vidence for Maternal Ability in Hybridi ation of Apogamous Fern Species: Dryopteris tsushimense K. Hori N. Murak. and D.

Transcription

1 ISSN Acta Phytotax. Geobot. 69 (3): (2018) doi: /apg vidence for Maternal Ability in Hybridi ation of Apogamous Fern Species: Dryopteris tsushimense K. Hori N. Murak. and D. subtsushimense K. Hori N. Murak. ( ryopteridaceae), New Tetraploid Apogamous Pteridophytes of Hybrid Origin from Tsushima, Japan KiyotaKa Hori 1,,*, Xile ZHou 2, yue-hong yan 2, yasuhiko inoue 3 and noriaki MuraKaMi 1 a ino e ba ium o yo et opolitan ni e sity - inami-osa a achio i o yo - apan P esent add ess he ochi P e ectu al a ino otanical Ga den - Godaisan ochi - apan. ho i ma ino.o. p autho o co espondence Shan hai henshan Plant Science esea ch ente hinese Academy o Sciences henshan otanical Ga den henhua oad Son ian Shan hai hina Sa a ity Sa a apan The yopte is e yth oso a complex (Dryopteridaceae subg. yth o a iae sect. yth o a iae Fraser- Jenk.) contains many apogamous species showing large morphological and genetic variation. This study reports two new tetraploid apogamous species: yopte is tsushimense (. caudipinna +. chinensis) and. subtsushimense (. chinensis +. tsoon ii). Their parents were postulated by use of a plastid DNA ( bc ) and nuclear DNA (G P ) marker. yopte is tsushimense is similar to. chinensis in its fresh green lamina, but differs in having narrowly triangular lamina. yopte is subtsushimense is also similar to. chinensis in its fresh green lamina, but it differs in being evergreen lamina and in having scales with a serrated margin. This is the first report of maternal ability in natural populations of apogamous ferns. Key words: apogamous, Dryopteridaceae, yopte is e yth oso a complex, new species, reticulate evolution, tetraploid Apogamy or agamospory in ferns is a type of asexual reproduction in which unreduced spores are formed and the resultant gametophytes produce sporophytes without fertilization (Manton 1950, Lovis 1978). Gametophytes of some apogamous ferns, however, make few antheridia and archegonia (Momose 1967). In fact, apogamous ferns are reported to produce apogamous hybrids that reproduce with related sexual species in Asplenium (Dyer et al. 2012), heilanthes (Grusz et al. 2009), Pte is (Walker 1958, 1962, Suzuki & Iwatsuki 1990, Jaruwattanaphan et al. 2013) and Woodsiaceae (Takamiya et al. 2001). Other studies found that several apogamous species of yopte is are also of hybrid origin between sexual and apogamous species (Lin et al. 1992, 1995, Ebihara et al. 2012, Lee & Park 2013, Hori et al. 2014). Clarifying the complexity of relationships between sexual and apogamous species is therefore important for understanding morphological and genetic variation in apogamous species complexes. yopte is sect. yth o a iae Fraser-Jenk. (Dryopteridaceae) comprises approximately species, mainly distributed in temperate to subtropical eastern Asia (Fraser-Jenkins 1986, Iwatsuki 1995, Zhang et al. 2013, Ebihara 2017). Fraser-Jenkins (1986) recognized 25 species in

2 144 Acta Phytotax. Geobot. Vol. 69 are brown and have a serrated margin (Zhang et al. 2013). Hori et al. (2016) reported that the triploid apogamous. hondoensis (sect. yth o a iae of subg. yth o a iae, Fraser-Jenkins 1986, Zhang et al. 2013) is of hybrid origin between diploid sexual. caudipinna /. oid umiana or triploid apogamous. e yth oso a (subg. yth o a iae, sect. yth o a iae, Fraser-Jenkins 1986, Zhang et al. 2013), and diploid sexual. chinensis (subg. yopte is, sect. Aemulae, Fraser-Jenkins 1986, Zhang et al. 2013). Additional species of hybrid origin between. chinensis and. e yth oso a complex can occur. In this study, we report two new tetraploid apogamous species of hybrid origin,. tsushimense K. Hori & N. Murak. and. subtsushimense K. Hori & N. Murak., between triploid apogamous. chinensis (maternal or biparental, sect. Aemulae of subg. yopte is) and diploid sexual species of sect. yth o a iae of subg. yth o a iae from Tsushima, Japan. Their morphological characteristics, reproductive mode, chromotable 1. Ploidy level, reproductive mode and constitution of plastid ( bc ) and nuclear DNA markers (G P ) of. tsushimense,. subtsushimense, and other members of the. e yth oso a complex. Ploidy Reproductive mode Chromosome number DNA content (p.g. SE, ) bc G P. tsushimense 4x apo 2n ( 3) B, D C+E. subtsushimense 4x apo 2n ( 4) D A+E 2x sex ( 13) B C. oid umiana (a) 2x sex ( 2) B C. chinensis(2x) (a) 2x sex 2n ( 7) D E. chinensis(3x) 3x apo 2n ( 4) D E 2x sex 2n ( 5) A A. decipiens var. decipiens 3x apo ( 6) C B. decipiens var. dipla ioides 3x apo ( 4) C B. uscipes 3x apo ( 5) C B. championii 3x apo 2n ( 2) A, C A+B. medioxima 3x apo ( 3) A A+B. e yth oso a (a) 3x apo 2n ( 7) B, C B+C. hondoensis (a) 3x apo ( 4) B B+C+E. in iensis (a) 4x sex ( 3) A A+D (a) Ploidy level, reproductive mode, chromosome number, DNA content and bc sequences are quoted from Hori et al. (2016). (b) Ploidy level, reproductive mode, chromosome number, DNA content are quoted from Hori et al. (2018a). eastern Asia, and Ebihara (2017) recognized 22 species from Japan in sect. yth o a iae. Chromosome numbers and reproductive modes of several species of sect. yth o a iae have been reported from China, Japan and Taiwan, (see Table 1 in Hori et al. 2018a). Diploid sexual, diploid apogamous, triploid apogamous, and tetraploid sexual cytotypes are known from the section. With few exceptions, most species of section yth o a iae have been reported as apogamous triploids in Japan. The exceptions include o yopte is caudipinna (sexual diploid Hirabayashi 1970),. oid umiana (sexual diploid Mitui 1967, 1968, Hirabayashi 1969),. in iensis (sexual tetraploid Hirabayashi 1967),. pu pu ella (tetraploid apogamous Kurita 1966), and. o mosana (tetraploid, but reproductive mode is unknown Nakato 1987). In addition, Hori et al. (2018a) reported diploid sexual cytotypes of. tsoon ii (sect. yth o a iae), a Chinese endemic characterized by having sori near the margin and densely scaly petioles. The scales near the base of the petioles

3 October 2018 Hori & al. New Tetraploid Apogamous Pteridophytes from Tsushima 145 table 2. PCR Primers used in this study. bc Forward af3 ATGTCACCACAAACGGAGACTAAAGC Hori et al. (2018b) Reverse cr3 GCGGCAGCCAATTCCGGACTCCA Hori et al. (2018b) For sequence ard CGATCTCTCCAACGCATGAATGGCTG Hori et al. (2018b) For sequence D. paci-bf TATCCTTTGGATCTATTCGAAGAAGGTTC Hori et al. (2014) G P Forward G6F TTTGGTGGCTATGGAGAAGC Hori et al. (2018b) Forward G6Fb TGTCCCAGSACTACTTCATC This study Reverse G6R CGAATGTTGGGGTATTGGAG Hori et al. (2018b) Reverse G6Rb CATTAARTCCAGAGSATATT This study some number, and genome constitution are described. This is the first report of maternal ability in apogamous fern species in natural populations. Materials and Methods Plant ate ials Sampling for the molecular analyses was targeted toward members of the yopte is e yth oso a complex (Table 1, Appendix 1). In addition,. so didipes,. sabaei,. c assi hi oma,. handeliana,. hasseltii,. polita,. monticola,. expansa,. ymnophylla, Polystichum lepidocaulon, P. et osopaleaceum, and A achniodes a istata were used as outgroups. Living stocks were collected for observation of chromosome numbers and ploidy analysis (Appendix 1). All voucher specimens are deposited in CSH, MAK, TAIF and/or TNS. o pholo ical obse ation The morphology of yopte is caudipinna,. chinensis,. oid umiana,. tsoon ii,. tsushimense and. subtsushimense was compared, particularly focusing on differences in the color and sheen of the lamina and shape of the scales. We also examined the morphology of members of yopte is sections Aemulae, yth o a iae, and Indusiatae in Japan, Korea and China, mainly on the basis of their original descriptions and keys for identification. ytolo ical obse ation and estimates o ep oducti e mode We determined mitotic chromosome numbers of yopte is championii,. chinensis,. e yth- oso a. tsushimense, and. subtsushimense from the living stocks. The materials used for the cytological observations are listed in Appendix 1. To observe mitotic chromosomes, root tips from living plants were pretreated with M 8-hydroxyquinoline for 6 h at approximately 15 C. After fixation overnight in ethanol and acetic acid (3:1), the root tips were hydrolyzed in a mixed solution of 1N HCl and 45 acetic acid (1:1) at 60 C for 10 min before being mashed in a 2 aceto orcein solution. The chromosomes were observed using a Leica DM2500 microscope, then photographed using a Leica MC170 HD digital camera. To estimate the reproductive mode of each sample or herbarium specimen, the numbers of spores per sporangium ( s/s) were counted. We examined at least five sporangia with normal spores for each specimen. If the number was 64, we estimated the sample to be sexually reproducing if the number was 32, we estimated it to be apogamous (Manton 1950). Ploidy analyses The methods of ploidy analyses followed those of Hori et al. (2014). To determine the ploidy level, the DNA content (2C value) of each nucleus extracted from fresh pinnae was measured once for each sample by flow cytometry using a Cyflow Ploidy Analyzer PA-II (Partec, Munster, Germany) and a Cystain UV Precise P kit (Partec). Approximately 100 mm 2 of each pinna

4 146 Acta Phytotax. Geobot. Vol. 69 was torn into several pieces and finely chopped with a razor blade in 0.25 ml of nucleus extraction buffer from the kit. Then, 0.8 ml of staining solution from the kit was added to the chopped tissues. The crushed tissue and buffers were filtered through a 30- m nylon mesh (Partec) before measuring on the analyzer. Approximately 25 mm 2 of fresh leaf tissue of Nicotiana tabacum L. (2C value pg., Narayan 1987) was used as an internal standard. olecula analyses o plastid and nuclea ma e s For molecular analyses, a small amount of leaf tissue was dried in plastic bags cm using silica gel. Subsequently, total DNA was extracted from the dried leaves using a cetyltrimethylammonium bromide solution according to the method of Doyle & Doyle (1990). The plastid gene bc (af3 cr3, Hori et al. 2018b.) was used in this study as the cpdna marker. For nuclear DNA (nrdna) markers, G P (G6F G6R, Hori et al. 2018b) was chosen. Primers information is shown in Table 2. PCR amplification was performed using Prime- STAR Max DNA Polymerase (Takara, Kyoto, Japan) in a Model 9700 thermal cycler (Applied Biosystems, Foster City, CA, USA). PCR-single-strand conformation polymorphism (SSCP) analysis was performed to examine allelic variation at the nuclear marker level for each individual, following the method of Hori et al. (2014, 2016). Electrophoresis was performed using MDE gel solution (Lonza) with 5 glycerol at 15 C for 16 h at 350 V for G P. Most plant samples were classified based on their PCR-SSCP banding patterns. The genomic constitution for each band pattern was identified by determining the nucleotide sequences of DNA bands separated on the SSCP gel. For materials collected in China, we performed experiments in the laboratory of CSH. Phylo enetic analyses The cpdna and nrdna sequences were aligned using MUSCLE Citation (Edgar 2004) and analyzed separately by neighbor-joining (NJ), maximum parsimony (MP), or maximum likelihood (ML) analyses using MEGA version 6 (Tamura et al. 2013). In ML analysis, the bestfitting model of sequence evolution for each DNA region was selected using MEGA version 6 (Tamura et al. 2013). The G P tree was constructed using the Tamura 3-parameter model and the bc tree was constructed using the Kimura 2-parameter + G + I model. The initial trees for the heuristic search were obtained automatically by applying the Maximum Parsimony method. The indels were treated as missing characters in MP and ML analyses. The bootstrap method with 1000 replications was employed to estimate the confidence levels of monophyletic groups. In this study, alleles from apogamous species whose sequence formed a clade with particular sexual species with high bootstrap value were considered to have originated in the sexual species. Therefore, when three alleles from one triploid apogamous species formed clades with those from sexual species, Y, and Z, respectively, the genotype (genome constitution) of the apogamous species was estimated to be, Y, Z. Results o pholo ical obse ation yopte is tsushimense was morphologically similar to. chinensis in having a fresh green laminae. It was also similar to. caudipinna in having narrowly triangular evergreen laminae and dark brown lanceolate scales (Fig. 1d, Table 3). yopte is subtsushimense is similar to. chinensis in having fresh green laminae, and also similar to. tsoon ii in having soft, coriaceous evergreen laminae and scales with a serrated margin (Fig. 1b, Table 3). Ploidy and ep oducti e mode The ploidy levels and reproductive modes of yopte is tsushimense, and. subtsushimense and related species of the. e yth oso a complex are shown in Table 1. The chromosome numbers of. tsushimense and. subtsushimense were

5 October 2018 Hori & al. New Tetraploid Apogamous Pteridophytes from Tsushima 147 both 2n 164. The number of regular spore of both determined to be 32 s/s (Fig. 2e f). The basic chromosome number of yopte is is x 41. accordingly, these samples were determined to be apogamous tetraploids. The chromosome number of one sample each of yopte is championii,. chinensis, and. e yth oso a was 2n 123. The number of spores of them were 32 s/s. These samples were determined to be apogamous triploids. The DNA content of the materials in this study are as follows (Table 1):. tsushimense, p.g. ( 5). subtsushimense, p.g. ( 4) apogamous triploid. chinensis, ( 4) sexual diploid. tsoon ii, p.g., ( 5, quoted from Hori et al. 2018a) and sexual diploid. caudipinna was p.g., ( 13, nine samples are quoted from Hori et al. 2018a). The DNA contents of. tsushimense nearly corresponds to the total of the apogamous triploid. chinensis and the sexual diploid. caudipinna. subtsushimense nearly corresponds to the total of the apogamous triploid. chinensis and the sexual diploid. tsoon ii. olecula phylo enetic t ee acco din to plastid rbcl and nuclea G6PD se uences We determined 1,205 bp of bc sequences, of which 96 were parsimony-informative (Appendix 1). In total, four types (A D) were recognized in yopte is tsushimense,. subtsushimense,. chinensis and other members of the. e yth- oso a complex (Fig. 3, Table 1, Appendix 1). yopte is tsushimense and. subtsushimense shared type D with. chinensis. Some samples of. tsushimense also shared type B with. caudipinna and. oid umiana. We determined bp of G P sequences. The total aligned lengths were 349 bp, of which 79 were parsimony-informative. In total, 5 types (A E) were recognized (Fig. 4, Table 1, Appendix 1). yopte is tsushimense and. subtsushimense had two types of G P sequences: C (. caudipinna and. oid umiana) + E (. chinensis) and A (. tsoon ii) + E. iscussion i in o Dryopteris tsushimense and D. subtsushimense Chromosome numbers, ploidy levels and molecular analysis of the plastid bc and nuclear G P suggested that yopte is tsushimense and. subtsushimense are of hybrid origin. According to the plastid bc data,. tsushimense had the same type of plastid sequences as. chinensis,. caudipinna and. oid umiana (diploid sexual). In G P, the genotype of was C1E1E6E7 (Appendix 1). This sample had one allele belonging to. caudipinna or. oid- umiana (type C), and three alleles belonging to. chinensis (type E). The DNA contents of. tsushimense nearly corresponds to the total of the apogamous triploid. chinensis and the sexual diploids. caudipinna or. oid umiana. Additionally, the morphological characteristics. tsushimense are more similar to. caudipinna than to. oid umiana (Table3). Therefore,. tsushimense appears to be of hybrid origin between triploid apogamous. chinensis (bipaternal), and. caudipinna (bipaternal). For yopte is subtsushimense, the nuclear G P data suggested that it is of hybrid origin between. chinensis and. tsoon ii. As for the plastid DNA,. subtsushimense shared the same type of sequences with. chinensis. Furthermore, the DNA contents of. subtsushimense nearly corresponds to the total of the apogamous triploid. chinensis and the sexual diploid D. tsoongii. Therefore,. subtsushimense is apparently of hybrid origin between the triploid apogamous. chinensis (maternal) and. tsoon ii (paternal). yopte is subtsushimense and. tsushimense originated at least twice, because we found two clones of each of them (Appendix 1). ate nal ability in hyb idi ation o Apo amous e n species yopte is subtsushimense and. tsushimense had plastid bc sequence of apogamous. chinensis. In general, plastid DNA is maternal inheritance (Kuo et al. 2018). Therefore, apoga-

6 148 Acta Phytotax. Geobot. Vol. 69 Fig. 1. Scales (at base of petioles) of yopte is tsushimense,. subtsushimense and their parents. a,. chinensis b,. subtsushimense c,. tsoon ii d,. tsushimense e,. caudipinna. table 3. Morphological differences between. tsushimense,. subtsushimense and its relatives. color of lamina evergreen/ summergreen shape of lamina shape of scales margin of scales. tsushimense. subtsushimense. chinensis. tsoon ii. caudipinna. oid umiana fresh green fresh green fresh green dark green dark green dark green summergreen evergreen summergreen evergreen evergreen evergreen narrowly triangular broadly triangular pentagonal broadly triangular lanceolate ovate lanceolateovate lanceolateovate narrowly triangular lanceolate oblong, narrow at apex lanceolate entire serrated entire serrated entire entire mous yopte is chinensis seemed to have maternal ability in hybridization. This means apogamous. chinensis can produce fertile eggs from its archegonia. Walker (1962) reported that gametophytes of apogamous species of Pte is have only antheridia. Japanese apogamous species of Pte is also have only antheridia (Momose 1967). Gametophytes of several apogamous species of yopte is (including. chinensis) not only have antheridia but also archegonia (Momose 1967). Our study found that archegonia produced from apogamous gametophytes can function in fertilization in natural populations.

7 October 2018 Hori & al. New Tetraploid Apogamous Pteridophytes from Tsushima 149 Fig. 2. Chromosome number and reproductive mode of yopte is subtsushimense and. tsushimense. a Photograph of mitotic metaphase chromosomes of. subtsushimense, b Illustration of a, c Photograph of mitotic metaphase chromosomes of. tsushimense, d Illustration of c, e Spores in a sporangium of. subtsushimense, f Spores in a sporangium of. tsushimense. axonomy 1. ryopteris tsushimense K. Hori & N. Murak., sp. nov. Fig. 5. yopte is tsushimense is similar to. chinensis in having fresh green lamina surface, but it differs from that species in having narrowly triangular lamina and dark brown lanceolate scales. ypus. Japan, Nagasaki, Tsushima city, Kamiagata town, 60 m altitude, on roadside of granite in an evergreen forest,., collected on Aug 19, 2014 (holo- MAK436578).

8 150 Acta Phytotax. Geobot. Vol. 69 Fig. 3. The ML tree (highest log likelihood ) based on sequence variation of plastid gene bc with BPs ( 50) of NJ/ML/MP analyses. Black circle diploid sexual, Triangle triploid apogamous, White square tetraploid sexual, Black square tetraploid apogamous.

9 October 2018 Hori & al. New Tetraploid Apogamous Pteridophytes from Tsushima 151 Fig. 4. ML tree (highest log likelihood ) based on sequence variation of nuclear gene G P with the BPs ( 50) of NJ/ML/MP analyses. Black circle diploid sexual, Triangle triploid apogamous, White square tetraploid sexual, Black square tetraploid apogamous.

10 152 Acta Phytotax. Geobot. Vol. 69 Fig. 5. yopte is tsushimense K. Hori & N. Murak. 1 3: Scales on petioles, rachis and costa. 4: Abaxial surface of frond. 5: Indusium. (drawn from specimen., MAK).

11 October 2018 Hori & al. New Tetraploid Apogamous Pteridophytes from Tsushima 153 Fig. 6. yopte is subtsushimense K. Hori & N. Murak. 1 3: Scales on petioles, rachis and costa. 4: Abaxial surface of frond. 5: Indusium. (drawn from specimen., MAK).

12 154 Acta Phytotax. Geobot. Vol. 69 Plants is of hybrid origin between yopte is caudipinna and. chinensis. Plants terrestrial, summer green, rhizome erect, leaves cespitose petiole 7 15 cm long scales dense on rhizome and basal petiole, sparse on upper petiole and rachis, dark brown, lanceolate, filiform at apex lamina bipinnate to tripinnatifid, narrowly triangular, gradually narrowing to apex, cm cm, fresh green, herbaceous in texture, surface dull, flat at margin pinnules acute, serrated at apical margin, 8-10 pairs, 5 10 cm 2 6 cm lowest basiscopic pinnules on lowest pinna barely longer than second one sori round, born near to the margin indusia translucent, reniform or circular, entire, 1.0 mm in diameter. abitat and dist ibution. Warm temperate evergreen forests in temperate zone. Endemic to Japan (Tsushima Island). apanese name. Tsushima-Misakikaguma. Additional specimens examined. JAPAN. KYUSHU. Nagasaki Pref.: Tsushima Island, Tsushima city, Mitsushima town,.,.,.. soft coriaceous in texture, surface dull, flat at margin pinnules obtuse or acute, serrated at apical margin, 8 10 pairs, 5 10 cm 2 6 cm lowest basiscopic pinnules on lowest pinna barely longer than second one sori round, born near to the margin indusia translucent, reniform or circular, entire, 1.0 mm in diameter. otes. We found several specimens of. subtsushimense collected from Jiangsu Prov., China in TI. These specimens are reported as tetraploid apogamous. chinensis in Nakato et al. (1995). We also need to analyze DNA of Chinese materials in future study. abitat and dist ibution. Warm temperate evergreen forests in temperate zone. Japan (Tsushima Island) and eastern China (Jiangsu Prov.). apanese name. Arage-Misakikaguma. Additional specimens examined. JAPAN. KYUSHU. Nagasaki Pref.: Tsushima Island, Tsushima city, Shiroyama,.,.,.. CHINA. Jiangsu Prov.: Juron ian, Mt. Baohua,, (TI) Nanjing Botanical Garden,. ato,. Ito &. Saito (TI) Yixing ian, Mt. Longchi, (TI). 2. ryopteris subtsushimense K. Hori & N. Murak., sp. nov. Fig. 6. yopte is subtsushimense is similar to. chinensis in having fresh green lamina surface, but it differs from that species in having soft coriaceous evergreen lamina and serrated margin on scales. ypus. Japan, Nagasaki, Tsushima city, Shiroyama, 30 m altitude, on roadside of granite in an evergreen forest,., collected on Aug 19, 2014 (holo- MAK454609). Plants is of hybrid origin between. chinensis and. tsoon ii. Plants terrestrial, evergreen, rhizome erect, leaves cespitose petiole 5 15 cm long scales dense on rhizome and basal petiole, sparse on upper petiole and rachis, brown, sometimes dark brown in center, ovate, serrated on margin, filiform at apex lamina bipinnate to tripinnatifid, broadly triangular, gradually narrowing to apex, cm cm, fresh green, We are grateful to the following persons for their assistance in collecting the plant material used in this study: Dr. Li-Yaung Kuo of the Taiwan Forestry Research Institute Dr. J. Yamashita of Okayama University Mr. S. Saito and Dr. S. Tagane of Kyushu University Dr. S. Kariyama of the Kurashiki Museum of Natural History and Mr. Y. Kazumi, Mrs. K. Mizote, Mr. K. Ohora, Mr. T. Oka, and Mr. H. Takae of the Nippon Fernist Club. We are also grateful to Mrs. S. Nakamura-Kato, Dr. T. Sugawara, Dr. H. Kato, and Dr. Y. Kakugawa of the Makino Herbarium, Tokyo Metropolitan University Dr..-C. Zhang of the Institute of Botany, Beijing (PE) and Dr. K. Yamamoto of the Yokosuka City Museum for their valuable suggestions and advice during the course of this study. This study was partly supported by a Grant-in-Aid for JSPS Fellows No to K. H. and by a Grant-in- Aid for Scientific Research No to N. M and 15K07204 to A. E. This study was conducted under the Memorandum of Understanding (MoU) between the Shanghai Chenshan Botanical Garden and the Kochi Prefectural Makino Botanical Garden, Japan.

13 October 2018 Hori & al. New Tetraploid Apogamous Pteridophytes from Tsushima 155 References Doyle, J. A. & J. L. Doyle Isolation of plant DNA from fresh tissue. Focus 12: Dyer, R. J., V. Savolainen, & H. Schneider Apomixis and reticulate evolution in the Asplenium monanthes fern complex. Ann. Bot. 110: Ebihara, A., S. Matsumoto & M. Kato Origin of yopte is shibipedis (Dryopteridaceae), a fern species extinct in the wild. J. Plant Res. 125: Ebihara, A The Standard of Ferns and Lycophytes in Japan (2). Gakkenn-Plus, Tokyo. (in Japanese). Edgar, R. C MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucl. Acid Res. 32: Fraser-Jenkins, C. R A classification of the genus yopte is (Pteridophyta: Dryopteridaceae). Bull. Brit. Mus. Nat. Hist (Bot). 14: Grusz, A. L., M. D. Windham & K. M. Pryer Deciphering the origins of apomictic polyploids in the helianthes ya apensis complex (Pteridaceae). Am. J. Bot. 96: Hirabayashi, H Chromosome numbers in Japanese species of yopte is (2). J. Jap. Bot. 42: Hirabayashi, H Chromosome numbers in Japanese species of yopte is (3). J. Jap. Bot. 44: Hirabayashi, H Chromosome numbers in Japanese species of yopte is (4). J. Jap. Bot. 45: Hori, K., A. Tono, K. Fujimoto, J. Kato, A. Ebihara, Y. Watano & N. Murakami Reticulate evolution in the apogamous yopte is a ia complex (Dryopteridaceae, subg. yth o a iae, sect. a iae) and its related sexual species in Japan. J. Plant Res. 127: Hori, K., Y. Watano & N. Murakami Hybrid origin of the apogamous fern species yopte is hondoensis (Dryopteridaceae). Acta Phytotax. Geobot. 67: Hori, K.,.-L. Zhou, W. Shao, Y.-H. Yan, R.-. Wang & N. Murakami. 2018a. New diploid sexual cytotypes of yopte is sect. yth o a iae (Dryopteridaceae) in China. Acta Phytotax. Geobot. Acta Phytotax. Geobot. 69: Hori, K., Y. Okuyama, Y. Watano & N. Murakami. 2018b. Recurrent hybridization without homoeologous chromosome paring in the. a ia complex. Chromo. Bot. 13: Iwatsuki, K Dryopteridaceae. In: Iwatsuki, K., T. Yamazaki, D. E. Boufford & H. Ohba. (eds.), Flora of Japan, vol. I, pp Kodansha, Tokyo. Jaruwattanaphan, T., S. Matsumoto & Y. Watano Reconstructing hybrid speciation events in the Pte is c etica group (Pteridaceae) in Japan and adjacent regions. Syst. Bot. 38: Kuo, L.-Y., T.-Y. Tang, F.-W. Li, H.-J. Su, W.-L. Chiou, Y.-M. Huang & C.-N. Wang Organelle genome inheritance in epa ia ferns (Athyriaceae, Aspleniineae, Polypodiales). Front Plant Sci. 9: 486. Kurita, S Chromosome numbers of some Japanese ferns (6). J. Jap. Bot. 41: Lee, S.-J. & C.-W. Park Relationships and origins of the yopte is a ia (L.) Kuntze species complex (Dryopteridaceae) in Korea inferred from nuclear and chloroplast DNA sequences. Biochem. Syst. Ecol. 50: Lin, S.-J., M. Kato & K. Iwatsuki Diploid and triploid offspring of triploid agamosporous fern yopte is paci ca. J. Plant Res. 105: Lin, S.-J., M. Kato & K. Iwatsuki Electrophoretic variation of the apogamous yopte is a ia group (Dryopteridaceae). J. Plant Res. 108: Lovis, J. D Evolutionary patterns and processes in ferns. Adv. Bot. Res. 4: Manton, I Problems of Cytology and Evolution in the Pteridophyta. Cambridge University Press, Cambridge. Momose, S Prothallia of the Japanese Ferns (Filicales). University of Tokyo Press, Tokyo. (in Japanese). Mitui, K Chromosome studies on Japanese ferns (3). J. Jap. Bot. 42: Mitui, K Chromosomes and speciation in ferns. Sci. Rep. Tokyo Kyoiku Daigaku Sec. B 13: Nakato, N Notes on chromosomes of Japanese pteridophytes (1). J. Jap. Bot. 62: Nakato, N., M. Kato & B. D. Liu A cytotaxonomic study of some ferns from Jiangsu and Zhejiang Provinces, China. J. Jap. Bot. 70: Narayan, R. K Nuclear DNA changes, genome differentiation and evolution in icotiana (Solanaceae). Plant Syst. Evol. 157: Suzuki, T. & K. Iwatsuki Genetic variation in agamosporous fern Pte is c etica L. in Japan. Heredity 65: Takamiya, M., N. Ohta, Y. Yatabe & N. Murakami Cytological, morphological, genetic, and molecular phylogenetic studies on intraspecific differentiations within ipla ium doede leinii (Woodsiaceae: Pteridophyta). Int. J. Plant Sci. 162: Tamura, K., G. Stecher, D. Peterson, A. Fillipski & S. Kumar MEGA6: Molecular evolutionary genetics analysis version 6. Molec. Biol. Evol. 30: Walker, T. G Hybridization in some species of Pte is L. Evolution 12: Walker, T. G Cytology and evolution in the fern genus Pte is L. Evolution 16: Zhang, L.-B., S.-G. Wu, J.-Y. iang, F.-W. ing, H. He, F.-G. Wang, S.-G. Lu, S.-Y. Dong, D. S. Barrington, K. Iwatsuki, M. J. M. Christenhusz, J. T. Mickel, M. Kato & M. G. Gilbert Dryopteridaceae. In: Wu, Z.-Y., P. H. Raven & D. -Y. Hong (eds.), Flora of China vol. 2 3: (Pteridophytes), pp Science Press, Beijing & Missouri Botanical Garden, St. Louis. ecei ed ecembe accepted ay

14 156 Acta Phytotax. Geobot. Vol. 69 appendix 1. Voucher specimens examined in this study. Species name Voucher Locality.subtsushimense. subtsushimense. subtsushimense. subtsushimense. tsushimense. tsushimense. tsushimense. tsushimense. caudipinna. caudipinna. caudipinna. caudipinna. oid umiana (a). oid umiana (a). oid umiana (a) atsumoto m h atsumoto m h atsumoto m h amamoto I (TNS) tsu a tsu a tsu a tsu a tsu a tsu a tsu a tsu a tsu a atsumoto atsumoto atsumoto Tsushima city, Shiroyama Tsushima city, Shiroyama Tsushima city, Shiroyama Tsushima city, Shiroyama Tsushima city, Kamiagata town Tsushima city, Mitsushima town Tsushima city, Mitsushima town Tsushima city, Mitsushima town Reproductive mode Chromosome number DNA amount (p.g.) ploidy bc G P apo 2n x D A2/E1/E7 apo x D A2/E1/E7 apo x D A6/E1/E4 apo x D A2/E1/E7 apo 2n x D C1E1E6E7 apo B3 C1/E4/E8 apo x B3 C1/E4/E8 apo x B3 C1/E4/E8 Japan, Hyogo pref., Himeji city sex B1 C1C1 Japan, Hyogo pref., Himeji city sex B1 C1C1 Japan, Hyogo pref., Himeji city sex B2 C1C1 Japan, Kanagawa pref., Zushi city sex B3 C1C1 Japan, Kanagawa pref., Zushi city sex x B3 C1C1 Japan, Kanagawa pref., Zushi city sex x B5 C1C1 Japan, Kanagawa pref., Zushi city sex x B3 C1C1 Japan, Kanagawa pref., Zushi city sex x B3 C1C1 Japan, Kanagawa pref., Zushi city sex x B5 C1C1 Japan, Kanagawa pref., Zushi city sex x B3 C1C1 Japan, Kanagawa pref., Zushi city sex x B5 C1C1 Japan, Kanagawa pref., Zushi city sex x B3 C1C1 Japan, Kanagawa pref., Zushi city sex x B3 C1C1 Tsushima city, Mitsushima town Tsushima city, Mitsushima town Tsushima city, Mitsushima town Tsushima city, Mitsushima town sex x B3 C1C1 sex x B3 C1C1 sex x B3 C1C1 sex x B3 C1C1 sex x B3 C1C1 sex sex B2 C1C1 B3 C1C1

15 October 2018 Hori & al. New Tetraploid Apogamous Pteridophytes from Tsushima 157 appendix 1. Continued. Species name Voucher Locality. oid umiana (a). oid umiana (a). oid umiana (a) atsumoto atsumoto tsu a Reproductive mode sex sex Chromosome number DNA amount (p.g.) ploidy bc G P B4 C1C1 B3 C1C1 sex x B4 C1C1. chinensis (a) o i Japan, Tokyo-to, Inagi city D E1/E3. chinensis (a). chinensis (a). chinensis (a). chinensis (a). chinensis (a). chinensis (a). chinensis (a). chinensis (a). chinensis (a). chinensis. chinensis. chinensis. chinensis. championii o i Japan, Tokyo-to, Hachioji city D E1/E3 Japan, Wakayama pref. Kozagawa town Nobeoka city Nishiusuki county Nobeoka city Nobeoka city Nobeoka city Nobeoka city Hyuuga city Tsushima city, Shiroyama Tsushima city, Shiroyama Tsushima city, Shiroyama Tsushima city, Shiroyama Shi niu zhai Shi niu zhai Shi niu zhai Shi niu zhai Ye jia dong Ye jia dong Lu tou lin chang Lu tou lin chang Lu tou lin chang Ye jia dong D E1 sex x D E1E1 sex x D E1E1 sex x D E1E1 sex x D E1E5 sex x D E1E2 sex 2n x D E1E1 sex x D E1E1 apo 2n x D E1/E5 apo x D E1/E5 apo x D E1E6E7 apo x D E1E6E7 sex A A2A2 sex A A2A2 sex A A2A2 sex A A2A2 sex x A A2A4 sex 2n x A A2A2 sex x A A2A2 sex x A A2A4 sex A A2A2 sex x A A2A4 Japan, Gifu pref. Inuyama city A A3/B3

16 158 Acta Phytotax. Geobot. Vol. 69 appendix 1. Continued. Species name Voucher Locality. championii. championii. championii. championii. championii decipiens decipiens decipiens decipiens decipiens decipiens dipla ioides dipla ioides dipla ioides dipla ioides. e yth oso a (a). e yth oso a (a). e yth oso a (a). e yth oso a. e yth oso a. e yth oso a (a). e yth oso a (a). e yth oso a. uscipes. uscipes. uscipes uo (TAIF) uo (TAIF) Reproductive mode Chromosome number DNA amount (p.g.) ploidy bc G P Japan, Gifu pref. Inuyama city A A3/B3 Japan, Tokyo-to, Hachioji city, Kawamachi China, Hunan, Changsha city Mt. YueLu Japan, Saga pref, Kashima city, Furueda Japan, Okayama pref. Mt. Tatsunokuchi Nobeoka city, Akamizu town Japan, Mie pref., Owase city, Minamiura Shi niu zhai Shingu city Shingu city Shingu city Shingu city Nobeoka city, Akamizu town Shingu city Shingu city Nachikatsuuracho Japan, Tokyo-to, Hachioji city, Minamiosawa China, Hunan, Changsha city Mt. YueLu Nobeoka city, Urashiro town Japan, Saga pref., Karatsu city, Mt. Kishi Japan, Mie pref., Owase city, Obarano A A1A3B3 apo 2n x A A2/B1 apo x A A1A3B3 C3 A2/B x C1 B1B1B1 apo x C1 B1B1B1 apo x C1 B1B1B1 apo x C1 B1B1B1 apo x C1 B1B1B1 apo x C4 B1B1B x C2 B3B3B3 apo x C2 B3B3B3 apo x C2 B3B3B3 apo x C2 B3B3B x B3 B3/C x B3 B4/C x B3 B3/C1 apo x C2 B3C1C3 apo x B3 B3/C x B3 B1B2C1 apo 2n x B3 B3C1C2 B3 B1/C x C3 B3B3B3 C3 B2/B x C2 B3B3B3

17 October 2018 Hori & al. New Tetraploid Apogamous Pteridophytes from Tsushima 159 appendix 1. Continued. Species name Voucher Locality. uscipes. uscipes. uscipes. hondoensis (a). hondoensis (a). hondoensis (a). hondoensis (a). hondoensis (a). hondoensis (a). in iensis (a). in iensis (a). in iensis (a). in iensis (a). in iensis (a). in iensis (a). medioxima. medioxima. medioxima. c assi hi oma (c). expansa (c). ymnophylla (c). handeliana (c). hasseltii (c). lace a (c). monticola (c). polita (c) o i o i uo (TAIF) o i Japan, Mie pref., Owase city, Obarano Japan, Mie pref., Owase city, Obarano Japan, Mie pref., Owase city, Obarano Japan, Tokyo-to, Inagi city Japan, Tokyo-to, Inagi city Kitakata town Reproductive mode Chromosome number DNA amount (p.g.) ploidy bc G P x C2 B3B3B3 apo x C3 B3B3B3 apo x C3 B3B3B3 B3 B4C1E5 B3 B3C1E x B3 B4C1E5 Japan, Tokyo-to, Inagi city x B3 B3C1E1 Japan, Tokyo-to, Inagi city apo x B3 B4C1E5 Shingu city Japan, Shizuoka pref., Haibara county, Kawanehoncho x B3 B4C1E5 A A2A2D1D1 Japan. Nara pref., Kashihara city sex A A2A2D1D1 Japan. Saga pref., Saga city, Nakaore town Japan. Saga pref., Saga city, Nakaore town Japan, Niigata pref., Minamiuonuma Japan, Yamanashi pref., Minamiarupusu Japan, Tokyo-to, Hachioji-shi Japan, Kumamoto pref., Aso Taiwan, Ilan county, Taipei city Japan, Tokyo-to, Okutama Cultivated in the Koishikawa Botanical Garden of The University Tokyo Taiwan, Taipei City, Mt. Chihtan sex x A A2A2D2D2 sex A A2A2D2D2 sex x A A2A2D1D1 sex x A A2A2D1D x A A2/B x A A2/B3 apo x A A2/B3

18 160 Acta Phytotax. Geobot. Vol. 69 appendix 1. Continued. Species name Voucher Locality. p otobissetiana (c). sabaei (c). saxi a a (c). so didipes (c). so didipes (c). so didipes (c). so didipes (c). so didipes (c). so didipes (c). to yoensis (c). a ia (c) o i o i o i o i o i o i o i S (TNS) (c) A. a istata (c) P. lepidocaulon (c) P. et osopaleaceum Japan, Tokyo-to, Okutama Japan, Tokyo-to, Okutama Taiwan, Taipei City, Urai Taiwan, Taipei City, Urai Japan, Aichi pref., Kitashitara Taiwan, Taipei City Japan, Kanagawa pref., Zushi city Japan, Kanagawa pref., Zushi city Japan, Niigata pref., Minamiuonuma Reproductive mode Chromosome number DNA amount (p.g.) (a) Ploidy level, reproductive mode, chromosome number, DNA content, bc sequences are quoted from Hori et al. (2016). (b) Ploidy level, reproductive mode, chromosome number, DNA content are quoted from Hori et al. (2018a). (c) DNA sequences are quoted from Hori et al. (2018b). ploidy bc G P appendix 2. DNA data accession numbers of the obtained nucleotide sequences in this study. Data are in the order: Allele or species name Access. No. G P A1, LC A2, LC A3, LC A4, LC A5, LC A6, LC B1, LC B2, LC B3, LC B4, LC C1, LC C2, LC C3, LC D1, LC D2, LC E1, LC E2, LC E3, LC E4, LC E5, LC E6, LC E7, LC E8, LC A achniodes a istate, LC LC yopte is c assi hi oma, LC LC expansa, LC ymnophylla, LC handeliana, LC lace a, LC monticola, LC LC polita, LC p otobissetiana, LC sabaei, LC LC saxi a e, LC so didipes, LC to yoensis, LC a ia, LC Polystichum lepidocaulon, LC P. et- osopaleaceum, LC bc A, LC B1, LC B2, LC B3, LC B4, LC B5, LC C1, LC C2, LC C3, LC C4, LC D, LC A achniodes a istata, KY yopte is expansa, KY ymnophylla, KY handeliana, KY hasseltii, KY monticola, KY polita, KY p otobissetiana, KY sabaei, KY saxi a a, KY so didipes, KY to yoensis, KY a ia, KY Polystichum lepidocaulon, KY P. et osopaleaceum, KY