Coordinated conformational and compositional dynamics drive. ribosome translocation

Transcription

1 Coordinated conformational and compositional dynamics drive ribosome translocation Supplementary Information Jin Chen,2, Alexey Petrov 2, Albert Tsai,2, Seán E. O Leary 2, & Joseph D. Puglisi 2,3 Department of Applied Physics, Stanford University, Stanford, CA , USA. 2 Department of Structural Biology, Stanford University School of Medicine, Stanford, CA , USA. 3 Stanford Magnetic Resonance Laboratory, Stanford University School of Medicine, Stanford, CA , USA. Correspondence should be addressed to J.D.P. puglisi@stanford.edu Phone: Nature Structural & Molecular Biology: doi:.38/nsmb.267

2 a Tu b G 3S mrna IF2 Tu IF2 Initiation Codon Codon 2 Non-rotated State Lifetime Rotated State Lifetime Number of codons translated = n... Codon n Time c d 8 nm wild-type EF-G 8 nm mutant Cy EF-G 2 6 F K F K F K F K F K F K F KF K F K e Density Translation Efficiency WT EF-G Cy EF-G Number of Codons Translated f Lifetime (s) Rotated State Lifetimes WT EF-G Cy EF-G Codon g Lifetime (s) Non-rotated State Lifetimes 3 WT EF-G Cy EF-G Codon Supplementary Figure. Cy-EF-G is functionally equivalent to wild-type EF-G. a. BHQ-S with 8 nm Phe-tRNA Phe ternary complex, 8 nm Lys-tRNA Lys ternary complex, and 8 nm Cy-EF-G- (or 8 nm wild-type EF-G-) were delivered to surface immobilized Cy3B- 3S pre-initiation complexes on a prism-based total internal reflection fluorescent microscope (TIRFm) with single laser excitation at 32 nm (Cy-EF-G not excited). The data was collected at ms exposure time ( frames per second). Assembling complexes and buffer conditions are identical to the procedure for ZMW. Details on data collection and analysis were described previously. Nature Structural & Molecular Biology: doi:.38/nsmb.267

3 b. Expected signal sequence defining the non-rotated state lifetime, rotated state lifetime, as well as number of codons translated for the particular ribosome. c. Representative traces of Cy3B/BHQ ribosome elongating on 6(FK) mrna with Cy-EF-G or wildtype EF-G. Elongation with Cy-EF-G shows similar translation behavior as with wild-type EF-G. Upon initiation, the Cy3B intensity drops, followed by alternating low-high-low intensities reporting on the non-rotated, rotated, and non-rotated states of the ribosome. d. Histogram of translation efficiency. Translation efficiencies using both types of EF-G are similar, though the processivity for the mutant Cy-EF-G is slightly lower. e. The rotated state lifetimes at each codon, comparing wild-type EF-G and Cy-EF-G. Overall wildtype and Cy-EF-G resulted in statistically indistinguishable overall lifetimes, being 3.±.4 s for wild type, and 4.±.9 s for Cy-EF-G. f. The non-rotated state lifetimes at each codon, comparing wild-type EF-G and Cy-EF-G. The lifetimes are statistically the same, as expected, since non-rotated state lifetime depends only on trna ternary complex concentrations. Nature Structural & Molecular Biology: doi:.38/nsmb.267

4 a EF-G dwell time b EF-G Sampling Mean EF-G Dwell [EF-G] [TC] Number of EF-G Sampling for Successful Counter-rotation [EF-G] [TC] c 2 Non-rotated State Lifetime d 2 Rotated State Lifetime Non-rotated State Lifetime (s) 2 [EF-G] [TC] Rotated State Lifetime (s) [EF-G] [TC] Supplementary Figure 2. Statistics of EF-G dynamics and ribosome conformations. a. The mean dwell time for EF-G is independent of EF-G concentration. b. EF-G non-productively samples the rotated state of the ribosome. The number of EF-G sampling for a successful counter-rotation is independent of EF-G concentration, with a mean of ~.3. c. The non-rotated state lifetime depend only on trna ternary complex concentration. d. Increase in EF-G concentration speeds up translocation and decreases rotated state lifetime. From left to right, n = 39, n = 26, n = 26, n = 3. Nature Structural & Molecular Biology: doi:.38/nsmb.267

5 a G G GDP b Non-rotated Rotated Cy EF-G Cy EF-G + Fusidic Acid + Fusidic Acid EF-G F EF-G K EF-G (Fusidic Acid) F Density G c EF-G Dwell G GDP Prolonged EF-G dwell time EF-G (Fusidic Acid) Ribosome Rotated Ribosome Non-rotated EF-G + Fusidic Acid - Fusidic Acid d + Thiostrepton G G e F EF-G Arrival (+) (-) Rotated State (+) (-) Non-rotated State f EF-G Dwell (+) (-) Rotated State (+) Ribosome rotated Ribosome non-rotated EF-G (-) Non-rotated State Nature Structural & Molecular Biology: doi:.38/nsmb.267

6 Supplementary Figure 3. Antibiotic effects on EF-G binding and departure. a. Representative trace of Cy3B/BHQ ribosome elongating with 8 nm Cy-EF-G-, 8 nm PhetRNA Phe ternary complex, and 8 nm Lys-tRNA Lys ternary complex, in the presence of µm fusidic acid, an antibiotic that binds directly to EF-G at the interface of domains II and V to stabilize the post-translocation state but does not inhibit hydrolysis -3. After the ribosome counter-rotates the EF-G remains on the ribosome for an extended period of time. b. Post-synchronization of the ribosome counter-rotating, with Cy-EF-G in the presence of fusidic acid, compared with Cy-EF-G without fusidic acid. The data was collected at fps. It is evident that post ribosome counter-rotation, EF-G remains on the ribosome, indicating that EF-G dissociation is not coupled to ribosome counter-rotation and translocation. Number of molecules analyzed n = 9. c. The dwell time of EF-G is increased almost 8 fold in the presence of fusidic acid. d. Representative trace of Cy3B/BHQ ribosomes elongating with 8 nm Cy-EF-G-, 8 nm PhetRNA Phe ternary complex, and 8 nm Lys-tRNA Lys ternary complex, in the presence of μm of thiostrepton, an antibiotic that inhibits translocation through interaction with the large subunit GAC, blocking stable binding of EF-G to the ribosome and preventing EF-G from engaging the A site 3. The data was collected at frames per second. e. The arrival time for EF-G is increased approximately fold in the presence of thiostrepton. Number of molecules analyzed n = 62. f. The EF-G dwell times are statistically the same with and without thiostrepton. Nature Structural & Molecular Biology: doi:.38/nsmb.267

7 a Rotated State Lifetime (s) Rotated State Lifetime mm Mg 2+ mm Mg 2+ b Non-rotated State Lifetime (s) Non-rotated State Lifetime mm Mg 2+ mm Mg 2+ c 2. EF-G Sampling d EF-G Dwell-time Number of EF-G Sampling for Successful Counter-rotation 2.. EF-G Lifetime (s) mm Mg 2+ mm Mg 2+ mm Mg 2+ mm Mg 2+ Non-rotated Rotated Transition Supplementary Figure 4. Elongation at high magnesium concentrations. a. We examined elongation at mm and mm Mg 2+, correlating Cy-EF-G with Cy3B/BHQ ribosomes. We delivered 2 nm BHQ-S, μm IF2-, 8 nm Phe-tRNA Phe ternary complex, 8 nm Lys-tRNA Lys ternary complex, and 8 nm Cy-EF-G- to pre-initiation complex with Cy3B-3S. The rotated state lifetime remains the statistically the same at high and low magnesium concentrations. The number of molecules analyzed, for mm and mm Mg 2+, is n = 26 and n = 9. Nature Structural & Molecular Biology: doi:.38/nsmb.267

8 b. The non-rotated state lifetime increases nearly 2 fold at high concentrations of magnesium, for 8 nm Cy-EF-G-, 8 nm Phe-tRNA Phe ternary complex, and 8 nm Lys-tRNA Lys ternary complex. This suggests that high magnesium stabilizes the rotated conformer of the ribosome, relatively destabilizing the non-rotated state. c. The number of EF-G binding events for a successful ribosome counter-rotation remains constant (mean ~.3) at high and low magnesium concentrations. d. High magnesium increases the EF-G dwell times slightly, stabilizing EF-G on the ribosome. Nature Structural & Molecular Biology: doi:.38/nsmb.267

9 a b 6 Initiation mm Mg Rotation 2 2 mm Mg Rotation Counter-rotation 2 2 c Pathway Probability Initiated but did not rotate Rotated but did not counter-rotate Rotated and counter-rotated mm Mg 2+ mm Mg 2+ Supplementary Figure. Magnesium effects on translocation and ribosome counter-rotation. a. We delivered 2 nm BHQ-S, μm IF2-, 8 nm Phe-tRNA Phe ternary complex, and 8 nm Lys-tRNA Lys ternary complex, without any EF-G, to pre-initiation complex with Cy3B-3S immobilized through a biotinylated mrna on the bottom of the ZMW wells. Example trace of Cy3B/BHQ ribosomes elongating at mm Mg 2+. Upon trna arrival and peptide bond formation, the ribosome rotates. However, due to the absence of EF-G, the ribosome remains in the rotated state for a prolonged period of time. b. Example trace of Cy3B/BHQ ribosomes elongating with 8 nm Phe-tRNA Phe ternary complex and 8 nm Lys-tRNA Lys ternary complex in the absence of EF-G, at mm Mg 2+. There is a slightly increased percentage of ribosomes that eventually counter-rotated, even in the absence of EF-G. c. The percentage of ribosomes that either () initiated but did not rotate, (2) rotated but did not counterrotate, or (3) rotated and eventually counter-rotated, under different concentrations of magnesium. Upon initiation, a portion of the ribosomes failed to rotate from the initial non-rotated state, possibly due to trna-ef-tu failing to accommodate. Only a small percentage (~%) of the ribosomes at mm Mg 2+ failed to rotate, but a much larger percentage (~4%) of ribosomes failed to rotate at Nature Structural & Molecular Biology: doi:.38/nsmb.267

10 mm Mg 2+. Since the trnas are locked in the classical state when the ribosome is non-rotated, this is consistent with previous reports of high magnesium stabilizing the classical state of trna 4. Thus, high magnesium stabilizes the non-rotated state of the ribosome. Another portion of the ribosomes successfully rotated after initiation. A much smaller percentage of ribosomes (~4%) counter-rotated after rotation at mm Mg 2+, even in the absence of EF-G. At mm Mg 2+, this percentage increased to ~%. This further emphasizes the stabilization of the non-rotated state of the ribosome and the possible lowering of the energy barrier for ribosome counter-rotation. From left to right n = 7 and n = 9. Nature Structural & Molecular Biology: doi:.38/nsmb.267

11 a Aluminum Tu Tu ZMW mrna 3S G GDPNP Biotin-PEG '-Biotin UTR M F K F K F K F K F K F K 6(FK) AUG UUCAAAUUCAAAUUCAAAUUCAAAUUCAAAUUCAAAUAA(UUU) 4 3S Glass Substrate b Translocation 8 Cy-Phe Cy2-Lys Tu c % of molecules that translocated mm Mg2+ EF-G EF-G GDPNP Cy-Phe Cy3-fMet No Translocation Cy2-Lys Tu Tu % of molecules that translocated mm Mg2+ EF-G EF-G GDPNP Supplementary Figure 6. Single-molecule translocation toeprinting assay. a. We preformed 7S in the rotated state with (Cy3)tRNA fmet in the P site and (Cy)tRNA Phe in the A site immobilized at the bottom of the ZMW wells. We then added µm of EF-G, with either or GDPNP, to the complex and incubated for minutes at room temperature. To test if the complex translocated, we delivered Lys-(Cy2)tRNA Lys and imaged for stable Lys trna accommodation signal (see Online Methods). The 6(FK) mrna used consists of a sequence with fmet followed by six Nature Structural & Molecular Biology: doi:.38/nsmb.267

12 alternating Phe and Lys codons (Online Methods), ending with a stop codon and four Phe spacer codons. b. Example traces for ribosomes that translocated and for ribosomes that failed to translocate. For ribosomes that translocated, there will be a stable Cy (red) signal with an arrival of stable Cy2 (blue) signal. For ribosomes that did not translocate, there will be a lack of stable Cy2 signal due to the A- site being blocked. c. At mm Mg 2+ (~.3 mm free Mg 2+ ), we observed ~7% of the ribosomes translocated in the presence of (remaining portion of ribosomes are probably not functional), while only ~2% of the ribosomes translocated in the presence of GDPNP. This is clear indication that translocation is possible even in the absence of hydrolysis. At mm Mg 2+ (~ mm free Mg 2+ ), the number of ribosomes that translocated with decreased to ~6%. This suggests that high magnesium stabilizes the non-rotated state of the ribosome, as we see increased numbers of Lys-(Cy2)tRNA Lys ternary complex sampling events as the trna tries to accommodate into the A site and drive ribosome rotation. Thus, the apparent number of ribosomes that translocated decreased. Despite this, at mm Mg 2+, the number of ribosomes that translocated with GDPNP increased to ~%. Number of molecules analyzed is n = (, mm Mg 2+ ), n = 74 (GDPNP, mm Mg 2+ ), n = 68 (, mm Mg 2+ ), n = 83 (GDPNP, mm Mg 2+ ). Nature Structural & Molecular Biology: doi:.38/nsmb.267

13 a b Viomycin F 2 2 Transition N/A Probability Density G K G GDP G... Rotated State Sampling Probability Density G Rotated State Non-rotated State EF-G binding Non-rotated State Sampling c EF-G Arrival 2 2 (+) (-) Rotated State (+).. EF-G Dwell (-) Non-rotated State d EF-G Dwell (+) Rotated State EF-G Dwell (-) (+) (-) Non-rotated State N/A Transition Supplementary Figure 7. Elongation in the presence of viomycin. a. Representative trace of Cy3B/BHQ ribosome elongating with 8 nm Cy-EF-G-, 8 nm PhetRNA Phe ternary complex, and 8 nm Lys-tRNA Lys ternary complex, in the presence of µm viomycin. Viomycin binds at the subunit interface, interacting with bridge B2a at helix 44 of the 3S subunit and helix 69 of the S subunit. This interaction with helix 44 affects the position of residues Nature Structural & Molecular Biology: doi:.38/nsmb.267

14 A492 and A493, which are involved in the decoding of A-site trnas. Binding of viomycin may stabilize the hybrid conformation of the trna and disrupt communication at the subunit interface necessary to mediate ribosome rotation,6. Thus, viomycin inhibits translocation subsequent to hydrolysis. Data was acquired at frames per second. b. Viomycin causes the decoupling of EF-G with intersubunit rotation. Thus, there are no correlated EF- G events with ribosome counter-rotation. The dwell time distribution for rotated state sampling is a multi-step process, indicating that futile hydrolysis probably occurs. The dwell time distribution for non-rotated state sampling is purely exponential, indicating that sampling to the non-rotated state in the presence of viomycin is a single rate-limiting step process. c. The EF-G arrival times with (+) and without (-) viomycin, showing similar arrival times. d. The EF-G dwell times with (+) and without (-) viomycin. EF-G dwell times to the rotated state are nearly 2 fold longer in the presence of viomycin, while dwell times to the non-rotated state remained the same with and without viomycin. Nature Structural & Molecular Biology: doi:.38/nsmb.267

15 References: Aitken, C. E. & Puglisi, J. D. Following the intersubunit conformation of the ribosome during translation in real time. Nature structural & molecular biology 7, 793-8, doi:.38/nsmb.828 (2). 2 Gao, Y. G. et al. The structure of the ribosome with elongation factor G trapped in the posttranslocational state. Science 326, , doi:.26/science.7979 (29). 3 Munro, J. B., Wasserman, M. R., Altman, R. B., Wang, L. & Blanchard, S. C. Correlated conformational events in EF-G and the ribosome regulate translocation. Nature structural & molecular biology 7, , doi:.38/nsmb.92 (2). 4 Lee, T. H., Blanchard, S. C., Kim, H. D., Puglisi, J. D. & Chu, S. The role of fluctuations in trna selection by the ribosome. Proceedings of the National Academy of Sciences of the United States of America 4, , doi:.73/pnas (27). Ermolenko, D. N. et al. The antibiotic viomycin traps the ribosome in an intermediate state of translocation. Nature structural & molecular biology 4, , doi:.38/nsmb243 (27). 6 Stanley, R. E., Blaha, G., Grodzicki, R. L., Strickler, M. D. & Steitz, T. A. The structures of the anti-tuberculosis antibiotics viomycin and capreomycin bound to the 7S ribosome. Nature structural & molecular biology 7, , doi:.38/nsmb.7 (2). Nature Structural & Molecular Biology: doi:.38/nsmb.267