The factor contributed by ph-dependent effects ( fold for puromycin as the substrate) was similar with ribosomes from both organisms. However, pk a values determined from reaction rates differed slightly, suggesting that the respective ionizing groups either are not conserved or are located in different environments. The latter possibility is consistent with the results of chemical probing that suggested that the structure and ph-dependent changes of the peptidyl transferase center are different in E. coli and M. smegmatis (see below). When aminoacyl-trna, rather than puromycin, was used as the A-site substrate, the rate of peptide bond formation on M. smegmatis ribosomes was independent of ph. The rate of the reaction on E. coli ribosomes was higher but was also independent of ph over 2 ph units. 6 At high ph, the reaction rate was limited by the accommodation of aa-trna in the A site, precluding rate measurements of the chemistry step with aa-trna substrates (36). Notably, mutations of a number of residues at the peptidyl transferase center of E. coli ribosomes impaired the reaction with puromycin but had no effect when aa-trna was used (18). These observations may indicate that groups ionizing at neutral ph are not critical for the reaction with the natural substrate. Structural Rearrangements in the Active Site The structure of the peptidyl transferase center has long been known to be sensitive to ph and monovalent cation concentrations (37). Chemical probing experiments with E. coli ribosomes showed that the DMS reactivities of several bases, including A2451, A2453, A2572, and U2584 in 23 S rrna, are affected by ph transition in the range (30). However, the phdependent structural changes differ in ribosomes from various species despite the high degree of structural conservation of the peptidyl transferase center. The ph-dependent reactivity of A2451 varies in ribosomes of different organisms (38). C2474 shows increased reactivity at ph 7.5 and 8.5 in ribosomes of M. smegmatis and Thermus aquaticus (Ref. 39, and the current study) but not in E. coli (30). These data suggest that ribosomes may undergo conformational changes that involve several ionizing groups that are not necessarily conserved in the peptidyl transferase center with apparent pk a values between 7 and 8. The chemical nature of these groups does not have to be limited to rrna residues, as ionization of ribosomal proteins may also affect the structure of rrna in the peptidyl transferase center. Because the structure of the peptidyl transferase center changes considerably in response to ph, the effect of ph on the peptidyl transferase rate (Refs. 10 and 19, and the current study) per se does not provide support for the catalytic models involving general acid/base catalysis. The A2451U mutation in M. smegmatis ribosomes altered the intensity and ph dependence of chemical modification of several bases in the peptidyl transferase center, i.e. A2060, U2506, A2572, U2584, and U2585. Interestingly, 2 of the effects that we observed in the M. smegmatis mutant, namely, increased accessibility of A2572 and decreased accessibility of U2584 to DMS modification, parallel those observed in the inactive conformation of the E. coli ribosome (30). This may suggest that the A2451U mutation alters the structure of the peptidyl transferase center toward the inactive conformation. However, as the functional effect of the mutation is rather moderate compared with the peptidyl transferase inactivation by monovalent cation depletion, additional differences must be present between the structures induced by the A2451 mutation versus the absence of monovalent cations (30, 37). Role of A2451 in the Peptidyl Transfer Reaction Whereas mutations of A2451 to 3 other bases are lethal in E. coli (14, 15), M. smegmatis cells bearing the A2451U mutation are viable, although they grow slowly. A similar mutation confers resistance to chloramphenicol in mouse mitochondria, indicating that this mutation is not lethal in mitochondrial ribosomes either (41). In reconstituted large ribosomal subunits, mutations of A2451 as well as incorporation of several nonnatural nucleobases instead of adenine or even removal of the adenine base preserved considerable peptidyl transferase activity (12, 14, 16, 19). In E. coli, the A2451U mutation decreased the rate of puromycin reaction by 150-fold. It resulted in the loss of the corresponding ionization (pk a 7.5) and reduced the reaction rate by the same factor as protonation did with WT ribosomes (10). Kinetic analysis of the A2451U M. smegmatis mutant demonstrated that the rate of peptidyl transfer to puromycin was decreased by a factor of 10. However, the A2451U mutation in M. smegmatis ribosomes did not eliminate ph dependence of the puromycin reaction and, thus, did not affect the ionization of a ribosomal group with a pk a of 8.0, which directly or indirectly affects the catalysis. Therefore, in M. smegmatis, A2451 is not responsible for the pk a of around 8, which then must arise from another ionizing group within the peptidyl transferase center. Two nonconventional pairs, A2453 C2499 and A2450 C2063, have been proposed as candidates that may convey ph-dependent conformational changes to the peptidyl transferase center (10). Each is presumed to possess a near-neutral pk a and both are located in the vicinity of A2451. The A2453 C2499 base pair, but not the A2450 C2063 base pair, was found to contribute to the ph-dependent structural rearrangement of A2451 in E. coli (31, 40). However, the lack of nucleotide conservation at the 2453 and 2499 positions suggests that the A2453 C2499 base pair, and consequently its presumed near-neutral pk a, is unlikely to be a part of the fundamental, evolutionarily conserved mechanism of peptide bond formation (40). Rather, deprotonation of group(s) in the peptidyl transferase center may accelerate peptide bond formation by stabilizing a favorable conformation of the active site, thereby contributing to catalysis on both M. smegmatis and E. coli ribosomes with puromycin as substrate (10). Replacements of rrna base A2451 in the inner shell of the peptidyl transferase center (18) has a moderate to no effect on the rate of peptide bond formation depending on the source of the ribosomes and the nature of the A-site substrate (puromycin or aminoacyl-trna) (Refs. 10 and 18, and the current study). Mutations of the neighboring G2447 have very little effect on the rate of peptide bond formation (19). Both replacements do not cause lethality in M. smegmatis (Ref. 24, and the current study). This strongly argues against an involvement of the base moiety of A2451 in the universally conserved mechanism of peptide bond formation. Rather, A2451 may act as one of the pivots for assembling the structure of the peptidyl transferase center required for rapid and proper positioning of substrates, shielding charges, and/or organizing water molecules. Acknowledgments We thank Wolfgang Wintermeyer for valuable comments on the manuscript and Petra Striebeck, Astrid Böhm, Carmen Schillings, Simone Möbitz, and Tanja Janusic for expert technical assistance. REFERENCES 1. Ban, N., Nissen, P., Hansen, J., Moore, P. B., and Steitz, T. A. (2000) Science 289, Nissen, P., Hansen, J., Ban, N., Moore, P. B., and Steitz, T. A. (2000) Science 289, Wolfenden, R. (1963) Biochemistry 338, Barta, A., and Halama, I. (1996) in Ribosomal RNA and Group I Introns (Green, R., and Schroeder, R., eds) pp , R. G. Landes Company, Austin, TX 5. Krayevsky, A. A., and Kukhanova, M. K. (1979) Prog. Nucleic Acids Res. Mol. Biol. 23, Lieberman, K. R., and Dahlberg, A. E. (1995) Prog. Nucleic Acids Res. Mol. Biol. 50, Maden, B. E., and Monro, R. E. (1968) Eur. J. Biochem. 6, OCTOBER 28, 2005 VOLUME 280 NUMBER 43 JOURNAL OF BIOLOGICAL CHEMISTRY 36071

8 8. Moore, P. B., and Steitz, T. A. (2003) Annu. Rev. Biochem. 72, Nierhaus, K. H., Schulze, H., and Cooperman, B. S. (1980) Biochem. Int. 1, Katunin, V. I., Muth, G. W., Strobel, S. A., Wintermeyer, W., and Rodnina, M. V. (2002) Mol. Cell 10, Hansen, J. L., Schmeing, T. M., Moore, P. B., and Steitz, T. A. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, Erlacher, M. D., Lang, K., Shankaran, N., Wotzel, B., Huttenhofer, A., Micura, R., Mankin, A. S., and Polacek, N. (2005) Nucleic Acids Res. 33, Parnell, K. M., Seila, A. C., and Strobel, S. A. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, Thompson, J., Kim, D. F., O Connor, M., Lieberman, K. R., Bayfield, M. A., Gregory, S. T., Green, R., Noller, H. F., and Dahlberg, A. E. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, Muth, G. W., Ortoleva-Donnelly, L., and Strobel, S. A. (2000) Science 289, Polacek, N., Gaynor, M., Yassin, A., and Mankin, A. S. (2001) Nature 411, Sievers, A., Beringer, M., Rodnina, M. V., and Wolfenden, R. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, Youngman, E. M., Brunelle, J. L., Kochaniak, A. B., and Green, R. (2004) Cell 117, Beringer, M., Adio, S., Wintermeyer, W., and Rodnina, M. V. (2003) RNA (N.Y.) 9, Bevilacqua, P. C., Brown, T. S., Nakano, S., and Yajima, R. (2004) Biopolymers 73, Weinger, J. S., Parnell, K. M., Dorner, S., Green, R., and Strobel, S. A. (2004) Nat. Struct. Mol. Biol. 11, Pfister, P., Hobbie, S., Brull, C., Corti, N., Vasella, A., Westhof, E., and Bottger, E. C. (2005) J. Mol. Biol. 346, Pfister, P., Hobbie, S., Vicens, Q., Bottger, E. C., and Westhof, E. (2003) Chembiochem. 4, Sander, P., Belova, L., Kidan, Y. G., Pfister, P., Mankin, A. S., and Bottger, E. C. (2002) Mol. Microbiol. 46, Sander, P., Prammananan, T., and Bottger, E. C. (1996) Mol. Microbiol. 22, Prammananan, T., Sander, P., Springer, B., and Bottger, E. C. (1999) Antimicrob. Agents Chemother. 43, Rodnina, M. V., and Wintermeyer, W. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, Rodnina, M. V., Savelsbergh, A., Matassova, N. B., Katunin, V. I., Semenkov, Y. P., and Wintermeyer, W. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, Merryman, C., and Noller, H. F. (1998) in RNA:Protein Interactions, A Practical Approach (Smith, C. W. J., ed) pp , Oxford University Press, Oxford 30. Bayfield, M. A., Dahlberg, A. E., Schulmeister, U., Dorner, S., and Barta, A. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, Hesslein, A. E., Katunin, V. I., Beringer, M., Kosek, A. B., Rodnina, M. V., and Strobel, S. A. (2004) Nucleic Acids Res. 32, Gutell, R. R., Weiser, B., Woese, C. R., and Noller, H. F. (1985) Prog. Nucleic Acids Res. Mol. Biol. 32, Noller, H. F., and Woese, C. R. (1981) Science 212, Harms, J., Schluenzen, F., Zarivach, R., Bashan, A., Gat, S., Agmon, I., Bartels, H., Franceschi, F., and Yonath, A. (2001) Cell 107, Bashan, A., Agmon, I., Zarivach, R., Schluenzen, F., Harms, J., Berisio, R., Bartels, H., Franceschi, F., Auerbach, T., Hansen, H. A., Kossoy, E., Kessler, M., and Yonath, A. (2003) Mol. Cell 11, Pape, T., Wintermeyer, W., and Rodnina, M. V. (1998) EMBO J. 17, Miskin, R., Zamir, A., and Elson, D. (1968) Biochem. Biophys. Res. Commun. 33, Muth, G. W., Chen, L., Kosek, A. B., and Strobel, S. A. (2001) RNA (N.Y.) 7, Xiong, L., Polacek, N., Sander, P., Bottger, E. C., and Mankin, A. (2001) RNA (N.Y.) 7, Bayfield, M. A., Thompson, J., and Dahlberg, A. E. (2004) Nucleic Acids Res. 32, Kearsey, S. E., and Craig, I. W. (1981) Nature 290, JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 280 NUMBER 43 OCTOBER 28, 2005