Evidence of Evolution
|
|
- Owen Morton
- 6 years ago
- Views:
Transcription
1 Evidence of Evolution
2 Biogeography
3 The Age of Earth and Fossils Ancient artiodactyl Modern whale
4 Ancestors of Whales Ambulocetus could both swim in shallow water and walk on land. Rodhocetus probably spent most of its time in water. Ancient artiodactyl Pakicetus Ambulocetus Rodhocetus
5 Evolution of Whales Modern whales have ancient structures Odontocetes Basilosaurus only swims. Mysticetes Modern whales Dorudon Basilosaurus
6
7 Gaps in the Fossil Record
8 Homology What does the word Homologous mean? Homology is the study of similarity between organisms There are three major branches of homology: Anatomical Homology Embryological Homology Molecular Homology
9 Homologous Structures Frog Alligator Chicken Horse Ancient lobed-finned fish
10 Vestigial Structures
11 Evidence of Evolution Analogous Structures: structures similar in function, but not inherited from a common ancestor. Same function, different structure
12 Development
13 Embryological Homology The diagram below shows embryos of five different species: pig, chicken, fish, turtle, and human. Can you tell which is which?
14 Figured it out yet?
15 How about now?
16 Did you guess correctly?
17
18 Embryological Homology Did you know that when you were inside your mother s womb, for a while you looked almost exactly like a fish? Vertebrate embryos all share a similar pattern of development, suggesting that they may share common ancestry
19 Chicken 2 ½ days Human 31 days Pig 21 days
20 Genetics and Molecular Biology
21 Molecular Homology All living things contain DNA and RNA. Changes in Proteins, DNA and RNA can be traced from ancestors to their descendents. The fewer Amino Acid differences between organisms, the closer their inferred evolutionary relationship. Hemoglobin and Cytochrome C are a group of proteins that are commonly found in many different organisms
22 Our ancient DNA GTGCCAGCAGCCGCGGTAATTCCAGCTCCAAT AGCGTATATTAAAGTTGCTGCAGTTAAAAAG Codes for an RNA enzyme that plays a crucial role in protein synthesis Present in EVERY cell in the world (and some viruses ) Evolved in the common ancestor of ALL life
23 Our modern DNA There are around 100 mutations in your genome that are NOT present in your mother or father
24 Testing Natural Selection Platyspiza strips bark with a beak designed to grip and hold tightly, like a pair of pliers. Pinaroloxias probes for insects, fruit, and nectar with a curved beak, like needle-nose pliers. Certhidea picks insects off surfaces with a straight, narrow beak, like needle-nose pliers. Geospiza breaks large, thick seeds with a beak that is thick, strong, and sharp, like heavy-duty wire cutters.
25 Bird Survival Based on Beak Size
26 Genes and Variation
27 Genotype and Phenotype Genotype: particular combination of alleles Phenotype: physical, physiological, and behavioral characteristics
28 Genetics and Evolutionary Theory Natural selection acts on an organism s characteristics, not on its alleles.
29 Allele Frequency Number of times an allele occurs in a gene pool, as a percentage of the total occurrence of all alleles In 50 alleles: In 100 alleles: 20 alleles are B (black) 40 are B (black) 30 alleles are b (brown) 60 are b (brown)
30 Alleles in a Population Evolution involves any change in the frequency of alleles in a population over time. In a population of 25 mice, how many mice are in each genotype?
31 Genetic Variation Three evolutionary mechanisms that generate genetic variation: mutation genetic recombination lateral gene transfer Possible chromosome combinations is 2 n. In humans, n = = 8,388,608
32 Single-Gene Traits Traits controlled by only one gene Without bands With bands
33 Single-Gene Traits Phenotypic ratios are determined by the frequency of alleles and by whether the alleles are dominant or recessive. 77% 23%
34 Polygenic Traits Traits controlled by two or more genes
35 Polygenic Traits Height in humans is an example of a polygenic trait.
36 Evolution as Genetic Change in Populations
37 How Natural Selection Works An evolutionary adaptation is any genetically controlled trait that increases an individual s fitness.
38 Natural Selection on Single-Gene Traits Natural selection on single-gene traits can produce changes in allele frequencies that may be reflected by simple changes in phenotype frequencies.
39 Natural Selection on Polygenic Traits Natural selection on polygenic traits can produce three types of selection: directional selection stabilizing selection disruptive selection
40 Directional Selection Individuals at one end of the curve have higher fitness than individuals in the middle or at the other end.
41 Stabilizing Selection Individuals near the center of the curve have higher fitness than individuals at either end.
42 Disruptive Selection Phenotypes at the upper and lower ends of the curve have higher fitness than individuals near the middle.
43 Genetic Drift Genetic drift is a random change in allele frequency. Genetic bottlenecks The founder effect Founding populations Descendants
44 Evolution Versus Genetic Equilibrium If a population is not evolving, the population is in genetic equilibrium. Sexual reproduction Hardy Weinberg principle
45 Hardy Weinberg Principle and In words, this is stated: (frequency of AA) + (frequency of Aa) + (frequency of aa) = 100% and (frequency of A) + (frequency of a) = 100% If p = 0.40 and q = 0.60: Probability of genotype Aa: AA: aa: 16% 36% 48%
46 Hardy Weinberg Principle To maintain genetic equilibrium there must be: Random mating Large population size No immigration or emigration No mutations No natural selection The H-W Principle predicts that: If any of these conditions occur it can disturb genetic equilibrium, causing evolution.
List the five conditions that can disturb genetic equilibrium in a population.(10)
List the five conditions that can disturb genetic equilibrium in a population.(10) The five conditions are non-random mating, small population size, immigration or emigration, mutations, and natural selection.
More informationEnduring Understanding: Change in the genetic makeup of a population over time is evolution Pearson Education, Inc.
Enduring Understanding: Change in the genetic makeup of a population over time is evolution. Objective: You will be able to identify the key concepts of evolution theory Do Now: Read the enduring understanding
More informationEvolutionary change. Evolution and Diversity. Two British naturalists, one revolutionary idea. Darwin observed organisms in many environments
Evolutionary change Evolution and Diversity Ch 13 How populations evolve Organisms change over time In baby steps Species (including humans) are descended from other species Two British naturalists, one
More informationEvidence of Evolution by Natural Selection. Dodo bird
Evidence of Evolution by Natural Selection Dodo bird 2007-2008 Evidence supporting evolution Fossil record transition species Anatomical record homologous & vestigial structures embryology & development
More information16.4 Evidence of Evolution
16.4 Evidence of Evolution Lesson Objectives Explain how geologic distribution of species relates to their evolutionary history. Explain how fossils and the fossil record document the descent of modern
More informationTheory a well supported testable explanation of phenomenon occurring in the natural world.
Evolution Theory of Evolution Theory a well supported testable explanation of phenomenon occurring in the natural world. Evolution the process by which modern organisms changed over time from ancient common
More informationEvidence of Evolution. Lesson Overview. Lesson Overview Evidence of Evolution
Lesson Overview Lesson Overview 16.4 THINK ABOUT IT Scientists in some fields, including geology, physics, paleontology, chemistry, and embryology, did not have the technology or understanding to test
More informationEvolution Test Review
Name Evolution Test Review Period 1) A group of interbreeding organisms (a species) living in a given area is called population 2) Give an example of a species. Ex. One wolf Give an example of a population.
More informationIV. Comparative Anatomy
Whale Evolution: Fossil Record of Evolution Modern toothed whales Rodhocetus kasrani reduced hind limbs could not walk; swam with up-down motion like modern whales Pakicetus attocki lived on land; skull
More informationEvolution. Changes over Time
Evolution Changes over Time TEKS Students will analyze and evaluate B. 7 C how natural selection produces change in populations, not individuals B. 7 E/F effects of genetic mechanisms and their relationship
More informationBiology 20 Evolution
Biology 20 Evolution Evolution: Modern synthesis: Individuals: Lamarck: Use and disuse: Inheritance of Acquired Traits: Darwin: Travelled: Galapagos Islands: What was the name of Darwin s book, which he
More informationMechanisms of Evolution. Adaptations. Old Ideas about Evolution. Behavioral. Structural. Biochemical. Physiological
Mechanisms of Evolution Honors Biology 2012 1 Adaptations Behavioral Structural Biochemical Physiological 2 Old Ideas about Evolution Aristotle (viewed species perfect and unchanging) Lamarck suggested
More informationEvidence of EVOLUTION
Evidence of EVOLUTION Evolution: Genetic change in a population through time Charles Darwin On his journey around the world, Darwin found evidence of GRADUAL CHANGE (evolution) He cited evidences he found
More informationBiology Chapter 15 Evolution Notes
Biology Chapter 15 Evolution Notes Section 1: Darwin's Theory of Evolution by Natural Selection Charles Darwin- English naturalist that studied animals over a number of years before developing the theory
More informationBig Idea #1: The process of evolution drives the diversity and unity of life
BIG IDEA! Big Idea #1: The process of evolution drives the diversity and unity of life Key Terms for this section: emigration phenotype adaptation evolution phylogenetic tree adaptive radiation fertility
More informationSection 15 3 Darwin Presents His Case
Section 15 3 Darwin Presents His Case (pages 378 386) Key Concepts How is natural variation used in artificial selection? How is natural selection related to a species fitness? What evidence of evolution
More informationSince Darwin s work, every scientific test has supported Darwin s basic ideas about evolution
Guided Reading Answers Since Darwin s work, every scientific test has supported Darwin s basic ideas about evolution Biogeography Biogeography is the study of where organisms live now, and where they and
More informationThursday, January 14. Teaching Point: SWBAT. assess their knowledge to prepare for the Evolution Summative Assessment. (TOMORROW) Agenda:
Thursday, January 14 Teaching Point: SWBAT. assess their knowledge to prepare for the Evolution Summative Assessment. (TOMORROW) Agenda: 1. Show Hinsz your completed Review WS 2. Discuss answers to Review
More informationMechanisms of Evolution Darwinian Evolution
Mechanisms of Evolution Darwinian Evolution Descent with modification by means of natural selection All life has descended from a common ancestor The mechanism of modification is natural selection Concept
More informationConcepts of Evolution
Concepts of Evolution Isn t Evolution Just A Theory? How does the scientific meaning of a term like theory differ from the way it is used in everyday life? Can the facts of science change over time? If
More information1.1: Natural selection is a major mechanism of evolution 1. NATURAL SELECTION
Domain 1: Evolution 1.1: Natural selection is a major mechanism of evolution 1. NATURAL SELECTION Charles Darwin Pre-Darwin Lyell: Geology, Uniformitarianism! very old earth. Malthus: Exponential Population
More informationChapter 8: Evolution and Natural Selection
Darwin s dangerous idea: evolution by natural selection Lectures by Mark Manteuffel, St. Louis Community College Chapter 8: Evolution and Natural Selection Use new chapter opening photo here Do Now: Scientific
More informationReview of molecular biology
Review of molecular biology DNA is into RNA, which is into protein. What mrna sequence would be transcribed from the DNA template CTA? What sequence of trna would be attracted by the above mrna sequence?
More informationUnit 9 - Evolution Practice Quiz
Unit 9 - Evolution Practice Quiz Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Lamarck s theory of evolution includes the concept that new organs in
More information16.4 The Evidence of Evolution. Adapted from following Materials; Biology,Miller & Levine (2010) Understanding Evolution (evolution.berkely.
16.4 The Evidence of Evolution Adapted from following Materials; Biology,Miller & Levine (2010) Understanding Evolution (evolution.berkely.edu) Guiding Question: What are the main lines of scientific evidence
More informationSlide 1. Slide 2. Slide 3. Concepts of Evolution. Isn t Evolution Just A Theory? Evolution
Slide 1 Concepts of Evolution Slide 2 Isn t Evolution Just A Theory? How does the scientific meaning of a term like theory differ from the way it is used in everyday life? Can the facts of science change
More informationUnderstanding Natural Selection
Understanding Natural Selection Charles Darwin (1809-1882) Sailed around the world 1831-1836 What did Darwin s Travels reveal The diversity of living species was far greater than anyone had previously
More informationEvidences of Evolution
Evidences of Evolution Darwin stated that all organisms descend from a common ancestor Darwin based his theory of Natural Selection on observations of: Traits, geographical distribution, selective breeding,
More informationCH 16: Evolution of Population
CH 16: Evolution of Population 16.1 Genes and Variation A. Introduction 1. Darwin s theory of evolution by natural selection explained how 2. What Darwin did not know was how were passed down through each
More informationChapter 16. Table of Contents. Section 1 Genetic Equilibrium. Section 2 Disruption of Genetic Equilibrium. Section 3 Formation of Species
Population Genetics and Speciation Table of Contents Section 1 Genetic Equilibrium Section 2 Disruption of Genetic Equilibrium Section 3 Formation of Species Section 1 Genetic Equilibrium Objectives Identify
More informationEvolution Unit: What is Evolution?
Evolution Unit: What is Evolution? What is The Theory of Evolution? Evolution is, a change (in the genetic composition) of a population over time. on a larger scale, the entire biological history, from
More informationTHE THEORY OF EVOLUTION
THE THEORY OF EVOLUTION Why evolution matters Theory: A well-substantiated explanation of some aspect of the natural world, based on a body of facts that have been repeatedly confirmed through observation
More informationNOTES CH 17 Evolution of. Populations
NOTES CH 17 Evolution of Vocabulary Fitness Genetic Drift Punctuated Equilibrium Gene flow Adaptive radiation Divergent evolution Convergent evolution Gradualism Populations 17.1 Genes & Variation Darwin
More informationWhat is Evolution? Study of how things change over time
10.2 15 Darwin s Theory Observations of Evolution What is Evolution? Study of how things change over time 10.2 15 Darwin s Theory Observations of Evolution Theories of Evolution - Lamarck Jean Baptiste
More informationWarm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab
Date: Agenda Warm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab Ask questions based on 5.1 and 5.2 Quiz on 5.1 and 5.2 How
More informatione.g. population: 500, two alleles: Red (R) and White (r). Total: 1000 genes for flower color in the population
The Evolution of Populations What is Evolution? A change over time in the genetic composition of a population Human evolution The gene pool Is the total aggregate of genes for a particular trait in a population
More informationAP Biology Concepts and Connections. Reading Guide. Your Name: ! Chapter 13 How Populations Evolve. Key Terms
AP Biology Concepts and Connections Chapter 13 How Populations Evolve Reading Guide Key Terms adaptation fossils microevolution artificial selection founder effect molecular biology balancing selection
More informationAP Biology Review Chapters Review Questions Chapter 15: Darwin Chapter 16-17: Evolution
AP Biology Review Chapters 15-19 Review Questions Chapter 15: Darwin 1. What was the common belief before Darwin? 2. Know the following people and their contributions: Linnaeus, Cuvier, Lamarck, Wallace,
More informationEvolution of Populations. Chapter 17
Evolution of Populations Chapter 17 17.1 Genes and Variation i. Introduction: Remember from previous units. Genes- Units of Heredity Variation- Genetic differences among individuals in a population. New
More informationHBio Evolution 2 Practice test
HBio Evolution 2 Practice test Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The genes carried by all members of a particular population make up the
More informationEvidence of Evolution
Evidence of Evolution There is a gigantic body of evidence supporting evolution. Six major areas of study contribute to that body of evidence: 1. The Fossil Record 2. Comparative Anatomy 3. Comparative
More informationUNIT V. Chapter 11 Evolution of Populations. Pre-AP Biology
UNIT V Chapter 11 Evolution of Populations UNIT 4: EVOLUTION Chapter 11: The Evolution of Populations I. Genetic Variation Within Populations (11.1) A. Genetic variation in a population increases the chance
More informationChapters 17, 19.2, & 16.4 EVOLUTION
Chapters 17, 19.2, & 16.4 EVOLUTION STANDARD #2 EXPLAIN THE PROCESS OF NATURAL SELECTION A. Explain how genes make evolution possible (17.1) B. Describe what cause a gene pool to change over time (17.2)
More informationEvolution. Darwin s Voyage
Evolution Darwin s Voyage Charles Darwin Explorer on an observation trip to the Galapagos Islands. He set sail on the HMS Beagle in 1858 from England on a 5 year trip. He was a naturalist (a person who
More informationFinal Revision G8 Biology ( ) Multiple Choice Identify the choice that best completes the statement or answers the question.
Final Revision G8 Biology ( 2017-2018 ) Multiple Choice Identify the choice that best completes the statement or answers the question. 1 A species is a group of similar organisms that A can mate with each
More informationMicroevolution Changing Allele Frequencies
Microevolution Changing Allele Frequencies Evolution Evolution is defined as a change in the inherited characteristics of biological populations over successive generations. Microevolution involves the
More informationEvolution Common Assessment 1
Evolution Common Assessment 1 1. The field of biology that includes the study of the origin of new species through time is known as 5. A. biochemistry B. evolution C. ecology D. embryology 2. Evidence
More informationChange Over Time. Evidence for evolution
Change Over Time Evidence for evolution 1. Fossils 2. Geographic Distribution of Living Things 3. Structural Adaptations 4. Physiological Adaptations 5. Anatomy 6. Biochemistry 1. Fossils In biological
More informationEvolution and Natural Selection (16-18)
Evolution and Natural Selection (16-18) 3 Key Observations of Life: 1) Shared Characteristics of Life (Unity) 2) Rich Diversity of Life 3) Organisms are Adapted to their Environment These observations
More informationEvidence of Evolution
16.4 Evidence for Evolution Biogeography Biogeography - study of where organisms live, where they and ancestors lived. Two significant patterns: - closely related species separate in different climates.
More informationTheory. Pattern and Process
Theory Pattern and Process Definition of Science: Science is based on evidence and always changing. Scientists test explanations and predictions of natural phenomena. Some questions are outside the realm
More informationStation 1. What is Evolution? What causes Evolution? A primary example of Evolution, is different bird beak sizes. What caused this to occur?
Station 1 What is Evolution? What causes Evolution? A primary example of Evolution, is different bird beak sizes. What caused this to occur? Station 2 What is Survival of the Fittest? How is fitness measured?
More informationWTHS Biology Keystone Exams
WTHS Biology Keystone Exams Biology Keystone Review Packet 10 th / 11 th Grade Keystone Test Prep This packet contains helpful information for you to prepare for the upcoming Biology Keystone Test on May
More informationProcesses of Evolution
15 Processes of Evolution Forces of Evolution Concept 15.4 Selection Can Be Stabilizing, Directional, or Disruptive Natural selection can act on quantitative traits in three ways: Stabilizing selection
More informationEvolution. Taxonomy. Domains. Prokaryotes vs Eukaryotes
Evolution Taxonomy Domains Prokaryotes vs Eukaryotes Evolution unifying theme in biology Explains Both similarities and differences among living things How groups of organisms are related How organisms
More informationEvolution AP Biology
Darwin s Theory of Evolution How do biologists use evolutionary theory to develop better flu vaccines? Theory: Evolutionary Theory: Why do we need to understand the Theory of Evolution? Charles Darwin:
More informationSCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION. Using Anatomy, Embryology, Biochemistry, and Paleontology
SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION Using Anatomy, Embryology, Biochemistry, and Paleontology Scientific Fields Different fields of science have contributed evidence for the theory of
More informationAP Biology Evolution Review Slides
AP Biology Evolution Review Slides How would one go about studying the evolution of a tetrapod limb from a fish s fin? Compare limb/fin structure of existing related species of fish to tetrapods Figure
More informationGrade 11 Biology SBI3U 12
Grade 11 Biology SBI3U 12 } We ve looked at Darwin, selection, and evidence for evolution } We can t consider evolution without looking at another branch of biology: } Genetics } Around the same time Darwin
More informationEvidence of Species Change
Evidence of Species Change Evidence of Evolution What is evolution? Evolution is change over time Scientific theory of evolution explains how living things descended from earlier organisms Evidence of
More informationPopulation Genetics & Evolution
The Theory of Evolution Mechanisms of Evolution Notes Pt. 4 Population Genetics & Evolution IMPORTANT TO REMEMBER: Populations, not individuals, evolve. Population = a group of individuals of the same
More informationEvidences of Evolution (Clues)
Evidences of Evolution (Clues) Darwin stated that all organisms descended from a common ancestor Darwin based his theory of Natural Selection on observations of: Traits, geographical distribution, selective
More informationEvolution Unit Ch in Miller & Levine Biology textbook
Evolution Unit Ch. 15-17 in Miller & Levine Biology textbook Evolution: theory of how modern organisms have descended from ancient organisms; a.k.a. "a change over time" Charles Darwin is one of the many
More informationDarwin s Observations & Conclusions The Struggle for Existence
Darwin s Observations & Conclusions The Struggle for Existence 1 Voyage of the Beagle During His Travels, Darwin Made Numerous Observations And Collected Evidence That Led Him To Propose A Revolutionary
More informationOutline. Evolution: Speciation and More Evidence. Key Concepts: Evolution is a FACT. 1. Key concepts 2. Speciation 3. More evidence 4.
Evolution: Speciation and More Evidence Evolution is a FACT 1. Key concepts 2. Speciation 3. More evidence 4. Conclusions Outline Key Concepts: A species consist of one or more populations of individuals
More informationEvolution. Chapters 16 & 17
Evolution Chapters 16 & 17 Darwin s Voyage Chapter 16 Change over time Evolution Charles Darwin Developed a scientific theory that explains how modern organisms evolved over long periods of time through
More informationMicroevolution (Ch 16) Test Bank
Microevolution (Ch 16) Test Bank Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Which of the following statements describes what all members
More informationChapter 15 Evolution
Section 1: Darwin s Theory of Natural Selection Section 2: Evidence of Section 3: Shaping ary Theory Click on a lesson name to select. 15.1 Darwin s Theory of Natural Selection Darwin on the HMS Beagle
More informationCH_15_Evolution.notebook. February 28, Cellular Evolution. Jean Baptiste de Lamarck. Endosymbiont Theory. Charles Darwin
Cellular Evolution The first cells were prokaryotic They did not need oxygen (the atmosphere did not contain oxygen until 1.8 billion years ago) Eukaryotic cells were found in the fossil record about 2
More informationWhat is Evolution? Evolution Unit Vocabulary. Answer: Evidence of Evolution. What is a Gene Pool? Change over time.
What is Evolution? Evolution Unit Vocabulary Practice Quiz Change over time. Evidence of Evolution The gradual development of something, especially from simple to more complex. Can be big or very small
More information1. T/F: Genetic variation leads to evolution. 2. What is genetic equilibrium? 3. What is speciation? How does it occur?
1. T/F: Genetic variation leads to evolution. 2. What is genetic equilibrium? 3. What is speciation? How does it occur? Warm UP Notes on Environmental Factor Concept Map Brief 6 questions and Concept Map
More informationChapter 16: Evolutionary Theory
Chapter 16: Evolutionary Theory Section 1: Developing a Theory Evolution: Artificial Selection: Evolution: I. A Theory to Explain Change Over Time B. Charles Darwin C. Theory: D. Modern evolutionary theory
More informationChapter 17: Population Genetics and Speciation
Chapter 17: Population Genetics and Speciation Section 1: Genetic Variation Population Genetics: Normal Distribution: a line graph showing the general trends in a set of data of which most values are near
More informationThe slow, gradual change in a population of organisms over time
The slow, gradual change in a population of organisms over time SB5. Students will evaluate the role of natural selection in the development of the theory of evolution. acquired characteristics inherited
More informationEvidence of Evolution by Natural Selection. Evidence supporting evolution. Fossil record. Fossil record. Anatomical record.
Evidence of Evolution by Natural Selection Dodo bird Evidence supporting evolution Fossil record transition species Anatomical record homologous & vestigial structures embryology & development Molecular
More information19. When allele frequencies change as a result of the migration of a small subgroup of a population
CP Biology: Evolution Name: Per: Directions: Use your textbook to help you answer the practice questions for each chapter. It is important that you READ the chapter sections and not just search for the
More informationFace area (cm 2 ) Brain surface area (cm 2 ) Cranial capacity (cm 3 ) 1, Jaw Angle ( º )
Honors Biology Test : Evolution GOOD LUCK! You ve learned so much! Multiple Choice: Identify the choice that best completes the statement or answers the question. (2 pts each) 1. As we move through the
More informationStation 1: Evidence from Current Examples
Station 1: Evidence from Current Examples Go to the website below: http://www.pbs.org/wgbh/evolution/educators/lessons/lesson6/act1.html Watch the video segment called Why does evolution matter now? After
More informationWhich concept would be correctly placed in box X? A) use and disuse B) variation C) changes in nucleic acids D) transmission of acquired traits
1. Base your answer to the following question on Some of the concepts included in Darwin's theory of natural selection are represented in the diagram below. Which concept would be correctly placed in box
More informationEvolution of Populations
Evolution of Populations Gene Pools 1. All of the genes in a population - Contains 2 or more alleles (forms of a gene) for each trait 2. Relative frequencies - # of times an allele occurs in a gene pool
More informationReproduction and Evolution Practice Exam
Reproduction and Evolution Practice Exam Topics: Genetic concepts from the lecture notes including; o Mitosis and Meiosis, Homologous Chromosomes, Haploid vs Diploid cells Reproductive Strategies Heaviest
More informationThe Living Environment Unit 4 History of Biologic Diversity Unit 15 Evolution: (15.2) Evidence of Evolution-class key. Name: Class key.
Name: Class key Period: Topic 15.2 assignments Pages/Sections Date Assigned Date Due Topic: Evidence for Evolution Objective: What scientific evidence supports evolution theory? Evidence supporting evolution
More informationHeredity and Evolution
Heredity and Variation Heredity and Evolution Living organisms have certain recognisable heritable features such as height, complexion, colour of hair and eyes, shape of nose and chin etc. These are called
More informationAP Biology Review Packet 5- Natural Selection and Evolution & Speciation and Phylogeny
AP Biology Review Packet 5- Natural Selection and Evolution & Speciation and Phylogeny 1A1- Natural selection is a major mechanism of evolution. 1A2: Natural selection acts on phenotypic variations in
More informationchatper 17 Multiple Choice Identify the choice that best completes the statement or answers the question.
chatper 17 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. If a mutation introduces a new skin color in a lizard population, which factor might determine
More informationBiology. Slide 1 of 41. End Show. Copyright Pearson Prentice Hall
Biology 1 of 41 Do Now: Why do the colors of moths change over time? Write a detailed explanation on the scrap paper provided. 2 of 41 Why do the colors of moths change over time? 3 of 41 4 of 41 Evolution
More informationBiology 20 Chapter 5 Lesson 2 Evidence for Evolution. Today s species that exist have evolved from ancestral ones.
Biology 20 Chapter 5 Lesson 2 Evidence for Evolution Today s species that exist have evolved from ancestral ones. This theory of evolution is supported by many different types of evidence collected by
More informationSources of Evidence of Evolution
Sources of Evidence of Evolution In The Origin of Species, Darwin assembled a group of facts that had previously seemed unrelated. Darwin s ideas were developed, for the most part, by his observations
More informationAfter you read this section, you should be able to answer these questions:
CHAPTER 10 1 Change Over Time SECTION The Evolution of Living Things 7.3.c, 7.3.d California Science Standards BEFORE YOU READ After you read this section, you should be able to answer these questions:
More informationREVIEW 6: EVOLUTION. 1. Define evolution: Was not the first to think of evolution, but he did figure out how it works (mostly).
Name: REVIEW 6: EVOLUTION 1. Define evolution: 2. Modern Theory of Evolution: a. Charles Darwin: Was not the first to think of evolution, but he did figure out how it works (mostly). However, Darwin didn
More informationReproduction- passing genetic information to the next generation
166 166 Essential Question: How has biological evolution led to the diversity of life? B-5 Natural Selection Traits that make an organism more or less likely to survive in an environment and reproduce
More informationDichotomous Key for Genus Problematica
Evolution Summative Assessment DO NOT WRITE ON TEST 1. Industrial melanism describes the change in moth color from pale to dark after pollution from factories resulting in coating tree trunks with a layer
More information1.A- Natural Selection
1.A- Natural Selection Big Idea 1: The process of evolution drives the diversity and unity of life. EU 1.A- Evolution is change in the genetic makeup of a population over time. EU 1.B- Organisms are linked
More informationname: Worksheets for Ch 14, 15, 16 Evolution
name: Worksheets for Ch 14, 15, 16 Evolution Classify the following scenarios as examples of either artificial or natural selection by placing the letter for each scenario into the appropriate box below.
More informationSo what is Evolution anyway?
Evolution 3/2/14 So what is Evolution anyway? Definition: A change over time More specifically: change in relative frequency of alleles in a population Note the word POPULATION INDIVIDUALS DO NOT EVOLVE
More informationAP Biology. Evolution is "so overwhelmingly established that it has become irrational to call it a theory." Evidence of Evolution by Natural Selection
Evidence of Evolution by Natural Selection Evolution is "so overwhelmingly established that it has become irrational to call it a theory." -- Ernst Mayr What Evolution Is 2001 Professor Emeritus, Evolutionary
More informationThe Theory of Evolution
Name Date Class CHAPTER 13 DIRECTED READING The Theory of Evolution Section 13-1: The Theory of Evolution by Natural Selection Darwin Proposed a Mechanism for Evolution Mark each statement below T if it
More informationWeek 7.2 Ch 4 Microevolutionary Proceses
Week 7.2 Ch 4 Microevolutionary Proceses 1 Mendelian Traits vs Polygenic Traits Mendelian -discrete -single gene determines effect -rarely influenced by environment Polygenic: -continuous -multiple genes
More informationTHE EVIDENCE FOR EVOLUTION
Unit 37 THE EVIDENCE FOR EVOLUTION LEARNING OBJECTIVES 1. Understand the meaning of the term evolution. 2. Learn about fossil evidence including how fossils are formed. 3. Learn how comparative anatomy
More informationGuided Notes: Evolution. is the change in traits through generations over! Occurs in, NOT individual organisms
Guided Notes: Evolution The Theory of Evolution is the change in traits through generations over! Occurs in, NOT individual organisms How Have Organisms Changed? At the time life emerged, the Earth was
More information