2018 OCB Workshop. What goes around comes around: Connectivity and microevolution in the plankton. Tatiana Rynearson

Size: px

Start display at page:

Download "2018 OCB Workshop. What goes around comes around: Connectivity and microevolution in the plankton. Tatiana Rynearson"

Mildred Ryan
5 years ago
Views:

1 What goes around comes around: Connectivity and microevolution in the plankton 208 OCB Workshop Tatiana Rynearson Graduate School of Oceanography, University of Rhode Island

(silica, POC) Uptake rates Needed: high-throughput phenotypic screening

2 BGC and plankton Inter-specific physiological variation Intra-specific variation in the lab Light Nutrients Temperature Salinity Composition (silica, POC) Uptake rates Needed: high-throughput phenotypic screening phenomics Reviewed in Godhe and Rynearson, 207 BGC??? BGC 208 OCB Workshop

3 BGC and Plankton Ecological effects of inter- vs intra-specific variation? 208 OCB Workshop N Density (µmol/µm 3 ) S marinoi S pseudocostatum Des Roches et al 207, Nature Ecol & Evol Anderson et al in prep

4 What s going on in the field? Evolutionary potential? Mechanisms? (drift, selection, sex, mutation, migration?) Rates of change? How does water circulation influence these processes? What does the planktonic seascape look like? 208 OCB Workshop

5 Today s themes Ocean forensics: How much raw material is out there for evolution to act on and how is it subdivided? Temporal and spatial patterns of genetic variation Tells us about evolutionary potential Diatoms and their friends 208 OCB Workshop You can tell a lot about a diatom by who it associates with Not only in test tubes Potential for microbial coevolution?

6 Ocean forensics: Temporal and spatial patterns of genetic variation Trotula Kerry Whittaker Focus on diatom T rotula 208 OCB Workshop Phenotypic variation Whittaker & Rynearson 202

genetic variation is out there Frequency Population Population 2 Repeat length (allele size), bp Gene pools

7 How to ID genetic variation Microsatellite markers- Repeat region varies in length (Mutation) CTGCTCAGTGTGTGTGTGTGACGACC DNA fingerprints identify individuals Whole genome scans (Mutation) Tells us how much genetic variation is out there Frequency Population Population 2 Repeat length (allele size), bp Gene pools identify genetically distinct populations How variation is subdivided into distinct units (Selection, Migration, Recombination & Genetic Drift)

8 Global Diversity in T rotula? individuals genotyped 447 different genotypes 6 Sampled 20 global locations simultaneously Isolated ~50 single cells from each location at multiple timepoints Extract DNA and amplify microsatellites Lots of raw material for contemporary evolution! 208 Summer Workshop Large population sizes (000 s of clonal lineages) Genetic Drift not as important as other mechanisms

9 High diversity but how is it subdivided? F ST 6 Quantify genetic divergence between water samples (F ST ) Test for isolation by distance Isolation by distance 208 Summer Workshop No Isolation Pairwise Distance b/t samples (km) eg Wright, 93

10 Isolation by distance in T rotula? A Genetic Distance (F ST /(-F ST )) R 2 = 0058 p = 05 Atlantic B Pacific C Global Log Distance (km) Genetic Distance (F ST /(-F ST )) No substantive isolation by distance on global scale R 2 = 0330 p = Log Distance (km) Genetic Distance (F ST /(-F ST )) R 2 = 0058 p = Summer Workshop Log Distance (km) Whittaker & Rynearson, 207, PNAS

11 How are diatom species subdivided over global scales? genetically distinct populations, some sampled repeatedly Same population in different ocean basins 208 Summer Workshop Whittaker & Rynearson, 207, PNAS

12 How are diatom species subdivided over global scales? genetically distinct populations, some sampled repeatedly Same population in different ocean basins Same population succession in two ocean basins So there is population variation but Not static Not dispersal limited 208 Summer Workshop Whittaker & Rynearson, 207, PNAS

T rotula populations evolving more slowly than connectivity of surface ocean Microbial evolution in a circulating ocean- see Hellweger et al 204 Divergence

13 T rotula populations evolving more slowly than connectivity of surface ocean Microbial evolution in a circulating ocean- see Hellweger et al 204 Divergence maintained by selection T rotula populations associated with temperature and Chl a Selection reduces gene flow among populations NASA, G Shirah 208 Summer Workshop

What else do we know about the diversity and divergence

adaptation Fjords harbor unique populations in T rotula

14 What else do we know about the diversity and divergence of diatoms? Space Time Taxa 208 Summer Workshop Long-lived populations >00yrs LOTS of time for evolutionary adaptation Fjords harbor unique populations in T rotula and D brightwellii Recirculating nature of fjords? (Rynearson et al 2006) Harnstrom, Ellegaard, Andersen, Godhe 20

to dispersal? Different than T rotula! Space Time Taxa Pennate : Centric signal?

15 What else do we know about the diversity and divergence of diatoms? Distinct Populations & Increasing divergence with increasing distance Barriers to dispersal? Different than T rotula! Space Time Taxa Pennate : Centric signal? Different evolutionary potentials? Phytopedia, EOAS, UBC 208 Summer Workshop Casteleyn et al 200

16 What else do we know about the diversity and divergence of diatoms? Space Time Taxa NABE Suggests the open ocean may act as a mixing zone and repository of genetic variation 208 Summer Workshop Chen and Rynearson, 206

17 Today s themes Ocean forensics: How much raw material is out there and how is it subdivided? Temporal and spatial patterns of genetic variation Tells us about evolutionary potential Diatoms and their friends You can tell a lot about a diatom by who it associates with 208 Summer Workshop Not only in test tubes Potential for microbial coevolution?

18 Not only in test tubes Potential for microbial co-evolution? Organism interactions and significance for BGC - Exchange of molecules, vitamins, and nutrients - Bacteria impact diatom host physiology 208 Summer Workshop Olivia Ahern Species-specific associations

19 Do distinct diatom populations harbor distinct microbiomes? Hints of intraspecific variation in diatom genus Pseudonitzschia (Sison-Mangus et al ISMEJ 204) 208 Summer Workshop Hypothesized there would be a single core microbiome with shifts in composition between populations

20 Do distinct diatom populations harbor distinct 5 μl 200 ml microbiomes? A single cell approach 2 μl 2 μl 2 μl 200 ml 200 ml 200 ml 88 single cell diatom isolates + whole seawater samples Isolates washed 3x in sterile seawater Transfer of << free-floating bacteria into culture well 208 Summer Workshop Isolates cultured for 2 wks DNA extraction Sequencing to determine taxonomic composition Ahern et al in prep

Diatom associated bacterial communities differ from whole seawater communities PCA2 822% PCA2 822% 0 5 0 5 0 208 Summer Workshop 20 5 0 5 0 5 PCA

21 Diatom associated bacterial communities differ from whole seawater communities PCA2 822% PCA2 822% Summer Workshop PCA 2643% PCA 2643% T rotula Narragansett Bay Whole Seawater Narragansett Bay T rotula Narragansett Bay 2 Whole Seawater Narragansett Bay 2 Ahern et al in prep

22 Different bacterial communities associated with genetically distinct diatom populations Bacterial community composition maps directly to diatom populations 208 Summer Workshop Ahern et al in prep

23 Different bacterial communities associated with genetically distinct diatom populations Summer Workshop Suggests long-term associations between bacteria and diatoms Potential for co-evolutionary dynamics and significant impact on function, survival, and biogeochemical cycling 7 Ahern et al in prep

24 What s going on in the field? Evolutionary potential is high! (Diatoms, Dinoflagellates, Prymnesiophytes) Mechanisms Selection influenced by both environment & ecology Genetic Drift not so important (large populations) Open questions: frequency of sex (recombination)? Rates of mutation in the field? Persistent populations Lifetimes exceed global connectivity of surface waters (>00 yrs) Sufficient duration to acquire unique microbiomes 208 Summer Workshop Seascape: Barriers to dispersal? No in Centrics Yes in Pennate Diatoms High probability of immigration, emigration and niche occupation Potential for local adaptation, reduced immigration and gene flow Open ocean as a genetic mixing zone

25 Acknowledgements: Global Sampling Effort Caitlin Lawrence Heidi M Sosik Taylor Crockford Barney Balch Karen Wiltshire Nicole Alberle-Malzahn Erla Bjork Hugh MacIntyre Justin Liefer Lucie Novoveska Fabienne Jalabert David A Caron Erica Seubert Mya Keyzers Anthony Odell Bruce L Wing Tatiana Orlova Martina Doblin Katherine Baer-Jones, Sophie Mormede Peter Thompson Cathy Johnston Beatriz Yancinnelli Johan Van der Molen Environmental data was generously provided by several monitoring programs including: Helgoland Roads, Southern California Coastal Observing System (SCCOS), Narragansett Bay Phytoplankton Time Series, Martha s Vineyard Coastal Observatory, Washington State Department of Ecology, Service d Observation en Milieu LITtoral (SOMLIT) 208 Summer Workshop

Evolution of Populations

Evolution of Populations Gene Pools 1. All of the genes in a population - Contains 2 or more alleles (forms of a gene) for each trait 2. Relative frequencies - # of times an allele occurs in a gene pool