Isolation of the hemf Operon Containing the Gene for the Escherichia coli Aerobic Coproporphyrinogen III Oxidase by

Transcription

1 JOURNAL OF BACrERIOLOGY, Feb. 1994, p /94/$ Copyright X) 1994, American Society for Microbiology Vol. 176, No. 3 Isolation of the hemf Operon Containing the Gene for the Escherichia coli Aerobic Coproporphyrinogen III Oxidase by In Vivo Complementation of a Yeast HEM13 Mutant BARBARA TROUP,1'2 MARTINA JAHN,3 CHRISTOPH HUNGERER,12 AND DIETER JAHN' 2* Laboratorium fiir Mikrobiologie, Fachbereich Biologie, Philipps-Universitat Marburg,1 and Abteilung Biochemie, Max-Planck-Institut fiir Terrestrische Mikrobiologie, Marburg, and Institut fur Molekularbiologie und Tumorforschung, Philipps- Universitat Marburg, Marburg,3 Germany Received 30 September 1993/Accepted 8 November 1993 Coproporphyrinogen III oxidase, an enzyme involved in heme biosynthesis, catalyzes the oxidative decarboxylation of coproporphyrinogen III to form protoporphyrinogen IX. Genetic and biochemical studies suggested the presence of two different coproporphyrinogen III oxidases, one for aerobic and one for anaerobic conditions. Here we report the cloning of the hemf gene, encoding the aerobic coproporphyrinogen III oxidase from Escherichia coli, by functional complementation of a Saccharomyces cerevisiae HEM13 mutant. An open reading frame of 897 bp encoding a protein of 299 amino acids with a calculated molecular mass of 34.3 kda was identified. Sequence comparisons revealed 43% amino acid sequence identity with the product of the S. cerevisiae HEM13 gene and 90% identity with the product of the recently cloned SalmoneUla typhimurium hemf gene, while a structural relationship to the proposed anaerobic enzyme from Rhodobacter sphaeroides was not obvious. The hemf gene is in an operon with an upstream open reading frame (orfl) encoding a 31.7-kfla protein with homology to an amidase involved in cell wall metabolism. The hemf gene was mapped to 52.6 min of the E. coli chromosome. Primer extension experiments revealed a strong transcription initiation site upstream of oifl. A weak signal, possibly indicative of a second promoter, was also identified just upstream of the hemf gene. A region containing bent DNA (Bent 111), previously mapped to 52.6 min of the E. coli chromosome, was discovered in the 5' region of orfi. Two potential integration host factor binding sites were found, one close to each transcription start site. An open reading frame (o6rj3) transcribed in a direction opposite that of the hemf gene was found downstream of the hemf gene. It encodes a protein of 40.2 kda that showed significant homology to proteins of the XylS/AraC family of transcriptional regulators. Heme and related tetrapyrroles are important cofactors for a number of enzymes in bacteria, eucarya, and archaea. Hence, there has been considerable interest in the pathway of heme biosynthesis and how heme biosynthesis is regulated. The cellular levels of heme vary depending on whether the organism is growing aerobically or anaerobically (10, 13, 30). Biochemical and genetic studies suggested the presence of two major regulatory points for oxygen. The first regulatory point was located at the formation of 5-aminolevulinic acid, an early precursor molecule for tetrapyrrolformation (19). The second point was found at the conversion of coproporphyrinogen III to protoporphyrinogen IX, a reaction in which the propionyl groups on rings A and B are oxidatively decarboxylated to vinyl groups (8, 10, 13, 20, 30). For both steps, two different enzymes, one that functions under aerobic conditions and one that functions under anaerobic conditions, are used. The presence of alternative enzymes for these steps most likely provides the basis for a regulatory mechanism (7, 9, 10, 15, 16, 18, 28, 37, 41, 42, 46-48). The aerobic coproporphyrinogen III oxidase requires molecular oxygen as an electron acceptor for the oxidative decarboxylation of coproporphyrinogen III, as described for animals, yeasts, and aerobically grown bacteria (5, 17, 31, 41, 42). This enzyme obviously cannot function in the absence of molecular oxygen. To maintain heme biosynthesis under anaerobic conditions, a different enzyme, one which requires Mg2+, methionine, ATP, and NAD+ or NADP+ for its activity, is used (37, 41, 42). In good agreement with these findings, two loci for coproporphyrinogen III oxidase activity were mapped to 50 min (hemf) and 85 min (hemn) of the Salmonella typhimurium chromosome (46). The genes for the aerobic enzymes were cloned from Saccharomyces cerevisiae (HEM13 [49]) and, very recently, from S. typhimurium (hemf [48]). Another recent report indicated the molecular cloning of a putative gene for the anaerobic enzyme from Rhodobacter sphaeroides (7). While the polypeptides for both aerobic enzymes shared 44% identity, no obvious homology was found for the anaerobic counterpart (7). The expression of the yeast gene was found to be subject to transcriptional regulation in response to changing cellular levels of oxygen and heme (21, 45, 49). As a step towards understanding the detailed nature of the regulatory mechanisms involved in the aerobic and anaerobic decarboxylation of coproporphyrinogen III, we cloned the gene for the aerobic' enzyme (hemf) from Escherichia coli by functional complementation of a yeast mutant. The protein encoded by the obtained gene showed a high level of homology to its yeast and S. typhimurium counterparts. MATERIALS AND METHODS * Corresponding author. Mailing address: Laboratorium fur Mikrobiologie, Fachbereich Biologie, Philipps-Universitat Marburg, Karlvon-Frisch-Str., Marburg, Germany. Phone: 49-(0) Fax: 49-(0) Enzymes and chemicals. All the enzymes used were purchased from United States Biochemicals (Bad Homburg, Germany) unless stated otherwise. Thermus aquaticus DNA polymerase was obtained from Perkin-Elmer (Uberlingen,

2 674 TROUP ET AL. J. BACTERIOL. TABLE 1. Bacterial strains, yeast strains, and plasmids used in this study Strain or plasmid Relevant genotype or description' reference Strains S. cerevisiae S150-2BAHEM13 AM To ura3-52 trpl-289 leu2-3 leu2-112 his3al heml3al 45 25B MALT his4-519 ura3-52 leu2-3 leu2-112 adel-100 heml E. coli DH5oa hsdr recal laczya 4)80 laczamj5 gyra96 34 BL21(DE3) F- hsds lacuv5::t7 gene 1 gyra+ 40 Plasmids pg-1 Yeast-E. coli shuttle vector containing the constitutive yeast GPD promoter and PGK 36 terminator; TRP1; 2,um replicon; Apr; ColEl replicon pbluescript SK+ High-copy-number phagemid; Apr Stratagene phem5 4.0-kb Sau3A fragment containing the E. coli hemf gene in the BamHI site of pg-1 (Fig. 1) This study pheml3 4.5-kb Sau3A fragment containing the E. coli hemf gene in the BamHI site of pg-1 (Fig. 1) This study pblues 6.0-kb HindlIl fragment from phems in the HindIII site of pbluescript SK+; the hemf gene This study is in an orientation opposite that of the +10 promoter (Fig. 1) pbluel3 6.5-kb HindIII fragment from phems in the Hindlll site of pbluescript SK+; the hemf gene This study is in the same orientation as the 4)10 promoter (Fig. 1) phem5aorf1 E. coli hemf gene with 150 bp of the 5' region and 100 bp of the 3' region cloned This study downstream of the GPD promoter of pg-1 pfl39-hem13 Yeast-E. coli shuttle vector containing the S. cerevisiae HEM13 gene; TRPI; ARS-CEN 45 replicon; Apr; ColEl replicon a GPD, glyceraldehyde-3-phosphate dehydrogenase gene; PGK, 3-phosphoglycerate kinase gene. 410 promoter = T7 RNA polymerase promoter. Germany). RNase inhibitor and avian myeloblastosis virus AMV) reverse transcriptase were obtained from Boehringer GmbH, Mannheim, Germany. Reagent-grade chemicals were obtained from Merck, Darmstadt, Germany. Nucleotides, hemin, and antibiotics were obtained from Sigma, Deisenhofen, Germany. Growth media were obtained from Difco, Augsburg, Germany. Oligonucleotides were purchased from Roth, Karlsruhe, Germany. Radioisotopes were supplied by ICN, Meckenheim, Germany. Bacterial and yeast strains and growth conditions. All strains used in this study are described in Table 1. E. coli strains were cultured on Luria-Bertani medium at 37 C (34). Ampicillin was used at a concentration of 100 p,g/ml. The heme-deficient mutants of S. cerevisiae were cultured on YPD medium containing 50,ug of hemin per ml (38, 49). Plasmids and recombinant DNA procedures. All DNA manipulations were carried out as described previously (34) unless stated otherwise. The plasmids used are listed in Table 1. Plasmid DNA from complemented S. cerevisiae was prepared as outlined by Strathern and Higgins (39). The inserts from the two plasmids (phems and pheml3) obtained by complementation were liberated by HindIII digestion and cloned into the HindIII site of pbluescript SK+ to create pblues and pblue13, respectively. The HindIII sites used are located on pg-1 (36). Plasmids pblues and pbluel3 were subjected to unidirectional exonuclease III treatment to generate a subset of clones with various insert lengths for DNA sequencing (34). DNA sequencing was performed with denatured double-stranded plasmid DNA by the dideoxynucleotide method with Sequenase version 2.0 (6). Construction of the E. coli genomic library in yeast expression vector pg-i. E. coli K-12 genomic DNA was isolated as described previously (1) and partially digested with Sau3A. Size-fractionated fragments from 5 to 10 kb were ligated into the BamHI site of pg-1 (36), a yeast-e. coli shuttle vector that contains the promoter for the glyceraldehyde-3-phosphate dehydrogenase gene (3) and the terminator for the 3-phosphoglycerate kinase gene (14) from S. cerevisiae. The TRP1 and ampicillin resistance genes were used for plasmid selection in S. cerevisiae and E. coli, respectively. The library was amplified in E. coli DH5a. Complementation of a yeast HEM13 mutant. Heme-deficient S. cerevisiae S150-2BAHEM13 was transformed via electroporation with the E. coli library in pg-1, with pfl39 carrying the yeast HEM13 gene as a positive control and with the vector (pg-1) as a negative control (2). Transformants were selected on synthetic minimal medium containing 0.67% yeast nitrogen base (without amino acids) and with 20 mg of uracil, 30 mg of leucine, 20 mg of histidine, 20 mg of adenine sulfate, 20 g of glucose, and 50 mg of hemin per liter (38, 49). Transformants were subsequently screened for the recovery of heme sufficiency by replica plating on the same minimal medium as that described above but without the hemin addition and with glycerol (2% [vol/vol]) instead of glucose as a carbon source. Mapping of the 5' ends of mrnas. Total cellular RNA was prepared from E. coli DH5a harboring pbluel3 as outlined elsewhere (1). The 5' ends of mrnas encoded by the hemf operon were mapped by the primer extension method (4) with oligonucleotides that were complementary to positions 457 to 429 (GTGGTIl7AAAAGTGCTCATACGGCCTGAG) and 1406 to 1377 (ACAAATTCTGCGCCATCGACGGCGGTC AGC) and that had been labeled at their 5' ends with T4 polynucleotide kinase and [y-32p]atp. For each experiment, 20 to 100,ug of RNA was incubated with 0.2 pmol of labeled primer (5 x 104 cpm) for 3 min at 70 C in 34 mm Tris-HCl-50 mm NaCl-5 mm MgCl2-5 mm dithiothreitol. The primer- RNA hybrids were extended with 10 U of AMV reverse transcriptase and 0.5 mm each nucleoside triphosphate for 30 min at 42 C. (Extension was done in the presence of 10 U of RNasin.) Extension products were purified by phenol extraction, subjected to denaturing polyacrylamide gel electrophoresis, and visualized by autoradiography. In vivo translation of the plasmid-encoded genes. E. coli

3 VOL. 176, 1994 HEME BIOSYNTHESIS AND COPROPORPHYRINOGEN III OXIDASE 675 TABLE 2. Complementation of S. cerevisiae HEM13 mutants with E. coli genomic DNA inserted into yeast-e. coli shuttle vector pg-1a Plasmid Complementation of S. cerevisiae 150-2BA&HEM13 phems + + phem5aorfl + + pheml3 + + pfl39-hem pg-1 a S. cerevisiae strains were transformed via electroporation with the plasmids indicated. Selection was performed for the uptake of plasmid DNA prior to replica plating and screening for heme sufficiency as outlined in Materials and Methods. + and - indicate whether the plasmid was able to restore growth on minimal medium with glycerol as the carbon source and without heme addition. BL21 (DE3), which carries the T7 RNA polymerase gene under the control of the lacuv5 promoter, was transformed with plasmids pblue5, pblue13 and, as a control, pbluescript SK+ (40). Transformed bacteria were grown at 37 C in 3 ml of M9-ampicillin medium containing all amino acids, each at a concentration of 0.01% (wt/vol), to an A600 of 0.5 (16). The cells were washed twice with M9 medium (34) and incubated for 1 h at 37 C in 1 ml of M9 medium containing all amino acids, except for methionine, at a concentration of 0.01% (wt/vol). After the addition of isopropyl-o-d-thiogalactopyranoside (IPTG) to a final concentration of 0.2 mm to induce the expression of T7 RNA polymerase, incubation was continued for 30 min before rifampin (100 jig/ml) was added. After another 30 min of incubation at 37 C, 10,uCi of [35S]methionine was added and incubation was continued for 5 min. The cells were harvested by centrifugation and broken by boiling, and the proteins were separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (24). Labeled proteins were visualized by autoradiography. Nucleotide sequence accession number. The nucleotide sequence data reported in this paper will appear in the EMBL, GenBank, and DDBJ nucleotide sequence data bases under accession number X RESULTS Complementation of a heme-deficient HEMJ3 mutant of S. cerevisiae with E. coli genomic DNA. We sought to clone the 25B gene for the aerobic coproporphyrinogen III oxidase of E. coli by complementation of a heme-requiring S. cerevisiae strain with a deletion of HEM13, the corresponding yeast gene. We chose this strategy for several reasons. First, at the time at which this investigation was started, an appropriate bacterial mutant was not available. Moreover, finding the gene via classical genetic techniques was expected to be difficult because the presence of two enzymes implied that the mutation of two loci would be needed to obtain a clear heme-deficient phenotype, as was found later for S. typhimurium (47). Finally, this strategy had been used previously to isolate the yeast HEM13 gene (49). Heme-deficient S. cerevisiae S150-2BAHEM13 carrying a 0.7-kb deletion in the HEM13 gene was transformed with the E. coli genomic library in pg-1 via electroporation. Over 200,000 transformants were screened for the recovery of heme sufficiency on minimal medium containing glycerol as a nonfermentable carbon source. Two positive clones were obtained, and the complementing plasmid DNAs were extracted and termed phem5 and pheml3. Retransformation of both plasmids into S150-2BAHEM13 and a second HEM13 mutant strain, 25B (49), confirmed the obtained phenotype (Table 2). The transformants with phem5 and pheml3 grew as well on plates as both HEM13 mutant strains complemented with the cloned yeast HEM13 gene on pfl39-hem13 (45). Control transformants containing just the vector failed to grow (Table 2). Nucleotide sequence and organization of the E. coli hemf gene encoding coproporphyrinogen III oxidase. Plasmids phem5 and pheml3 contained inserts of approximately 4.0 and 4.5 kb, respectively. Restriction mapping revealed the presence of an overlapping region of approximately 3.2 kb (Fig. 1). The inserts of both plasmids were recloned in pbluescript SK+ in both possible orientations for DNA sequence determinations. Three open reading frames were found (Fig. 1 and 2). orfl extended from an ATG codon at position 439 to an ochre codon at position 1308 and thus could encode a protein of 289 amino acids with a calculated molecular mass of 31,663 Da. orf2 (hemf; see below) started with an ATG codon at position 1312 and ended with an ochre codon at position The predicted protein of 299 amino acids would have a calculated molecular mass of 34,325 Da. orf3, which is oriented in the direction opposite that of orfl and orf2 (hemf), started with an ATG codon at position 3269 and extended to an opal codon at Bgli- --I A420. PvuII Bgil PtlI Bgll Bgill PYUll PYUII Pstl phem5 pheml3 pblues pblue13eb FIG. 1. Physical map of the hemf operon. The top line represents the restriction map of Kohara phage A420 (22), in which the hemf operon was mapped. The next line aligns the obtained structure of the hemf operon to the phage map. The structures of several clones used in this investigation are shown below. Bent 111 is a previously described region of bent DNA (43) of unknown function. IHF labels potential IHF binding sites (12).

4 676 TROUP ET AL. J. BACTERIOL tgcacgocaagataataacagaccacgcatgc gtcataacgcccatccgttacgaccacgtcaccgtttcct agegaooaaaaacaaaatqaaqtoatggtteatattacgctcgatqtacattt gajaataqttccacgga cgagcaaq 160 tcqcaacgqtcccaaaqggtgatgact tttctcttactgcqaaatacgcqtatctccatggtattcqttaactt 240 tttgcgggttaaaqgctgattatggcqtgaacogtcqaattagecaatatgaaaatcggttgaaaaagtgegcg F 321 g gggagattoaac ta atao taaaacaattctsaacagcaaacoqtcgtaacggattaogcgatacga tataacatctggaactttattatta aetcaggccgt ATG AGC ACT TTT kan CCA CTA AAa ACN CTC T F K P L K T L ACT TCG CaC COC CAG G!G CTG AAN 0CC GOT TTG GCT GCC CTG ACG TTG TCA GM ATG TCG T S R R Q V L X A G LA AL T L 5 G N S CNA GCC ATC G0C A" GNC GAA CTT TTA AAA AC AGC ANC GNca CNC AC MG CCG AAA GCC Q A I A X D N L L K T 1 G El 5 K P K A ANN AN" TCT GOC GGC AAA CGT GTC GTT GTT CTC OAT CCA GOT CAC GOC GGA ATT GNT ACC X X S G G X R V V V L D P G I 0 G I D T GN GCG ATC GM CGC anc GOT TCG AN OAN ANA CAT GlG OTG CTG GCG ATT GCT AA AAC G a X G R O SG K A 8 V V L A I A K N GTC COT TCC ATT TTG C1OT AT CAT GGG ATT GNT GCC COT TTA ACG CGT TCT GOC GNT ACG V R S I L R N H G I D A N L T R S G D T TTT ATC CCN CTT TAC GOT COC GTT GMA ATC 0CC CAT AM CAT GGC GCA OaT CTG TTT ATG F I P L T D R V Z I A 8 X 8 G A D L FM TCA ATT CAT GC OAT GOC TTT AC AC COG AN OCT GCC GOT GCT TCG GTA TTT 0CC CTC I H A D G F T N P EXA A G A S V F A L TCT ANC COT G00 CA AG AC GCA atg MG AAN TAC CTG TCT GM CGC GMA C CGC GCC N R G AS A8a N A X Y L 8 Z RN N R A GAT GM OTT 0C GOT AMA AG GC ACT OAC AMG GAT CaC CTA TTG CAN CAN GO CTM TT D N V A G XE A T D K D H L L Q Q V L F OAT CT(? GTG CAN Aca OAT ACC ATT Aa ANT AGT CTG ACG CTC GGC TCG CAT AT?CTG AM D L V Q T D P I K N S L T L G 5 H I L X AMG APT MAG CCG GTG ClT AM CTG CAC MC COC ANC ACC GMA CA ocg WCA TTT GT GOT K I K P V X L B S R NW T Z Q A A F V V TTG AMA TCN CCG TCG GTT CCT TCG OTG CTG OTG GML ACC TCOG TT ATC ACC AMC CCG GM L K 8 P 8 V P S V L V Z T S F I T N P S GA GM CGG CTG TTA a;c ACM QCG GCG TT COT CAG AM ATC GCC ACA rcg ATT GC GMa S R L L G T A A F R Q K I A T A I an 270 I 1249 GOC GTG ATC AOT TAT TTC CaC TOG TTC GAC ANC CAG AA OCA CAT TCG AM AAG CGA TAA V I S Y P H W F D N Q X A l S K K N * atl_atg AAA CCC GAC GCN CP4C CMG GTT AM CAG TTT CTG CTC AAC CTT CAG GAT ACG ATT N X P D A 8 Q V K Q F L L N L Q D T I TOT CMG CAG CTG ACC 0CC GTC GAT GGC OCA GA TTT GTC MA GAT AGT TGG CNG CGC GMA C Q Q L T A V D G A S F V I D S W Q R E CTGM C GGC GKC 00 COT AGT CGG GTG TTG CGT RAT GO GOT GTT TTC GMA CAG GCA GGC A G G G G R NR V L R N G G V FrE Q A G GTC AC TTT TCG CAT OTC CAC GGT GAG GCG ATG CCT GCT TCC GCC ACC GCT CAT CGC CCG V N F s H V I G 3 A N P A S A T A H R P GM CTT GCC G0G CGC AGT TTC GOLG GCG ATG GMC GTT TCA CTG GTA OTG CAT CCG CAT AAC N L A G R S F F A N G V S L V V B P H N CCG TAT OTT CCC ACC AGC CAC GMC AMT GTG CGG TTT T?T ATT 0CC GM AAA CCG GGT GCC P Y V P T S H A N V R F F I A E K P G A GAT CCC GTC TOG TOG TTT GMC GOT GGC TTC GAC TTA ACC CCN TTC TAT GOT TTT GA GM D P V w w F G G F 0D L T P F Y G F 13 E GAT. GCT ATT CAC TGG CAT CGC ACC GCC CGT GAC CTG TGC CTG CCA TTT GGC GMA GAC GTT D A I H W H R T A R D L C L P F G E D V 159 FIG. 2. Nucleotide sequence and deduced amino acid sequence for the cloned hemf operon. A potential r70-dependent promoter and two potential binding sites for IHF are underlined. The positions of the 5' ends of the mrnas indicated by primer extension analysis are marked with arrows. Note that the nucleotide sequence of orf is given in the orientation of the hemf operon, while the deduced amino acid sequence is shown in the opposite orientation, according to the direction of transcription. HIF 80o position orf3 could encode a protein of 350 amino acids DNA still complemented the HEM13 mutant of S. cerevisiae, with a calculated molecular mass of 40,248 Da. indicating that the encoded protein possessed coproporphy- The deduced orfl protein had 92% identity to the protein rinogen III oxidase function (Table 2). orf2 will henceforth be deduced from orf32, found upstream of the hemf gene of S. referred to as hemf, since this is the name of the gene for the typhimurium. Homology searches revealed strong similarity to aerobic coproporphyrinogen III oxidase in S. typhimurium the gene for N-acetylmuramoyl-L-alanine amidase from Bacil- (48). A comparison of the E. coli polypeptide with the polypeplus subtilis (23). Homology was also observed to a partially tide encoding a potential anaerobic coproporphyrinogen III sequenced open reading frame of unknown function upstream oxidase from R sphaeroides revealed no significant homology of the mutl gene of E. coli and S. typhimurium (25, 29). between the proteins. A hydrophobicity plot of the E. coli The predicted amino acid sequence for orf2 was 43% polypeptide indicated its hydrophilic character (data not identical to that of the yeast HEM13 gene product and 90% shown). identical to that of the product of the recently cloned hemf The orf3 gene product was found to be homologous to the gene from S. typhimurium (Fig. 3). A plasmid (phem5aorfl) XylS/AraC family of transcriptional activators, with the stronwhich carried only orf2 (hemf) and a small amount of flanking gest homology to the XylS protein, involved in the regulation

5 VOL. 176, 1994 HEME BIOSYNTHESIS AND COPROPORPHYRINOGEN III OXIDASE TAT CCC CGT TAC AAA AAG TGG TGC GAC GAA TAC TTC TAC CTC AAA CAT CGC AAC GAA CAG Y P R Y K K W C D E Y F Y L K H R N E Q CGC GGT ATT GGC GGG CTG TTC TTT GAT GAC CTG AAC ACG CCA GAT TTC GAC CGC TGT TTT R G I G G L F F D D L N T P D F D R C F GCC TTT ATG CAG GCG GTA GGC AAA GGC TAC ACC GAC GCT TAT TTA CCA ATT GTC GAG CGA A F M Q A V G K G Y T D A Y L P I V E R CGG AAA GCG ATG GCC TAC GGC GAG CGC GAA CGC AAT TTC CAG TTA TAT CGT CGC GGT CGT R K A M A Y G E R E R N F Q L Y R R G R TAT GTC GAG TTC AAT CTG GTC TGG GAT CGC GGC ACG CTG TTT GGC CTG CAA ACT GGC GGG Y V E F N L V W D R G T L F G L Q T G G CGC ACC GAG TCT ATC CTG ATG TCA ATG CCG CCA CTG GTA CGC TGG GAA TAT GAT TAT CAG R T E S I L M S M P P L V R W E Y D Y Q CCA AAA GAT GGC AGC CCA GAA GCG GCG TTA AGT GAG TTT ATT AAG GTC AGG GAT TGG GTG P K D G S P E A A L S E F I K V R D W V * G W E R M R Q H L T L S P K E S F TAA ctccctca CCC CCA CTC CCG CAT CCG CTG ATG CAG CGT CAG TGA CGG CTT CTC GGA AAA L Q Q Y D T A F Q G L H W F G W Q M A A 2271 CAG CTG CTG GTA ATC CGT GGC AAA TTG CCC CAG ATG CCA GAA TCC CCA CTG CAT GGC GGC 313D K V T M S Q S W P S I L E R R V A N L 2331 GTC TTT TAC CGT CAT ACT TTG CGA CCA CGG ACT TAT CAG TTC GCG GCG TAC GGC GTT CAG 293 R I R K L W A N P G I G L I A H F R N Q 2391 GCG AAT GCG TTT CAG CCA CGC GTT CCG GCC AAT GCC TAA AAT AGC GTG AAA CCG GTT TTG 273 L T R R S V H L Q N C L D L V T V P E S 2451 TAG CGT GCG GCG GCT GAC ATG CAG TTG ATT ACA CAA ATC CAG CAC CGT CAC CGG TTC GGA 253 M N E L V Y E R A R S L L R R Y S Q H S 2511 CATIGTT TTC CAG CAC ATA TTC ACG GGC GCG GGA AAG CAA TCG ACG GTA ACT CTG ATG ACT 233 IQT S E A T V M P Q A E H L N A G N A M L 2571 GAT GCT TTC CGC CGT CAC CAT TGG TTG CGC TTC TTC CAG CAT GGC CCC CAT CGC CAT TAG 213 L IN D G L V K R V A P Q H L N H P N E C 2631 CAA. ATT ATC CCC CAG CAC TTT TCG CAC TGC AGG CTG ATG GAG ATT TTC CGG ATT CTC GCA 193 F T A L A Q Q V F G W L A A X H Q H K V 2691 AAA CGT CGC CAG CGC CTG TTG GAC AAA GCC CCA CAG CGC GGC TTT ATG CTG CTC TTT CAC 173 E IL A S Q N R L M H L V R D P N H L F N 2751 TTC CAG CGC CGA CTG GTT ACG CAA CAT ATG TAA TAC CCG ATC CGG GTT ATG CAA AAA GTT 153 A IQ R T I V D E S L V V G L I T Y D D P 2811 AGC ICTG CCG GGT GAT GAC ATC TTC AGA AAG CAC CAC GCC CAG GAT CGT GTA ATC ATC CGG 133 T S L E F E T G G P R T A I H A S G L C 2871 CGT IGCT CAG TTC AAA TTC AGT GCC ACC AGG GCG GGT GGC GAT TTC CGC GCT TCC CAG ACA 113 Q. S G I F G Q E G R T A P I G F W F S N 2931 TTG ( CGA ACC GAT AAA TCC CTG CTC ACC GCG CGT CGC CGG AAT GCC AAA CCA GAA CGA GTT 93 W V L C S Q R L A L G T Y E R F V Q I 2991 CGG CCA GAC CAG GCA CGA CTG ACG CAG CGC CAG ACC GGT GTA TTC ACG AAA AAC CTG AAT 73D 1D L L I E T F E G H F K G P H L Q D Y 3051 ATC JATC GAG TAG AAT TTC CGT AAA TTC ACC ATG AAA CTT GCC CGG ATG CAG CTG ATC GTA 53I 1Q Q W A T I T L A H E Y V D T T Q R Q 3111 AAT ( CTG CTG CCA GGC GGT AAT CGT TAA AGC ATG TTC ATA GAC ATC CGT TGT CTG TCG TTG 33HB V N D V E V K P T L K L N E P L P H B 3171 ATG JAAC ATT ATC CAC TTC GAC CTT CGG CGT GAG CTT CAG GTT TTC GGG TAA GGG TTC ATG 13 Y L H H L N A T R T K K M 3231 ATA AAG ATG GTG CAA ATT GGC TGT ACG GGT CTT TTT CAT gatgttaatgccgggtgttgtaggaca A cccgacacctccqacaqqttaatqqggcttqaqacgataacgactactqcqtttacqtaacqtccqqcaqaaaaqaqc 3376 tqttcga FIG. 2-Continued of toluate metabolism in Pseudomonasputida (data not shown) (26, 33). This family of regulatory proteins is defined by a distinctive helix-turn-helix DNA-binding motif in the C-terminal region (11). Further studies will be needed to determine whether orf3 is involved in the regulation of heme biosynthesis. Interestingly, the 3' region of the hemf gene of E. coli showed no significant homology to the S. typhimurium DNA sequence or the deduced amino acid sequence for this region. Detection of the proteins encoded by the cloned DNA from E. coli. In vivo translation experiments were performed with pbluel3, which contains the orfl-hemf operon in the proper orientation to be expressed from a T7 RNA polymerase promoter on the plasmid. Polypeptides of approximately 31 and 35 kda, corresponding to the calculated molecular masses for Orfl and HemF, respectively, were observed (Fig. 4). Expression experiments with pblues, in which the cloned DNA is in the opposite orientation, yielded one labeled polypeptide of approximately 41 kda, corresponding to the calculated molecular mass for Orf3 (Fig. 4). Mapping of the 5' ends of mrnas and potential promoter elements for the hemf operon. Northern (RNA) blot analysis with a probe homologous to the hemf gene sequence indicated the presence of two differently sized transcripts originating from the hemf operon (data not shown), so the 5' region of orfl and the hemf gene were analyzed by primer extension for potential transcription start sites. One potential transcription start site (5' end of the long transcript) was located in the 5' region of orfl at position 328 and 331, approximately 110 bp upstream from the translational start site for orfl (Fig. SB and 2). A potential u70-dependent promoter was found upstream of this initiation site 5' of orfl at positions 292 to 297 (-35 region) and 318 to 323 ( -10 region). This promoter (ORF1-P) most likely sustains expression of the complete orfl-hemf operon. Genetic evidence indicates that in S. typhimurium,

6 678 TROUP ET AL. J. BACrERIOL. 1 M K D A H V K 9 F L LPL Q 1 G T D A N V D 5 W R 1I JI A P Q D P R N L, R Q UIM E A L I RURKLgj E SIG E T K F TgilT R G 9 t A GG G GU K nkv L KN G GV t t Q A G V N t S H V n [AM 5 A I A H K. 9 E A G G G G RS R V L RN G GI FE A G VN F S H VHG A MP A S A T A H R EEL. e T K N L R Ll-.. *.*.* IA HKSIF t A MUGVSL VV PR P IV P I 5 K A N V K F F I E.A R S F E A M GVSL V V H P H N P I P T S H A N V R F F I A 1 L PE DPKT G LPVT FA K M G U F Y G t titwu V IT HI DA LCL EIu Y KPLGA.DP.VWWF G FGG FD LTPIY Y GFiEEDA VIHWH RTA DR DL Q[P G D DVYP R jpqtiwwfgljg MD T PS ilg a D K HD1 T PR E c hemf S. t hemf S. c HEM 13 E. c hemf S. t hemf S. c HEM 13 E. c hemf S. t hemf S.c HEM 13 E. c. hef S. t hemf S.c HEM 13 "@IY K W U U t Y F Y L K H K N t: Q K G I G G L F F U U L N I P U F IRI FI-9A IFMQA V U KrG Y E.c* 1 K K W C D[a]Y F 1K H R N E R GIEIG G L F F D D L N T P D F D H IC FIDIF M Q A V_GGNI S.Lt hef 1S YK K W C D E Y F G I G E I L N M V E D C F D A F S.cHEMF PDIA MA I E R FRK N F U L Y K K 210 R A V E R R K A MIV WGERE R NF QL Y R R 36 IP KR KEM P R G R Y V t F N G R Y VE F N G R Y V E F N L V W U R G I L GLU L V W D R G T L F GL - 257r Y UIYy PK Dnr5p r V 5 ITI.G G R T E S I L M S M P P L V R W E YDW IPE AIG S P E A A L S E F I 1 V R D w I VN HH APiTV T RPrEWK E ct henf S. thmf S.c HEM 13 E c henif S. t. herf S. c. HEM 13 FIG. 3. Comparison of the amino acid sequences of the E. coli (E. c.) and S. typhimurium (S. t.) hemf genes (48) and the S. cerevisiae (S. c.) HEM13 gene (49) encoding coproporphyrinogen III oxidase. Identical residues are boxed. Dashes indicate gaps introduced to improve the alignment. hemf can be expressed from a promoter internal to orfl; however, no transcription start site could be mapped by primer extension (48). We found in E. coli a weak signal, possibly indicative of the hemf-specific promoter, that mapped in orfl at position 1292, 20 bp upstream from the translational start site for hemf (Fig. 5A and 2). No classical or - 35-type promoter sequences were detected in this region. A potential integration host factor (IHF) binding site (12) was found at positions 1290 to 1311, covering the apparent E. - ii r9'5w ;--100_h - ORF3 - homf - ORFI transcription initiation region of the hemf gene (Fig. 2). A second IHF binding site was located in the 5' region of orfi at positions 339 to 356, slightly downstream of the transcription initiation site (12). Both sequences were defined by their ability to match major parts of the consensus sequence previously determined for the site of binding of IHF (12). The second potential IHF binding site is part of a previously described bent DNA sequence (Bent 111) located from nucleotides 134 to 497 and covering almost the entire 5' region of orfl and 58 bp of the orfl coding region (43). The significance of the detected sequences remains to be elucidated. Chromosomal localization of the E. coli hemf locus. The Bent 111 region was previously mapped to 52.6 min of the E. coli chromosome (43). Hybridization of the inserts of phem5 and pheml3 to Kohara bacteriophages [420]E8E3(-) and [421]4ElO(+)x confirmed this result (data not shown) (22, 27). The restriction maps of our two clones (phems and pheml3) were identical to the Kohara map published for this region, with the exception of an additional PvuII site located at the 3' end of hemf (Fig. 1) (27). Alignment of the E. coli and S. typhimurium chromosomal maps assigns min 52.6 of the E. coli chromosome to min 50 of the S. typhimurium chromosome (27). This is the exact position mapped by Elliott and coworkers for the S. typhimurium hemf gene (47). FIG. 4. In vivo expression of the genes residing on the cloned E.coli DNA fragments. Plasmid-encoded gene products were labeled with [35S]methionine as described in Materials and Methods and detected by autoradiography after the separation of proteins on SDS-polyacrylamide gels. The plasmids used are indicated above the figure and are described in Fig. 1 and Table 1. The positions and apparent molecular masses (in kilodaltons) of protein standards run on the same gel are indicated.

7 VOL. 176, 1994 HEME BIOSYNTHESIS AND COPROPORPHYRINOGEN III OXIDASE 679 Al 1 T GC A B.4 * \ 1 23T GC A _ - O~~~~~~~~- _ = _.U. _ l O~~~~C FIG. 5. Primer extension mapping of the 5' ends of mrnas encoded by the hemf operon. Labeled oligonucleotides hybridized to total cellular RNA from E. coli were extended with AMV reverse transcriptase. The obtained products (lanes 1 to 3) were analyzed parallel to DNA sequencing reactions (lanes T, G, C, and A) performed with the same primers on a denaturing polyacrylamide gel and visualized by autoradiography. (A) Analysis of the 5' region of the hemf gene. Lane 1 contained 50,ug of cellular RNA. (B) Analysis of the 5' region of orfl. Lane 1 contained 20 p.g of RNA, lane 2 contained 60,ug of RNA, and lane 3 contained 100 pug of RNA. The reverse transcripts and the positions of the 5' ends of the mrnas are indicated with arrows. For the exact positions of the sites found, see the sequence in Fig. 2. DISCUSSION - :~~~~~- We have cloned the hemf gene, encoding the aerobic coproporphyrinogen III oxidase, of E. coli. This conclusion is supported by several observations. The gene that we cloned complemented two heme-deficient yeast HEM13 mutants, which were defective in aerobic coproporphyrinogen III oxidase. The predicted gene product has 43% identity and 90% identity to the aerobic coproporphyrinogen III oxidases of S. cerevisiae and S. typhimurium, respectively (48, 49). Finally, both the gene that we cloned from E. coli and hemf from S. typhimurium map to the corresponding positions on their chromosomes (47). However, the map position of the E. coli hemf gene at 52.6 min contradicts the position mapped for coproporphyrinogenaccumulating mutants of E. coli, which were isolated by Charles and coworkers (32). These mutations (sec-20 and popb7) were mapped near the gal gene at 17 min of the chromosome. To achieve a uniform genetic nomenclature, these mutants were later renamed hemf (35). Since these E. coli mutants obviously do not represent mutations in the hemf locus, the designation should be changed to the original popb, describing the phenotype as porphyrin-accumulating mutants. The same conclusion was drawn by Elliott and coworkers from a genetic investigation of the S. typhimurium loci encoding coproporphyrinogen III oxidase (47). E. coli hemf, like S. typhimurium hemf, was found in an operon together with a gene encoding a protein (Orfl) homologous to N-acetylmuramoyl-L-alanine amidase, the product of the cwlb gene from B. subtilis (23). It is possible that what we have identified as orfl is identical to amia, the gene for an N-acetylmuramoyl-L-alanine amidase that has been mapped to 51 min on the E. coli chromosome (44). orfl was also homologous to an unidentified open reading frame upstream of the mutl gene of S. typhimurium and E. coli, indicating the presence of a family of structurally related proteins in E. coli and S. typhimurium (25, 29). These findings suggest that Orfl could be an N-acetylmuramyl-L-alanine amidase involved in cell wall metabolism. Why an enzyme of cell wall metabolism would be encoded in the same operon as an enzyme involved in heme biosynthesis is not obvious at this time. Transcription of the yeast HEM13 gene is induced by the depletion of molecular oxygen and by low cellular levels of heme (21, 45, 49). In bacteria, efficient utilization of two coproporphyrinogen III oxidase genes for heme synthesis under aerobic (hemf) and anaerobic (hemn) conditions presumably requires their strongly coordinated expression. The presence of two promoter elements, one for the expression of the whole operon and one specific for hemf, could provide a basis for regulating hemf expression in response to different signals. The two potential IHF binding sites (12), a region of bent DNA (Bent 111) (43), and a putative transcriptional regulatory protein (Orf3) encoded downstream of hemf could also have a role in hemf expression. ACKNOWLEDGMENTS This work was supported by grants from the Deutsche Forschungsgemeinschaft, the Max-Planck-Gesellschaft, and the Graduiertenkolleg Enzymchemie of the Philipps-Universitat Marburg. We thank Ivana Weygand-Durasevic and Albert Crescenzo (Yale University, New Haven, Conn.) for help during the initial phase of the project and Erhart Bremer (Max-Planck-Institut, Marburg, Germany) for helpful discussions. We are indebted to Rosine Labbe-Bois (Institut Jacques Monod, Paris, France) for the gift of yeast strain S150-2BAHEM13, plasmid pfl39-hem13, and helpful advice. We thank Teresa Keng (McGill University, Montreal, Quebec, Canada) for the gift of yeast strain 25B and David Weiss (Philipps-Universitat Marburg) for critical reading of the manuscript. We are indebted to K. Yamamoto (University of California, San Francisco) for the gift of pg-1. REFERENCES 1. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. D. Seidman, J. A. Smith, and K. Struhl (ed.) Current protocols in molecular biology. Greene Publishing Associates and Wiley Interscience, New York. 2. Becker, D. M., and L. Guarente High-efficiency transformation of yeast by electroporation. Methods Enzymol. 194: Bitter, G. A., and K. M. Egan Expression of heterologous genes in Saccharomyces cerevisiae from vectors utilizing the glyceraldehyde-3-phosphate dehydrogenase promoter. Gene 32: Boorstein, W. R., and E. A. Craig Primer extension analysis of RNA. Methods Enzymol. 180: Camadro, J.-M., H. Chambon, J. Jolles, and P. Labbe Purification and properties of the coproporphyrinogen oxidase from the yeast Saccharomyces cerevisiae. Eur. J. Biochem. 156:

8 680 TROUP ET AL. 6. Chen, E. Y., and P. H. Seeburg Supercoil sequencing: a fast and simple method for sequencing plasmid DNA. DNA 4: Coomber, S. A., R. M. Jones, P. M. Jordan, and C. N. Hunter A putative anaerobic coproporphyrinogen III oxidase in Rhodobacter sphaeroides. I. Molecular clbning, transposon mutagenesis and sequence analysis of the gene. Mol. Microbiol. 6: Dailey, H. A. (ed.) Biosynthesis of heme and chlorophylls. McGraw-Hill Book Co., Hightstown, N.J. 9. Elliott, T Cloning, genetic characterization, and nucleotide sequence of the hema-prfa operon of Salmonella typhimurium. J. Bacteriol. 171: Elliott, T., and J. R. Roth Heme-deficient mutants of Salmonella typhimurium: two genes required for ALA synthesis. Mol. Gen. Genet. 216: Gallegos, M.-T., C. Michan, and J. L. Ramos The XylS/ AraC family of regulators. Nucleic Acids Res. 21: Goodrich, J. A., M. L. Schwartz, and W. R McClure Searching for and predicting the activity of sites for DNA binding proteins: compilation and analysis of the binding sites for Escherichia coli integration host factor (IHF). Nucleic Acids Res. 18: Hino, S., and A. Ishida Effect of oxygen on heme and cytochrome content of some facultative bacteria. Enzyme 16: Hitzeman, R. A., F. E. Hagie, J. S. Hayflick, C. Y. Chen, P. H. Seeburg, and R. Derynck The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase. Nucleic Acids Res. 10: lhag, L L., and D. Jahn Activity and spectroscopic features of the Escherichia coli glutamate 1-semialdehyde aminotransferase and the putatice active site mutant K265R. Biochemistry 31: Ilag, L. L., D. Jahn, G. Eggertsson, and D. SoIl The Escherichia coli heml gene encodes glutamate 1-semialdehyde aminotransferase. J. Bacteriol. 173: Jacobs, N. J., J. M. Jacobs, and H. E. Morgan, Jr Comparative effect of oxygen and nitrate on protoporphyrin and heme synthesis from A-aminolevulinic acid in bacterial cultures. J. Bacteriol. 112: Jahn, D., U. Michelsen, and D. SoIl Two glutamyl-trna reductase activities in Escherichia coli. J. Biol. Chem. 266: Jahn, D., E. Verkamp, and D. Soll Glutamyl-transfer RNA: a precursor of heme and chlorophyll biosynthesis. Trends Biochem. Sci. 17: Jordan, P. M Biosynthesis of tetrapyrroles. In A Neuberger and;l. L. M. van loeenen (ed.), Ne'w comprehensive biochemistry, vol. 19. Elsevier, Amsterdam. 21. Keng, T HAPI and ROXI form a regulatory pathway in the repression of HEM13 transcription in Saccharomyces cerevisiae. Mol. Cell. Biol. 12: Kohara, Y., K. Akiyama, and K. Isono The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50: Kuroda, A., and J. Sekiguchi Molecular cloning and sequencing of a major Bacillus subtilis autolysin gene. J. Bacteriol. 173: Laemmli, U. K Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227: Mankovich, J. A., C. A. McIntyre, and G. C. Walker Nucleotide sequence of the Salmonella typhimurium mutl gene required for mismatch repair: homology of mutl to hexb of Streptococcus pneumoniae and to PMSI of the yeast Saccharomyces cerevisiae. J. Bacteriol. 171: Marques, S., and J. L. Ramos Transcriptional control of the Pseudomonas putida plasmid catabolic pathway. Mol. Microbiol. 9: Miller, J. H. (ed.) A short course in bacterial genetics: a J. BACTERIOL. laboratory manual and handbook for Escherichia coli and related bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 28. O'Neill, G. P., D. Jahn, and D. Soil Transfer RNA involvement in chlorophyll biosynthesis. Subcell. Biochem. 17: Pang, P. P., A. S. Lundberg, and G. C. Walker Identification and characterization of the mutl and muts gene products of Salmonella typhimurium LT2. J. Bacteriol. 163: Philipp-Dornston, W. K., and M. Doss Comparison of porphyrin and heme biosynthesis in various heterotrophic bacteria. Enzyme 16: Poulson, R., and W. J. Polglase Aerobic and anaerobic coproporphyrinogenase activities in extracts from Saccharomyces cerevisiae. J. Biol. Chem. 249: Powell, K. A., R Cox, M. McConville, and H. P. Charles Mutations affecting porphyrin biosynthesis in Escherichia coli. Enzyme 16: Ramos, J. L., F. Rojo, L. Zhou, and K. N. Timmis A family of positive regulators related to the Pseudomonas putida TOL plasmid XylS and the Escherichia coli AraC activators. Nucleic Acids Res. 18: Sambrook, J., E. F. Fritsch, and T. Maniatis Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 35. Sasarman, A., P. Chartrand, R Proschek, M. Desrochers, D. Tardif, and C. Lapointe Uroporphyrin-accumulating mutants of Escherichia coli K-12. J. Bacteriol. 124: Schena, M., D. Picard, and K R. Yamamoto Vectors for constitutive and inducible gene expression in yeast. Methods Enzymol. 194: Seehra, J. S., P. M. Jordan, and M. Akhtar Anaerobic and aerobic coproporphyrinogen III oxidases of Rhodopseudomonas spheroides. Biochem. J. 269: Sherman, F Getting started with yeast. Methods Enzymol. 194: Strathern, J. N., and D. R Higgins Recovery of plasmids from yeast into Escherichia coli: shuttle vectors. Methods Enzymol. 194: Studier, F. W., A. H. Rosenberg, J. J. Dunn, and J. W. Dubendorff Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185: Tait, G. H Coproporphyrinogenase activity in extracts from Rhodopseudomonas spheroides. Biochem. Biophys. Res. Commun. 37: Tait, G. H Coproporphyrinogenase activities in extracts of Rhodopseudomonas spheroides and Chromatium strain D. Biochem. J. 128: Tanak, K.-I., S. Muramatsu, H. Yamada, and T. Mizuno Systematic characterization Qf curved DNA segments randomly cloned from Escherichia coli and their functional signi~fcance. Mol. Gen. Genet. 226: Tomioka, S., T. Nikaido, T. Miyakawa, and M. Matsuhashi Mutation of the N-acetylmuramyl-L-alanine amidase gene of Escherichia coli K-12. J. Bacteriol. 156: Verdiere, J., M. Gaisne, and R. Labbe-Bois CYP1 (HAP1) is a determinant effector of alternative expression of heme-dependent transcription in yeast. Mol. Gen. Genet. 228: Verkamp, E., M. Jahn, D. Jahn, M. Kumar, and D. Sol Glutamyl-tRNA reductase from Escherichia coli and Synechocystis J. Biol. Chem. 267: Xu, K., J. Delling, and T. Elliott The genes required for heme synthesis in Salmonella typhimurium include those encoding alternative functions for aerobic and anaerobic coproporphyrinogen oxidation. J. Bacteriol. 174: Xu, K., and T. Elliott An oxygen-dependent coproporphyrinogen oxidase encoded by the hemf gene of Salmonella typhimurium. J. Bacteriol. 175: Zagorec, M., J.-M. Buhler, I. Treich, T. Keng, L. Guarente, and R Labbe-Bois Isolation, sequence, and regulation by oxygen of yeast HEPM13 gene coding for coproporphyrinogen oxidase. J. Biol. Chem. 263: