The eye development of Astyanax cavefish

Transcription

1 Ma, Cave Research 2016, 2:1 Review Open Access ISSN The eye development of Astyanax cavefish Li Ma 1,2,* 1 Department of Biology, University of Maryland, College Park, MD 20742, USA 2 Department of Biological Sciences, University of Cincinnati, Cincinnati, OH 45221, USA * Correspondence: mal2@ucmail.uc.edu Abstract: Astyanax mexicanus, the Mexican tetra, is an excellent genetic model for research of adaptations to darkness and eye development and evolution. It s a single a single species consisting of eyed surface-dwelling (surface fish) and many con-specific blind cave-dwelling (cavefish) morphs. The surface and cavefish forms are completely interfertile, cavefish can also be crossed for genetic complementation analysis, provide the opportunity of genetic analysis of eye development. Because of the perpetual dark environment and limitation of food, the cave populations have evolved a series of constructive changes and regressive changes. However, the most obvious change is cave population lost the functional eyes during adult stage. In order to better understand the cavefish eye degenerative development and related molecular mechanism, this paper first overview of the eye development process in vertebrate, talk about the molecular mechanism under the eye development and lens inductive process in vertebrate, then introduce the degenerative development of Astyanax cavefish vision system, and discuss the molecular mechanism underlie cavefish eye degenerative development and evolution. Keywords: Astyanax mexicanus; cavefish; eye degeneration; development; molecular mechanism Overview of eye development: The eye is a highly specialized extension of the brain. In vertebrate, the first time of morphological appearance of eye is the bilateral evagination of diencephalon with the name optic primordia in the early neurula stage, and the continued evagination of the optic primordia leads to the formation of the optic vesicles, finally give rise to the lens and cornea. Mesenchyme between the optic vesicle and the surface ectoderm begin to have close physical contact, and lots of critical signal changes are involved in this period. During this stage, the lens placode is formed first and begin to contact with the optic vesicle (Cvekl & Piatigorsky 1996, Graw 1996, Wistow & Piatigorsky 1988, Wride 1996). There are some differences between mammalian and avian, and fish. In mammalian and avian, the contact of lens placode and optic vesicle results in the formation of lens vesicle and optic cup. In zebrafish, the development of lens does not include the formation of a lens vesicle (Schmitt et al., 1994, Easter et al., 1996, Soules et al., 2005, Dahm et al., 2007). Then, the lens fiber cells and retina cells begin to differentiate and form a complete eye finally. The molecular mechanism of eye development: The morphological differention of eye formed after a series of pattern and inductive events. According previous research (Robert and Richard, 2001), the development of eye is mainly devided into four stages, is forming the early eye filed, dorsal and ventral patterning of optic vesicle, neural retinal pigment epithelium induction, and dorsal and ventral patterning of neural retina. At the first stage of forming the early eye field, the specifying eye formation is followed with neural induction. The famous neural induction pathway is including mediated by Chordin, Noggin, Follistatin, Cerberus, and xnr3 (reviewed in Harland 2000, Weinstein & Hemmati-Brivanlou 1999) that antagonize the bone morphogenetic protein (BMP) signaling pathways. Then, a serious of transcription factors that critical for eye development and pattern the early eye field begin to express in early vertebrate embryos, that including Otx2, Pax6, Rx, Six3, and Hesx1/Rpx. For these transcription factors, Otx2, Six3, and Pax6 are initially express in the anterior neural plate, and later express in the retinal progenitor cells (Blitz and Cho, 1995; Oliver et al., 1995; Pannese et al., 1995; Simeone et al., 1993; Walther and Gruss, 1991). Rx and pax6 are generally expressed in entire anterior area. For these genes, the rx (Retinal homeobox) gene family is a conserved small family is a of paired-like homeobox genes that is critical for vertebrate eye formation in many species (Casarosa et al., 1997; Eggert et al., 1998; Furukawa et al., 1997b; Loosli et al., 2001; Mathers et al., 1997; Ohuchi et al., 1999). The expression of vertebrate Rx is most conserved in the anterior neural plate, followed by the expression in the eyes and ventral forebrain, and plays an important role in regulating the initial specification of retinal cells and their subsequent proliferation (Travis et al., 2004). The six3 gene is a member of the Six-gene family of vertebrates (Cheyette et al., 1994; Oliver et al., 1995) with the expression in the anterior neural plate and optic vesicles, lens, olfactory placodes and ventral forebrain, and have been found involved in head midline and eye formation in many species (mouse: Oliver et al., 1995; Kawakami et al., 1996; Chicken: Bovolenta et al., 1996; Xenopus: Ghanbari et al., 2001; medaka: Loosli et al., 1998; zebrafish: Seo et al., 1998; Human: Gallardo et al., 1999; Oliver et al., 1995). Pax6 is a member of the highly conserved developmental Pax gene family, and essential for the development of lens and retina of vertebrate embryos (Walther, 1991; Puschel et al., 1992; Nornes, 1998), though it is also expressed outside of the eye, i.e. in the developing brain, olfactory, piruitary, pancreas and spinal cord (for a review, see Simpson and Price, 2002). Pax6 plays cellautonomous roles in the lens (Quinn et al., 1996; Collinson et al., 2001), however, in the other ocular cells the Pax6 play cell or non-cell autonomous functions (Collinson et al., 2003; 2004). The most critical role of Pax6 gene is for lens formation. The mutations of Pax6 gene will result in defective eyes (Drosophila: Quiring et al., 1994; mouse: Hogan et Cave Research, 2016, 2:1, 1 1

2 CAVE RESEARCH 2016,2:1, 1 al., 1986, 1988; human: Ton et al., 1991), and ectopic expression of Pax6 will induce an ectopic formation of eyes (Halder et al., 1995; Chow et al., 1999). During later eye development, Pax6 is expressed in the lens epithelium, retina, and cornea (Macdonald and Wilson 1997), and also important for differentiation response to lens signaling (Beebe and Coats 2000; Yamamoto and Jeffery 2000). The expression of Pax6 is necessary for expression of c-maf, MafA/L-Maf, Six3, Prox1, and retinoic acid signaling. In order to regulation of gene expression, Pax6 generally form functional complexes with lots of transcription factors including the retinoblastoma protein, prb, MafA, Mitf and Sox2. (Ashery-Padan et al., 2000; Sakai et al., 2001; Goudreau et al., 2002; Reza et al., 2002) to perform its regulatory function. The first stage of forming the early eye field also accompany with the growth and patterning of the anterior neural plate in vertebrate, that controlled by the signal from signal centres which most locate at the embryonic midline (for a review, see Vieira et al., 2010). The centres signals include Shh, Wnt, secreted frizzled related protein (Sfrp), bone morphogenetic protein (Bmp), and fibroblast growth factor (Fgf) (Echelard et al., 1993; Lee and Jessell, 1999; Muroyama et al., 2002; Houart et al., 2002; Liem et al., 1997; Shimamura and Rubenstein, 1997). At the second stage of dorsal and ventral patterning of optic vesicle, Cyc signaling from underlying prechordal mesoderm will up-regulation of midline Hedgehog (hh) signal will specify the ventral optic vesicle (Robert and Richard, 2001). The reciprocal respression of Pax2 and Pax6 will induce to form a sharp boundary forms between neural retina and optic stalk (Robert and Richard, 2001). In early embryos, a single eye field will appear in the anterior neural plate. The single eye field needs to divide into two areas, otherwise will cause cyclopia. The Cyclops (cyc) gene encodes a secreted, Nodal-related member of the transforming growth factor (TGF) superfamily (Feldman et al. 1998, Sampath et al. 1998), is an important ventralizing signals coming from prechordal mesoderm and necessary for dividing single eye area into two areas (Ekker et al. 1995, Hatta et al. 1991, Macdonald et al. 1995). The cyc may regulate shh expression directly (Barth & Wilson 1995, Krauss et al. 1993) and cyc misexpression can act in a cell non-autonomous manner to rescue shh expression in cells of the ventral brain and floor plate of cyc mutants (Sampath et al. 1998). Sonic hedgehog, a mammalian hedgehog homologue, can induce the retinal differentiation in vertebrates (Neumann & Nuesslein-Volhard 2000), is consistent with the graded repression of Pax6 by Shh in the developing neural tube (Ericson et al. 1997), plays a critical role in specifying the ventral region of the developing eye. Patterning of the ventral optic vesicles is highlighted by the genes such as Pax2 (a paired homeobox gene) (Dressler et al. 1990, Nornes et al. 1990), Vax1 (Hallonet et al. 1998), and tailless (an orphan nuclear receptor) (Hollemann et al. 1998). The expression of Pax2 and Pax6 expression would initially overlap, eventually, owing to the reciprocal transcriptional repression of these genes, they would resolve into two distinct expression domains thereby establishing a distinct boundary at the optic stalk neural retina junction (Schwarz et al. 2000). At the third stage of neural retinal pigment epithelium induction, signals from the surface ectoderm include BMP and the fibroblaslt growth factor (FGF) are important for neural retina specification, whereas signals from extraoclar mesenchyme (possibly BMPs or activins) are believed to function in RPE specification (Robert and Richard, 2001). At the last stage of dorsal and ventral pattering of neural retina, the distinct patterning occurs within the neural retina under the influence of retinoic acid, also the Pax2 gene is normally present in the ventral neural retina, and it s expression will decrease at the late stage of development. Lens induction and development: Lens induction is a multi-step process The development of lens is a multi-step process. At the beginning, the lens lineage originate from a cluster of cells locate at the head surface ectoderm, it gradually differentiated into lens cells under a serious of transcription factors functions including Pax6, Otx2, Sox2, BMPs, FGFs, and retinoic acid. Using modern techniques, the role of early tissue interaction in lens induction have been re-examined and defined by Grainger and colleagues. They found the process of forming a lens mainly include four steps. First, the lens lineage cells need obtain the forming competence in the middle and late gastrula ectoderm; second the lens lineage cells need the acquisition of a lens-forming bias throughout the head ectoderm during neurltion; third, the lens lineage cells need specify the lens-forming bias during neurulation; fourth, the lens begin to differentiate and continue this process throughout life (Grainger 1992). In all vertebrates, the lens maintains a distinct polarity. During the whole process, the lens-forming competence may be a cell-autonomous event since its timing appears to remain unchanged in ectoderm that is precultured in isolation (Servetnick & Grainger 1991). The acquisition of a lens-forming bias throughout the head ectoderm is thought to be mediated, in part, by planar signals derived from the anterior neural plate, which are qualitatively different from those provided by the optic vesicle (Grainger 1992, Grainger et al. 1997). A lot of transcription factor and genes have critical function for lens development. Pax6 is essential for lens induction Pax6 gene is the master gene for entire vision system development, and critical for lens development. Pax6 expression in the presumptive lens region of vertebrates is first detected at early neurula stages (Grindley et al. 1995; Li et al. 1997, 1994; Walther & Gruss 1991). In Xenopus, this expression appears shortly after that of Pax6 in the anterior neural plate and is clearly visible as a distinct band of expression lateral and adjacent to the region of Pax6 expression in the anterior neural plate (Li et al. 1997). Pax6 expression continues throughout the surface ectoderm overlying the optic vesicles, but as the lens begins to differentiate, it becomes restricted to the proliferating lens epithelial cells (Grindley et al. 1995). Studies of the SeyNeu mutant have defined that the Pax6 has two distinct phases of expression. The first phase is the pre-placodal phase of Pax6 expression (Pax6pre-placode), and the second phase is placodel phase of Pax6 expression (Pax6placode). The second phase Pax6placode expression is dependent upon the first phase Pax6pre-placode expression (Wawersik et al. 1999). Bmp4 and Bmp7 play important roles in lens development Besides the Pax6 gene, the Bmp4 and Bmp7 also play important roles in 2 Cave research, 2016, 2:1, 1

3 CAVE RESEARCH 2016,2:1,1 lens development. For example, the Bmp7 plays an important role upstream of Pax6 during lens placode formation and specification (Wawersik et al. 1999). Furthermore, the timing of this proposed role for Bmp7 in lens induction and in the control of Pax6 expression in the lens placode indicate that Bmp7 signaling during this period of lens development is directed toward activating the Pax6 enhancers active in placodal ectoderm. The research also suggests that Bmp4 activity combines with at least one other signal to permit optic vesicle-induced lens induction (Wawersik et al. 1999). FGF receptor signaling is required for lens induction So far, several research about fibroblast growth factors functions using different vertebrate species has suggest that fibroblast growth factor (FGFs) and/or fibroblast growth factor receptors (FGFRs) play a key role in lens development including lens induction, lens cell proliferation and survival, lens fiber differentiation and lens regeneration (Michael, 2006). The developing vertebrate lens expresses all four FGFR genes (Kurose et al., 2005). Both loss- and gain-of-function experiments have shown that FGF signaling is necessary and sufficient for lens fiber cell differentiation (reviewed in McAvoy et al. 1991). Sox1, Sox2, and Sox3 participate in lens development Sox genes encode transcription factors containing a sex determining factor (SRY) related HMG box. Members of the Group B1 SOX family of transcription factors are Sox1, Sox2, and Sox3 are implicated in lens development. Based on their expression, they were originally implicated in lens differentiation (Kamachi et al. 1995). The Sox1, 2, and 3 display similar expression patterns in the developing lens, however also have some differences. In mice and chick, Sox1 is first expressed during the invagination of the lens placode and later is predominantly expressed in lens fiber cells. Sox2 and Sox3 expression appear prior to lens placode formation in ventral surface ectoderm bordering the presumptive lens region (Kamachi et al. 1998). Tissue ablation experiments have demonstrated that Sox2 and Sox3 expression in the presumptive lens ectoderm depends on the presence of the optic vesicle (Kamachi et al. 1998). Sox2 gene is a member of SoxB1 family genes that are involved in neural development from the early derivation of the neural primordium to the eventual differentiation of the central nervous system (CNS; Chicken: Uwanogho et al., 1995; Rex et al., 1997a,b; Uchikawa et al., 1999,2003;Mouse: Wood and Episkopou, 1999;Xenopus: Kishi et al., 2000;Mizuseki et al., 1998; vertebrate: Bylund et al., 2003; Graham et al., 2003; Pevny and Placzek, 2005). And the Sox2 gene has been found took important role in lens and retina development (Kamachi et al., 1998; Kondoh 1999) and function together with Pax6 (Kamachi et al. 2001; Kondoh et al. 2004; Aota et al. 2003; Masashi Inoue et al., 2007). The six zebrafish B1 sox genes, which include pan-vertebrate sox1a/b, sox2, and sox3, and also fish-specific sox19a/b have been identified, and the Sox2 shows anterior-restricted expression (Yuich Okuda et al., 2006). Prox1 is essential for lens fiber cell differentiation Prox1 gene encodes a transcription factor essential for lens fiber cell differentiation (Wigle et al. 1999) and is normally most abundant in the transitional, equatorial region of the lens, is expressed at high levels throughout the lens epithelium (Blixt et al. 2000, Brownell et al. 2000). Prox1 and c-maf/l-maf (c-maf in mammals and L-maf in the chick) are expressed in the lens epithelium, transcripts from all of these gene are markedly increased early in the lens fiber differentiation process. Six3 play the critical role in lens induction The sine oculis-related transcription factor six3 play the critical role in lens induction and express in the developing lens. However, it looks the Six3 gene has differences in the time of its expression at different species. In mice, Six3 expression in the developing lens first appears during the formation of the lens placode and is later restricted to the lens epithelium (Oliver et al. 1995). In Medaka fish, Six3 is expressed in the presumptive lens ectoderm and like Optx2, is down-regulated in the lens placode prior to lens differentiation (Loosli et al. 1998). As in Medaka, chick Six3 is expressed in the presumptive lens ectoderm overlying the optic vesicles but persists in the lens placode and is later localized to the lens epithelium (Bovolenta et al. 1998). Misexpression studies in Medaka have shown that Six3 can lead to formation of ectopic lenses (Oliver et al. 1996). In contrast to Pax6-induced ectopic lens formation in Xenopus, Six3 misexpression can transform the otic vesicle into lens (Oliver et al. 1996). Maf family members in lens development Several members of the maf family of basic-leucine zipper transcription factors have been implicated in lens induction and differentiation. L-maf is first expressed in the lens placode and can up-regulate several crystallin genes when misexpressed in Xenopus embryos and ectodermal explants or in chick neural retinal cultures (Ishibashi & Yasuda 2001, Ogino & Yasuda 1998). C-maf has been shown to play an essential role in lens differentiation: Homozygous c-maf loss-of-function mouse mutants are microphthalmic, have a reduction in crystallin expression, and have defects in lens fiber cell elongation (possibly as a consequence of reduced crystalline expression) (Kawauchi et al. 1999, Kim et al. 1999, Ring et al. 2000). Xenopus mafb is expressed much earlier in development in the presumptive lens ectoderm and is later restricted to the lens epithelium of the mature lens (Ishibashi & Yasuda 2001). In Xenopus ectodermal explants, XmafB can upregulate Pax6, Lens1, Six3, Sox3, and L-maf, as well as several crystallin genes (Ishibashi & Yasuda 2001). All these results suggest that XmafB may play a role in lens induction and in maintenance of the lens epithelium. alphaa-crystallin The lens is a unique tissue composed with long-lived proteins, called

4 CAVE RESEARCH 2016,2:1, 1 crystallins, which constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Mammalian lens crystallins are divided into alpha, beta, and gamma families. Alpha crystallins are composed of two gene products: alpha-a and alpha-b, for acidic and basic, respectively. Alpha crystallins can be induced by heat shock and are members of the small heat shock protein (shsp also known as the HSP20) family. They act as molecular chaperones although they do not renature proteins and release them in the fashion of a true chaperone; instead they hold them in large soluble aggregates. Post-translational modifications decrease the ability to chaperone. Two additional functions of alpha crystallins are an autokinase activity and participation in the intracellular architecture. The crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. During mammalian and zebrafish lens development, α-crystallin is the first crystallin synthesized in lens (Kurita et al.,2003, Andley, 2008) and it is initially detected in the lens placode (Robinson and Overbeek, 1996). The expression of αa-crystallin is the lens specific in zebrafish and mammalian (Kurita et al.,2003; Srinivasan et al., 1992). In zebrafish, aacrystallin expression begins at about 25 hpf, which corresponds to the starting of elongation of lens fiber cells (Kurita et al., 2003). Lens-specific expression of the αa-crystallin gene is regulated primarily at the transcriptional level (Cvekl and Piatigorsky, 1996). Mouse and chicken αa-crystallin promoter regions were isolated (Cvekl and Piatigorsky, 1996), and these genes had similar 5 -flanking sequences in about 100 base pairs of the proximal promoter region, which contained several common cis-elements for transcription factors such as Pax6, CREB, and USF (Cvekl and Piatigorsky 1996) and (Ogino and Yasuda 2000). αbcrystallin is widely expressed in non-lenticular tissues, and particularly abundant in brain, heart and muscle (Iwaki et al., 1990). Both αa- and αbcrystallin are found in lens epithelial cells but their synthesis is strongly up regulated upon differentiation to the lens fibre cells (van Leen et al., 1987a). αa- and αb-crystallin continue to be synthesized during lens development (Voorter et al., 1990; Ueda et al., 2002) and would then be homogenously distributed throughout the lens. The expression level of α- crystallin is rather variable between species. It is abundant in man (40% of soluble lens protein), less so in rodents (20%), while from chicken and fish values as low as 10% of the total lens protein have been reported (de Jong, 1981). The functions of α-crystallins are both as structural proteins and as chaperones in the lens (Bloemendal et al., 2004). A primary function of crystallins is to focus light on the retina by maintaining the necessary refractive characteristics and clarity of the lens. In zebrafish, aa-crystallin is important for normal lens development. In the absence of αa-crystallin, γ-crystallin is not solubilized, and lens fiber cells do not differentiate, which affects lens transparency and produces cataracts (Goishi et al. 2006). The other function of α-crystallin that expressed in lens epithelial cells is acting as molecular chaperones (Andley et al., 1998; Wang et al., 2004). As survival proteins, they prevent cell death during differentiation (Morozov and Wawrousek, 2006; Lovicu and Robinson, 2004) and suppress the aggregation of proteins denatured by oxidation, heat, and other stressors (Andley, 2008). The vertebrate αa-crystallin genes are regulated by a complex array of transcription factors, including Pax6, retinoic acid receptors, members of the Sox, Maf, and CREB families, AP- 1, and Prox1 (Kamachi et al. 1995; Yang et al. 2006). There are multiple regions in a-crystallin subunits may be involved in chaperone activity (Sharma et al.,2000; reviewed in Van Montfort et al., 2001; Ghosh, 2005, 2008). Since lens can grow throughout the lifetime of an individual, many significant changes will happen of lens crystallins, such as deamidation, truncation, oxidation, glycation, and methylation, lead to structural changes in the crystallins. These mechanisms play a major role in converting the largely soluble pool of crystallins into the largely insoluble pool with aging. Studies suggest that the same modifications decrease the chaperone activity of α-crystallin. Heat Shock Proteins Several heat shock proteins also play important roles in lens development, such as aa-crystallin. Heat Shock Proteins (HSPs) are members of a small and highly conserved gene family encoding molecular chaperones, the cytoplasmic mediators of protein folding and metabolism, and the molecular chaperones that bind to and prevent aggregation of proteins. So far, there are three major hsp subgroups are distinguished by their ralative molecular masses: the first is Hsp90 (~90kDa) which play a novel role in lens apoptosis and cavefish eye degeneration (Thomas A. Hooven, 2004), the second is Hsp70 (~70Da), and the third is the low molecular weight hsps (16~47 kda), such as alpha-crystallin. Small Heat Shock Proteins (shsps) have important roles in preventing disease and promoting resistance to environmental stressors. Mutations in aa-crystallin (HSPB4) or ab-crystallin (HSPB5) can result in neuronal degeneration and cataract formation. (Kimberly et al., 2007) The degenerative development of cavefish vision system: Astyanax mexicanus, a single species consisting of eyed surface-dwelling (surface fish) and many con-specific blind cave-dwelling (cavefish) morphs, is an excellent system for understanding the genetic mechanism for eye development. Because of the perpetual dark environment and food limitation, the cavefish have evolved a series of constructive changes and regressive changes: the constructive changes include an increase in the number and distribution of taste buds and teeth, olfactory neurons, and cranial neuromasts, the sensory organs of the lateral line, increased mouth and jaw size, and retention of significant amount of fat in the body; the regressive changes include regressed eyes, a reduction in melanin pigment, as well as reduced schooling behavior, aggression, and sleep (Jeffery, 2001). However, the most distinct characteristic of cavefish is the 4 Cave research, 2016, 2:1, 1

5 CAVE RESEARCH 2016,2:1,1 degeneration and disappearing of vision system. This is the result of adapting the environment highly, and can inherit to next generation, forming an independent population (Gross et al., 2006; Protas et al., 2006; Joshua et al., 2009). Although the adult Astyanax cavefish lost the functional eyes, they have small eye primordial during embryogenesis. During embryogenesis, there are two mainly differences between surface fish and cavefish before hatching. The first is the cavefish optic cup and lens is smaller than surface fish. The second is the ventral region of the cavefish optic cup is also reduced in size (Jeffery, 2009). After hatching, the eye continues to grow and develop in surface fish, however, in the cavefish, the eye growth is arrested and degeneration begins, which subsequently sink into the orbits. This degeneration is also accompanied by apoptosis in the lens, however, the embryonic lens starts to apoptosis before the eye degeneration (Jeffery, 2009). Cell Death Studies via TUNEL show much more apoptosis in the lens and retinas of Pachon cavefish embryos when compared with surface fish. The phenotype of cavefish eye is also very similar to some disease in human. The lens transplantation experiments have been made in Astyanax cavefish in Jeffery lab. When a surface fish embryonic lens was transplanted into the optic cups of cavefish can rescues the eye in adults. The restored eye exhibited an anterior chamber, an iris, a cornea, and a retina containing differentiated photoreceptors cells. Conversely, when a cavefish embryonic lens was transplanted into the optic cup of a surface fish cause retardation of eye development in adults. The cornea, anterior chamber, and iris failed to differentiate, retinal growth was retarded, and the eye sunk into the orbit. These lens transplantation experiments show that surface fish lens can stimulate cavefish eye growth and differentiation, and cavefish have retained the ability to respond to a lens inductive signal. Thus, apoptosis is controlled autonomously within the lens vesicle (Yamamoto and Jeffery, 2000). According to the published developmental staging table for Astyanax mexicanus (Sylvie, 2011), the neurulation begins between 9.6 and 9.9hpf, which accompany with a visible thickening in the anterior neural plate area. In Astyanax, the eye development starts at 12hpf and visible at 5-6 somites stage. However, the lens is visible at 18.5hpf. In surface fish, the eye start showing black melanophores between 19 and 23hpf. Before hatching, the lens and retina looks very clear around 24hpf. F1 hybrid eyes also grow until adulthood, but at all stages they are smaller than surface fish eyes. Compare to zebrafish, the Astyanax mexicanus hatching is early, and eye degeneration happen after hatching. The molecular mechanism of eye degeneration in cavefish: The cavefish eye regression is a multi-factorial trait controlled by many genes acting in concert to suppress optic development. A serious of genes and transcription factors that important for eye development had been research in Astyanax mexicanus. So far, the most researched eye gene in Astyanax mexicanus is Pax6 gene. The pax6 gene encodes a transcription factor essential for eye development in vertebrates. In 2001, Strickler reported two differences in pax6 expression in early cavefish embryos compare to surface fish embryos. The first is the pax6 expression domains corresponding to eye primordia are smaller in cavefish embryos. The second is there is a gap in pax6 expression area at the anterior margin of the neural plate in cavefish embryos. These different expressions of Pax6 gene in cavefish caused a smaller optic vesicle. The molecular process involved in cavefish eye degeneration has been simple summarized as five steps. First, pax6 expression is reduced at the anterior midline during neural plate specification. Second, a smaller lens and optic vesicle/cup are formed possibility as a result of earlier pax6 suppression. Third, the small cavefish lens undergoes apoptosis instead of differentiation. Fourth, in the absence of lens signaling, the cornea, iris, pupil and retinal photoreceptor cells fail to develop. Fifth, the eye eventually collapses into the orbit and is covered by a flap of skin. (Yamamoto et al., 2004; Menuet and Alunni., 2007; Rétaux et al., 2008 ). There are mainly three stages expressed pax6 in eye development. During the neural plate stage, pax6 as a very important transcription factor, induce the early eye field forming, at this stage, the pax6 express pattern in cavefish is smaller than surface fish, however, the express pattern is similar in surface fish and cavefish. During the lens induction pathway, pax6 play very important role at two stages, the first is pre-placode lens stage, and the second is lens placode stage. At the pre-placode stage, the eye s development of cavefish is comparable normal and still has small lens form, this show that pax6 function is probable right at this stage, and also because the pax6 gene has many transcripts that can compensate the function each other, such as in mice pax6 gene has 30 transcripts that may be can instead of the function each other. At lens placode stage, the lens fiber cell begin to differentiation, the lens protein alphaa-crystallin begin to express, pax6 as an important regulator of aa-crystallin, will regulate the alphaacrystallin s expression together with other lineage-restricted transcription factors including members of large Maf family, prox1, Six3, Sox1 and Sox2. Because the alphaa-crystallin only have on transcript that more easily to lead to the un-rescue mutation, and most alphaa-crystallin gene have the binding site of pax6 at the upstream region, so the pax6 gene should be have very critical role at lens placode stage for cavefish eye degeneration. Besides the Pax6 gene, the genetic analysis shows that several other gene that involved in eye s degenerative development of cavefish (Jeffery, 2002; Borowsky and Wilkens, 2002). During vertebrate development, Hedgehog (Hh) signals emanating from the underlying prechordal plate inhibit pax6 expression along the midline to divide the original eye domain into bilateral eyes. In cavefish, the Shh ventral midline expression domain was found expanded laterally and anteriorly, throughout gastrulation, neurulation and later on, when compared with surface fish (Karen et al., 2011). According the research in vertebrate, the shh activity is play a critical role in the ventral patterning of the optic vesicle in addition to the earlier role of shh derived from the ventral midline (Ekker et al., 1995; Macdonald et al., 1995), this show that the late expressed shh signal may be mainly responsible for the cavefish optic vesicle s ventral part decrease. Shh expansion in cavefish is physiological and probably adaptive, it could be compensated by other signalling pathways to prevent deleterious effects on brain development. Thus, Shh expansion in cavefish has highly specific consequences on the expression of downstream genes of the Nkx2.1 and LIM-hd families, resulting either in expression heterochrony of Lhx7, which is rapidly compensated and has no consequences on telencephalic patterning, or in an increase of Lhx6 expression, which might confer a selective advantage to the cavefish, or in an increase of the size of the hypothalamus, which is more difficult to interpret in terms of adaptation (Menuet, 2007). Figure1 Expression of Pax6 gene in Surface fish (A), Pachon cavefish(b) and hybrid fish(c) at late stage.

6 CAVE RESEARCH 2016,2:1, 1 Through the QTL studies, the three candidate gene αa-crystallin, shroom2, and rom1 for eye QTL were revealed by anchored map. The first candidate gene αa-crystallin is tightly linked to the eye QTL on linkage group21, the anti-apoptotic factor αa-crystallin was previously predicted to be involved in eye degeneration by its substantial downregulation in Piedras and Pachon cavefish (Allen et al., 2007). The aa-crystallin gene, which encodes a heat shock protein-related chaperone with antiapoptotic activity, is substantially downregulated in the developing cavefish lens (Allen et al., 2007). In situ hybridization has shown that αa-crystallin mrna expression is primarily in the lens from during the embryo development in surface fish and hybrid fish (Li et al., 2014). Pachon cavefish has very weak αa-crystallin express from 24h to 60h of development, which disappears at 72h of development. Sections of in situ hybridized embryos showed αa-crystallin mrna expression in thalamus, casquette, notochord in surface fish and Pachon cavefish. The surface fish also has very strong expression since lens differentiation. However, Pachon cavefish showed weak aa-crystallin expression in the posterior part of its small lens at 48h. Through the compare of 10 kb of aa-crystallin genomic DNA sequence from surface fish and Pachon cavefish, two big differences were found upstream the gene between surface fish and Pachon cavefish: the first is the Pachon cavefish delete a fragment of "CA" in a tandom repeat of "CA, that contains a putative enhancer; the second is, Pachon cavefish insert a long fragment of 633bp, which is a major candidate for the critical mutation leading to αacrystallin down regulation in lens. The sequence differences in the region that may be potential binding sites of transcription factors. Alignment the aa-crystallin genomic DNA sequence between different species of human, mouse, chicken, zebrafish, surface fish, and Pachon cavefish, the results show that the three exon region is conserved between different species, no big mutation was found in coding region. And the zebrafish, surface fish and Pachon cavefish also have a conserved region before the first exon, this region may be the basic promoter region, also no mutation of this promoter region was found between surface fish and Pachon cavefish, so hypothesis that the regulationn of cavefish αa-crystallin is impaired because of mutations in the promoter region can be excluded. In order to check the function of aa-crystallin in eye development, 0.5 nm morpholino was injected into 1-4 cell stage surface fish embryos to knockdown the alphaa-crystallin expression. Two different morpholino was co-injected. The first is translational blocking morphoino with the sequence 5 ATGGCAATATC (CAT)AATGACTGGGC 3, the second is splice blocking morpholino skip the Exon2 of alphaa-crystallin by blocking the 5 end (splice acceptor) with the sequence 5 AATGAGGTTCGAAGGCTTACCTGTC3 (Gene tools). After microinjection, there are four kinds of eye phenotype forms after hatching: the first is the normal eye with normal lens, the second is the eye lack of ventral quadrant of the retina, or some embryos lack of the ventral quadrant of the retina combine have the cavity between the lens and retina at the same time, the third phenotype is the eye have small lens, and the forth phenotype is the most serious situation without lens completely. The experiment also found that the alphaa-crystallin morpholino have the gradient effects for the Astyanax cavefish eyes development. TUNEL assay was used to check the apoptosis situation after the surface fish alphaa-crystallin morpholino injection, the results show that the eyes of surface fish injected with alphaa-crystallin morpholino have more apoptosis than the embryos injected nothing or control morpholino, all these results show that knockdown the expression of aa-crystallin will lead to the un-normal eye development. (Li et al., 2014) The eye s development follows the neural induction signal, so we check the organizer gene Follistatin s express pattern. In surface fish, the organizer gene Follistatin is first expressed during the tail-bud stage in the dorsal area where somites form. It is then expressed in several areas at 24hpf including the retina, the olfactory pit, the optic tectum, the rhombencephalon, and the aortic arches. By 30hpf the area of expression is reduced to only the olfactory pit, the 4th ventricle, and the pectoral fin bud. The expression pattern of Follistatin in both surface fish and Pachon cavefish is similar in the early stages of development, but is weaker in the cavefish during the later stages. This result show that, at the early stage of neural induction, the eye s development in cavefish may be still not get effect and normal, the mutation that lead to the eye degeneration should locus the downstream of neural induction. Otx2 is a very important forebrain gene. In early neural induction stage, otx2 patterns the eye field in forebrain together with six3, pax6 and other genes. In situ results show that otx2 expression in surface fish begins in the forebrain and eye areas during the early stages of development. In the later stages it is expressed in the forebrain, retina, and optic tectum. In Pachon cavefish otx2 is also expressed in the same regions during early development, but the expression pattern is much smaller due to the reduced size of the cavefish forebrain. In the later developmental stages, otx2 is not expressed in the cavefish retinal or optic tectum at all, though it is still expressed in the forebrain. From these results, we can get some significant information is, the forebrain development of cavefish may be normal, and the eye degenerative also caused by the un-normal development of optic tectum in cavefish. Rx gene is the very early expressed transcription factor important for eye development at neural plate stage. The expression of Rx gene was also checked in Astyanax mexicanus. The rx2 gene s expression pattern is compared between the surface fish and Pachon cavefish embryos at different stage. The result show that, in surface fish, the rx2 gene is first expressed in retinal progenitors cells within the neural plate area at the tail-bud stage. As the embryos develops the rx2 express in the retina. After the embryos hatching, rx2 is strongly expressed throughout the retina, this result is same to zebrafish and Medaka that rx2 expressed in the photoreceptor layer (cone cells, but not rod cells) and inner nuclear 6 Cave research, 2016, 2:1, 1

7 CAVE RESEARCH 2016,2:1,1 layer (Chuang et al, 1999). Rx gene expression in Pachon cavefish follows this pattern as well, with the exception of very weak expression in the cavefish retina in the later stages of development when the eye is degrading. The weak expression in Pachon cavefish maybe because the not intact retina structure. The final result is that there is no significant different difference between the expression patterns of the rx2 gene in surface fish and cavefish. Therefore it is reasonable to conclude that eye degeneration in cavefish is not caused from the retina, and by some other source downstream the neural plate development. The Six3 transcription factor is known to be important for the early stages of lens development and is likely to function in a positive feedback loop with pax6 that would result in the enhanced expression of both. Six3 is expressed in both surface fish and Pachon cavefish in the anterior neural plate, optic vesicles, lens, olfactory placodes, and ventral forebrain from the tail-bud stage of develop. There is no significant difference in express levels between the surface fish and Pachon cavefish prior to hatching. In the later stages, however, the six3 gene is expressed in both the eye and the ventral forebrain in surface fish, while it is only expressed in the ventral forebrain of cavefish. Six3 expression pattern no big difference in neural plate area at early stage, however, six3 also locus downstream of pax6 in lens induction pathway, so the disappearance expression in cavefish forebrain at late stage maybe because the effect of pax6 gene. And the sox2 express pattern in surface fish is stronger than cavefish. Prox1 is an important gene for lens precursor cells and the developing lens. Prox1 encodes a transcription factor essential for lens fiber cell differentiation (Wigle et al., 1999) and is normally most abundant in the transitional, equatorial region of the lens, is expressed at high levels throughout the lens epithelium (Blixt et at., 2000, Brownell et al., 2000). In surface fish Prox1 is detected as early as 12 hpf in the lens, retina, brain, and mouth. After hatching it is found in the lens, outer nuclear layer of retina, tegmentum, optic tectum, otic capsule, epiphysis, mouth, pectoral fin bud, and anal fin bud. In contrast, prox1 is only expressed weakly in the mouth of Pachon cavefish at 12hpf, and then after hatching also weakly in the otic capsule, the epiphysis. No expression is ever detected in the retina or lens of cavefish. This result show that the cavefish eye structure is disorder and the Prox1 gene that is important for eye development was affected a lot, at this time show that the gene that caused the cavefish eye degeneration locus on the upstream or same level of Prox1 gene. Fgf8 is essential implications for anterior neural plate patterning at early stage and is also responsible for retina morphogenesis defect at later stage, in cavefish embryos express Fgf8 was found turn on 2 hours earlier than surface fish embryos (Karen et al., 2011). In cavefish, at 10hpf, the future forebrain of embryos expresses significantly more transcripts for the shh and Fgf8 signalling molecules than its surface fish counterpart. The Fgf8 heterochrony therefore probably explains why the cavefish forebrain is not ventralised, as one might expect from its Shh pattern. (Karen et al., 2011) And the research also found that the Fgf8 heterochrony in cavefish is due to increased Shh signaling through the inhibiting shh signal in cavefish, suggesting that high Shh signaling in cavefish is responsible for the earlier onset of Fgf8 expression. (Karen et al., 2011) Lhx2 and Lhx9, two LIM-homeodomain factors involved in eye and forebrain development (Atkinson-Leadbeater et al., 2009; Porter et al., 1997; Tetreault et al., 2009; Yun et al., 2009; Zuber et al., 2003), the expression patterns were compared in surface fish and cavefish. Both factors showed significantly different expression patterns in cavefish and surface fish at 10hpf. In surface fish, the expression of the two genes covered the entire presumptive forebrain area, whereas in cavefish Lhx2 expression was absent from its medial posterior part and Lhx9 expression was absent from its medial anterior part. Of note, the differential patterns of Lhx2 and Lhx9 expression appear spatially correlated to those of Shh and Fgf8. (Karen et al., 2011) As Lhx2 is a major factor for eye field specification and morphogenesis (Porter et al., 1997; Tetreault et al., 2009; Yun et al., 2009; Zuber et al., 2003), the fate of the cells located in the medial posterior part of the presumptive forebrain which express Lhx2 in surface fish but not in cavefish was determined. The results demonstrate that in surface, some of the cells located in the medial posterior part of the Lhx2-positive domain at neural plate stage give rise to the ventral quadrant of the retina. And the comparative fate maps also show that surface fish and cavefish posterior medial forebrain neural plate give rise to distinct structures, suggesting a trade-off between ventral retina- and hypothalamic-fated territories in cavefish, and confirming major differences in patterning and cell movements in cavefish and surface fish at these stages. (Karen et al., 2011) From above results we can get information is, the mutation cause cavefish eye degeneration may be not at the neural plate stage or early eye forming stage, that should be at the downstream pathway of eye development and caused by some downstream gene s mutation. Recently published Astyanax genome research and QTL candidate gene analysis reveal a serious of genes that involved in cavefish eye degeneration (McGaugh et al., 2014), such as Otx2 and Pitx3 gene. The current extensive genomic and transcriptomic resources available for research have made Astyanax mexicanus to be a more powerful natural model system. Discuss the degenerative molecular mechanism and evolution: As an important ventralizing signal coming from prechordal mesoderm, cyc may induce hh (sonic, tiggy-winkle) expression in overlying neural midline tissue. Hedgehog, in turn, specifies proximo-ventral eye fates and leads to the repression of genes such as pax6 that direct DD eye development. In cavefish, the expression of shh is increased, this may be show that the concentration of cyc also should be high in cavefish. During the eye s development, otx2, six3, and pax6 gene patterning eye field in

8 CAVE RESEARCH 2016,2:1, 1 forebrain, and rx gene split of eye field into optic primordial. Otx2, six3, and pax6 are initially active in the anterior neural plate; and later in development their expression is prominent in the retinal progenitor cells. The research found that the pax6 and sox2 gene could combinatorial regulation of optic cup progenitor cell fate. Sox2 ablation will result in complete loss of neural competence and eventual cell fate conversion to non-neurogenic ciliary epithelium (2011). Pax6 and sox2 form a functional complex that is required for the activation of crystalline genes at the placodal stage (Cvekl et al., 2004). In addition, Pax6 has been shown to bind enhancer sequences of sox2 and to activate sox2 expression in lens cells and in neuronal progenitors, suggesting a positive effect of pax6 on sox2 expression, however, pax6 negatively regulate sox2 in the equatorial zone of the embryonic lens. Sox2 is not required at later stages of lens development. Pax6 expression is very important for the alpha-crystallin s expression. Pax6 is found to be required for the onset of alpha-crystallin expression in vivo during early stages of lens development. Pax6-deficent lens epithelium fails to exit the cell cycle at the lens equator and undergoes apoptosis. In the mouse, the pax6 is not required for the expression of a- crystallin or for the maintenance of an undifferentiated fate in the LE by inhibiting LFC-specific crystallins, and pax6 is primarify required for the normal differentiation of LFCs and this activity does not depend on its regulation of crystalline expression (2011). In addition pax6, lens fiber cell differentiation is regulated by c-maf, prox1 and sox1, however, pax6 requirement for LFC differentiation is not mediated through prox1, sox1 or c-maf, and c-maf plays important roles in organs not express the aacrystallin. Various experimental methods have demonstrated that pax6 directly binds enhancer sequences and activates expression of the chicken aa and δ1, mouse aa and ab, and guinea pig ξ(reviewed by Cvekl & Piatigorsky 1996), such as the aa-crystallin (Cryaa) promoter has been shown to bind and to be activated by pax6 in vitro. (Cvekl et al.,1995). Pax6 regulates expression of its direct target genes in concert with other lineage-restricted transcription factors including members of large Maf family (MafA, MafB, c-maf and NRL), prox1, six3, sox1 and sox2. Pax6 might play an epigenetic role in opening the promoter chromation structure. Evolution of crystallin is the acquisition of high, tissue-specific expression in the lens. Ancestrally involved in stress responses, would be the ability of stress signals to induce high expression in specific organs (Cvekl & Piatigorsky 1996). Subsequently, this inducible high level of expression would then evolve into developmentally high expression in specific organs by regulatory changes. This could conceivably occur by alterations in cis-regulatory DNA sequences. For example, a stressinducible promoter or enhancer could evolve lens-specific expression by acquiring a tissue-specific enhancer either by nucleotide substitution or by a transposition or genome rearrangement that brought the transcription unit close to an extant enhancer. This gene has both a GC-rich promoter and a TATA promoter. The GC-rich promoter is used for non-lens expression, and the TATA promoter used for lens expression (Gonzalez et al. 1994). The aa-crystallin gene is a single copy gene in Astyanax cavefish with a TATA promoter and express in the lens, so the mutation of alphaa-crystallin in cavefish mainly from the regulatory sequences evolution. There are two kinds of regulatory sequences evolution, alterations in cis-regulatory sequences, or the deployment and activity of the transcription factors. The mutation in the coding region of a transcription factor that functions in multiple tissues may directly affect all of the genes the protein regulates, such as the pax6 gene in cavefish. In contrast, a mutation in a single cis-regulatory element will affect gene expression only in the domain governed by that element, such as the alphaacrystallin gene in cavefish. The pax6 mrna sequence has 88% similar between the zebrafish and Astyanax, and no mutation was found between the Astyanax surface fish and cavefish. In generating developmental novelty, organisms have evolved different ways to use the same genes. Examples of such strategies include gene duplication and functional divergence (Holland et al., 1994). Such as shh is known to have possible effects on taste bud and forebrain development, which are enhanced in cavefish, as well as negative effects on eye development (Menuet et al., 2006, Retaux et al., 2008, Yamamoto et al., 2003 and 2009). Therefore, enhancement of these constructive traits might only be possible at the expense of eye development. Also relevant to the pleiotropy hypothesis, many QTL involved in constructive and regressive features co-map in genetic linkage analysis, particularly some of the eye and taste bud QTL (Protas et al., 2008). The role of pleiotropy in eye regression may be clarified when we understand more about the genes directly involved in eye degeneration and their roles in development. The next frontier in cavefish eye research will be to identify more of the genes and mutations involved in controlling the loss of eyes, and from this information learn more about the forces that drove the evolution of eye degeneration during adaptation of cavefish to perpetual darkness (Jeffery, 2009). The Astyanax cavefish system provides us a very good model for research the possible role of trade-off between constructive and regressive processes in evolutionary developmental biology. Surface-dwelling species have occasionally invaded caves more than once in their evolutionary history and have given rise to multiple cave-adapted lineages. Each of these lineages represents a replicate experiment in evolutionary developmental biology. The existence of independently derived cave forms in Astyanax also provides an opportunity to examine the developmental mechanisms underlying parallelism and convergence. Based on the evidence got so far, the natural selection may be involved in regressive evolution of eye development in Astyanax cavefish and the evolution event may be mainly concluded as, first, surface fish colonized in caves, and their differential survival led to the formation of cave- 8 Cave research, 2016, 2:1, 1