Pasan Samarasin-Dissanayake

Transcription

1 Population Differentiation, Historical Demography and Evolutionary Relationships Among Widespread Common Chaffinch Populations (Fringilla coelebs ssp.) by Pasan Samarasin-Dissanayake A thesis submitted in conformity with the requirements for the degree of Master of Science Ecology and Evolutionary Biology University of Toronto Copyright by Pasan Samarasin-Dissanayake 2010

2 Population Differentiation, Historical Demography and Evolutionary Relationships Among Widespread Common Chaffinch Populations (Fringilla coelebs ssp.) Pasan Samarasin-Dissanayake Master of Science Department of Ecology and Evolutionary Biology University of Toronto 2010 Abstract Widespread species that occupy continents and oceanic islands provide an excellent opportunity to study evolutionary forces responsible for population divergence. Here, I use multilocus coalescent based population genetic and phylogenetic methods to infer the evolutionary history of the common chaffinch (Fringilla coelebs), a widespread Palearctic passerine species. My results showed strong population structure between Atlantic islands. However, the two European subspecies can be considered one panmictic population based on gene flow estimates. My investigation of effects of sampling on concatenated and Bayesian estimation of species tree (BEST) methods demonstrated that concatenation is more sensitive to sampling than BEST. Furthermore, concatenation can provide incorrect evolutionary relationships with high confidence when sample size is small. In conclusion, my results suggest European ancestry for the common chaffinch and Atlantic islands appear to have been colonized sequentially from north to south via Azores. ii

3 Acknowledgements First, I would like to thank Dr. Allan Baker for giving me an opportunity to work in his lab, giving me the independence to explore and learn, and providing guidance when I needed it. Thanks to Dr. Asher Cutter for helpful advice and allowing me to use his cluster for analysis. I am in debt of Oliver Haddrath for training me in molecular laboratory techniques, designing an informative molecular marker (ANON OH) and tremendous support in and out of the lab. Thank you for everyone in the lab including Dr. Erika Tavares, the most helpful postdoc one can imagine; Rosemary Gibson for supporting me in many ways, Alison Cloutier for fun and very educational times in the lab, and Yvonne Verkuil for assistance with analysis and some interesting discussions. Thank you to past and present postdocs Dr. Sergio Pereira and Dr. Debbie Buehler for their assistance, Kristen Choffe for DNA sequencing help, Cathy Dutton and Sue Chopra for administrative support. Thank you to Alivia Dey for friendship. I am very grateful to my parents for their constant support in whatever I chose to do and my sister for running some of my analysis on her computer and annoying me to write this thesis. iii

4 Table of Contents Abstract.. ii Acknowledgements.. iii Table of contents.. iv List of Figures.. vi List of Tables.. viii List of Appendices ix Chapter 1: General Introduction Molecular population genetics and molecular phylogenetics The common chaffinch (Fringilla coelebs) Thesis objectives References 9 Chapter 2: Population genetic structure and historical demography of the common chaffinch (Fringilla coelebs) Abstract Introduction Methods Sampling DNA extraction, amplification and sequencing Data analysis Results Summary statistics and neutrality tests Haplotype networks Genetic clusters and migration rates Effective population sizes and population expansion Discussion Population structure & subspecies status Effective population size and population expansion Conclusions References.. 47 iv

5 Chapter 3: Comparison of multilocus phylogenetic methods for inferring evolutionary relationships among recently diverged common chaffinch subspecies (Fringilla coelebs ssp.) Abstract Introduction Methods Sampling, DNA extraction, amplification and sequencing Data analysis Results Discussion Effects of sampling on phylogenetic inference Species tree estimates with some gene flow Conclusion References.. 83 Chapter 4: General conclusions References.. 91 v

6 List of Figures Chapter 1 Figure 1: Evolutionary relationships among Fringilla sp Figure 2: Distribution map of the common chaffinch (Fringilla coelebs) showing part of its total range... 5 Chapter 2 Figure 1: Map of sampled common chaffinch populations. 17 Figure 2: Median- joining haplotype network of the control region of mtdna. 29 Figure 3: Median- joining haplotype network of nuclear loci EF1α and PTPN. 30 Figure 4: Median- joining haplotype network of nuclear loci TROP and UBIQ 31 Figure 5: Plot of likelihood of data for assumed number of populations (K) in Structure Figure 6: Probabilistic assignment of individual genotypes to populations (K=5) in Structure. 33 Chapter 3 Figure 1: Discordance between gene trees and the species tree.. 57 Figure 2: Geographic locations of sampled common chaffinch subspecies (Fringilla coelebs ssp.). 60 Figure 3: Expected phylogenetic relationships among Atlantic island subspecies under different colonization hypothesis Figure 4: Evolutionary relationships among common chaffinch subspecies from concatenated Bayesian inference.. 70 Figure 5: Evolutionary relationships among common chaffinch subspecies from estimation of species tree (BEST) method 71 vi

7 Figure 6: The large data set molecular clock tree from Bayesian estimation of species tree (BEST) method Figure 7: Effect of sampling when multiple gene lineages persist in recently diverged populations Figure 8: Most probable colonization pattern of Atlantic Islands and Africa. 79 vii

8 List of Tables Chapter 2: Table 1: Sampled loci for population genetic analysis 20 Table 2: Population genetic summary statistics Table 3: Migration rate estimates between common chaffinch populations Table 4: Effective population size and population expansion. 37 Chapter 3: Table 1: Details of 9 nuclear loci sampled for phylogenetic analysis. 65 viii

9 List of Appendices Appendix 1: Details of the Chaffinch samples used in the study 92 ix

10 Chapter 1 General Introduction The study of evolutionary processes responsible for population divergence and speciation is a very important area of research in evolutionary biology. Investigation of structured populations is a key component in understanding how population divergence eventually leads to speciation. According to a simple allopatric model of speciation, an ancestral population splits into two daughter populations and a barrier restricts gene flow between the two daughter populations. In absence of gene flow, the two daughter populations go on different evolutionary trajectories as each population experience random mutations, drift and/or selection. As genetic differences between the two daughter populations accumulate, reproductive isolation may result due to genetic incompatibilities (Coyne and Orr 2004). Understanding details of this process from initial divergence to complete reproductive isolation is an ongoing research goal in evolutionary biology. But it generally takes a long time to go from initial divergence to reproductive isolation; hence study of earth s biodiversity is historical in nature. The fields of population genetics and phylogenetics attempt to understand historical evolutionary and demographic process responsible for current species distribution, and infer past population divergence events using current molecular data. 1.1 Molecular population genetics and molecular phylogenetics Historically, the fields of population genetics and phylogenetics have asked different questions and have employed different methods. While population genetics is concerned with evolutionary forces acting within a species, the primary goal of 1

11 phylogenetics is to infer how species relate to each other. However, these two fields can be thought as being part of a continuum that goes from initial divergence of populations to accumulation of genetic differences between those populations to reach reproductive isolation, hence crossing the species boundary according to the biological definition of species. Early on, both fields have extensively used mtdna for evolutionary inference. While population genetics moved to microsatellites, phylogenetics required sequence based markers and moved to nuclear markers (e.g. introns). However, recent advances in DNA sequencing technology have slowly shifted population genetic studies to use more sequence based markers than microsatellites because sequences are much more information-rich than length polymorphisms. In addition, these two fields have come together in terms of methodology as coalescent theory has come to the forefront of phylogenetic inference methods. The utility of coalescent theory, the most active area of research in theoretical population genetics in the last few decades, provides a promising avenue to infer population genetic parameters and test evolutionary hypotheses. The development primarily attributed to Kingman (1982), the coalescent theory traces a sample of sequences from current generation back to its common ancestor. In the coalescent framework, gene genealogies are used to estimate population genetic parameters by treating genealogies as a random variable (Rosenberg and Nordborg 2002). The coalescent genealogy samplers estimate parameters of interest by making large collections of probable genealogies from data and integrating all sampled genealogies to estimate population genetic parameters. Herein lies the fundamental difference between traditional phylogenetics and theoretical population genetics approaches. Although both use gene genealogies, the inferred tree from the data is the primary interest in 2

12 phylogenetics, while trees are considered random variables in population genetics to estimate important population genetic parameters. The population genetic parameters estimated using the coalescent model provide more biologically realistic estimates with appropriate confidence intervals than estimates from classical summary statistics (Kuhner 2009). Also, coalescent simulations allow us to test demographic hypotheses, such as conformity to a certain population divergence pattern, and test alternative timing for divergence or population bottlenecks. The recognition that coalescent models can be extended from the population level to the species level has given rise to new phylogenetic methods for estimating species trees based on the coalescent such as Bayesian estimation of species trees (BEST) (Liu 2008), Minimize deep coalescence (MDC) (Maddison 1997), ESP-COAL (Degnan and Salter 2005; Carstens and Knowles 2007). These new methods are best suited for inferring evolutionary relationships between recently diverged groups because any single gene tree may not represent the actual species tree in these situations. Therefore, the methods incorporate uncertainty in gene genealogies in the estimate of the phylogeny. As a result, the fields of phylogenetics and population genetics are moving towards multilocus sequence-based coalescent approaches from single locus approaches that were predominant in most of its history (Brito and Edwards 2008). Use of multiple loci provides independent parameter estimates from each locus and gives far better estimates with narrow confidence intervals (Pluzhnikov and Donnelly 1996; Baker 2007). Therefore, there has been an emphasis on using multilocus data for historical evolutionary inference. 3

13 1.2 The common chaffinch (Fringilla coelebs) The genus Fringilla contains three species of finches that feed their young on insects, rather than seeds. They are seed-eating passerines, restricted to the Old World. The three members of this genus are the Brambling (Fringilla montifringilla), Blue chaffinch (Fringilla teydea) and the Common chaffinch (Fringilla coelebs). Figure 1 shows the evolutionary relationships of species in this genus. The common chaffinch and the blue chaffinch are sister species, and the brambling is sister to the two chaffinches. The blue chaffinch is endemic to high elevation pine forests in Canaries (Grant 1979), while the brambling occupies forests of Northern Europe and Asia. Figure 1: Evolutionary relationships among Fringilla sp. The common chaffinch is a widespread Palearctic species that is classified into many subspecies (>19), based on marked phenotypic, behavioural and geographic differences. There are two described subspecies from North Africa (F. c. africana and F. c. spodiogenys), two from Europe (F. c. coelebs and F. c. gengleri) and five from the Atlantic islands (F. c. moreletti, F. c. maderensis, F. c. canariensis, F. c. ombriosa, and F. c. palmae). The Atlantic islands are volcanic islands off the coast of Northwest Africa 4

14 and thought to have formed within the last 20 million years (Carracedo 1999). The Canary Islands are estimated to have formed 1-20 million years ago. The youngest island in the Canaries archipelago is El Hierro (home to F. c. ombriosa), which is estimated to be 1.1 million years old. La Palma (home to F. c. palmae) is estimated to be 2 million years old, while La Gomera (home to F. c. canariensis) is about 12 million years old (Carracedo 1999). The Azores and Madeira islands are thought to have formed about 5 million years ago. The Canary Islands are located about 100 km off the coast of Northwest Africa. Madeira is located between the Azores and Canaries, about 800 km from the Azores and 400 km from the Canaries. The Azores archipelago extends approximately 600 km in Northwest-southeast direction and is about 1,500 km from Portugal (Figure 2). Figure 2: Distribution map of the common chaffinch (Fringilla coelebs) showing part of its total range. The populations are named corresponding to their subspecies designations. 5

15 Based on the estimated origins of Atlantic islands, the common chaffinch populations are believed to have diverged within the last million years. There are substantial morphological and behavioural differences between island and continental types (Grant 1979; Dennison and Baker 1991; Lynch and Baker 1994), with island populations having evolved shorter wings, longer legs, longer bills and larger bodies than continental conspecifics (Grant 1979). In addition, island populations are characterized by extensive dark blue dorsal plumage, wings and tails in males (Grant 1979). Grant (1979) also found that beak depth and width have increased substantially in Azores birds, compared to the Canaries; and birds from the Canaries appear to be less variable than from the Azores for bill, wing and leg characters. However, Dennison and Baker (1991) used 12 morphometric measurements taken from larger samples and did not find statistically significant differences between the Canary and Azores populations in their total variance. They did noted that total variance in Canaries was lower than Azores and continental populations. Lynch and Baker (1994) investigated the cultural evolution of chaffinch populations by analyzing song memes. Their analysis revealed that the African and European populations had the lowest levels of meme differentiation between populations. The Azores population had the highest level of meme diversity and Canaries showed the highest level of among population differentiation. The high levels of memetic differentiation between Atlantic islands shown in this study suggest limited migration between islands (Lynch and Baker 1994). A previous phylogenetic analysis using mtdna suggested that Atlantic islands were sequentially colonized in a single wave via Azores (Marshall and Baker 1999). 6

16 However, the bootstrap support for some of the internal nodes in this phylogeny was low and incomplete lineage sorting may have swamped the phylogenetic signal, yielding incorrect evolutionary relationships by traditional methods. A population genetic study to infer the location of Pleistocene refugia using the same locus estimated moderate gene flow between some African and European populations, but parameter estimates had large confidence intervals since they were inferred from a single locus. However, the analysis suggested that Iberia, Greece and North Africa may have served as refugia during the Pleistocene glacial maximum (Griswold and Baker 2002). This study however did not sample any of the Atlantic island populations. 1.3 Thesis objectives A new method of phylogenetic inference based on coalescence was proposed by Liu and Pearl (2007), which is designed to rectify the problem of inferring evolutionary relationships when incomplete lineage sorting is present. This method has performed well in simulations and in a few empirical studies, showing potential for inferring correct evolutionary relationships for recently diverged species. Furthermore, coalescent theory allows us to estimate important population genetic parameters such as the scaled population mutation rate (θ), migration rates and historical population size changes (i.e. population growth/ bottlenecks). I employ these latest phylogenetic and population genetic tools to determine the evolutionary history of the common chaffinch, which can further our understanding of the speciation process in oceanic islands, which is the primary focus of my thesis. In chapter 2, I use molecular population genetic tools to examine population structuring and historical demography of common chaffinch populations. I use the 7

17 Bayesian genetic clustering program Structure to examine whether described populations based on morphology correspond to genetic populations. In a coalescent framework, I estimate migration rates among populations and investigate the possibility of recent population growth. The primary objective was to determine the level of population differentiation among putative populations (specifically Atlantic island populations) and whether morphological subspecies correspond to genetic clusters. In addition, I investigate the demographic history of these populations by modeling population size changes in the recent past. One possibility is that these island populations have been isolated for thousands of generations, with very limited gene flow between them, essentially functioning as allopatric incipient species. Another possibility is that these populations have diverged very recently, experience ongoing gene flow, and function as demes. In between these two extremes is the possibility that these populations have diverged relatively recently, have limited ongoing gene flow, and possibly are in the process of acquiring reproductive isolation, in which case, we may be seeing speciation in progress. In chapter 3, I investigate evolutionary relationships between common chaffinch populations by constructing multilocus intraspecific phylogenies. I use the popular phylogenetic package MrBayes to construct trees from concatenated sequence data and also by using the new coalescent based phylogenetic inference method implemented in the program BEST. First, I investigate effects of sampling on concatenated phylogenetic inference by comparing phylogenies constructed using few (4) sequences per population versus many (16) sequences per population. It is a common practice in phylogenetics to use a single sequence to represent the species because interspecific sequence variation is 8

18 expected to be significantly higher than intraspecific variation. But for recently diverged groups, this may result in incorrect evolutionary inferences due to the stochasticity of the lineage sorting process. Therefore, I use a new coalescent-based phylogenetic method (BEST) (Liu and Pearl 2007; Liu 2008), which accounts for incomplete lineage sorting to infer evolutionary relationships. I compare and contrast estimated phylogenies from each method to determine the most likely evolutionary relationships among chaffinch populations. I summarize my findings from the population genetic and phylogenetic analyses in chapter 4 to elucidate the evolutionary history of the common chaffinch. I also discuss future research directions in phylogenetic and population genetic inference methods to improve accuracy of historical inferences. Chapter 2 and 3 are written as two primary research articles to be published in separate scientific journals. 1.4 References Baker, A. J Molecular advances in the study of geographic variation and speciation in birds. Auk 124: Brito, P. H., and S. V. Edwards Multilocus phylogeography and phylogenetics using sequence-based markers. Genetica:1-17. Carracedo, J. C Growth, structure, instability and collapse of Canarian volcanoes and comparisons with Hawaiian volcanoes. J Volcanol Geotherm Res 94:

19 Carstens, B. C., and L. L. Knowles Estimating species phylogeny from gene-tree probabilities despite incomplete lineage sorting: An example from melanoplus grasshoppers. Syst Biol 56: Coyne, J. A., and H. A. Orr Speciation. Sinauer Associates, Sunderland, MA. Degnan, J. H., and L. A. Salter Gene tree distributions under the coalescent process. Evolution 59: Dennison, M. D., and A. J. Baker Morphometric variability in continental and Atlantic island populations of chaffinches (Fringilla coelebs). Evolution 45: Grant, P. R Evolution of the Chaffinch, Fringilla coelebs, on the Atlantic islands. Biol J Linn Soc 11: Griswold, C. K., and A. J. Baker Time to the most recent common ancestor and divergence times of populations of common chaffinches (Fringilla coelebs) in Europe and North Africa: Insights into Pleistocene refugia and current levels of migration. Evolution 56: Kingman, J. F. C On the genealogy of large populations. J Appl Probab 19A: Kuhner, M. K Coalescent genealogy samplers: windows into population history. Trends Ecol Evol 24: Liu, L BEST: Bayesian estimation of species trees under the coalescent model. Bioinformatics 24: Liu, L., and D. K. Pearl Species trees from gene trees: Reconstructing Bayesian posterior distributions of a species phylogeny using estimated gene tree distributions. Syst Biol 56:

20 Lynch, A., and A. J. Baker A population memetics approach to cultural evolution in chaffinch song: Differentiation among populations. Evolution 48: Maddison, W. P Gene trees in species trees. Syst Biol 46: Marshall, H. D., and A. J. Baker Colonization history of Atlantic island common chaffinches (Fringilla coelebs) revealed by mitochondrial DNA. Mol Phylogenet Evol 11: Pluzhnikov, A., and P. Donnelly Optimal sequencing strategies for surveying molecular genetic diversity. Genetics 144: Rosenberg, N. A., and M. Nordborg Genealogical trees, coalescent theory and the analysis of genetic polymorphisms. Nat Rev Genet 3:

21 Chapter 2 Population genetic structure and historical demography of the common chaffinch (Fringilla coelebs) 2.1 Abstract The widespread common chaffinch (Fringilla coelebs) is divided into over 19 subspecies based on morphological differences. Here, I investigated the genetic structure and demographic history of the common chaffinch populations in Western Europe, Northern Africa and the Atlantic islands using 10 sequence-based genetic markers (mtdna and 9 nuclear markers). The migration rate estimates from the multilocus coalescent analysis showed significant genetic differentiation among Atlantic island populations (4Nm<1). High levels of gene flow were detected between the British chaffinch (F. c. gengleri) and the Western European chaffinch (F. c. coelebs) (4Nm = 7.86). The mismatch distribution analysis of mtdna and multilocus analysis suggests that all populations (except F. c. ombriosa) have been growing at relatively equal rates. Our results suggest that the British chaffinch is part of the more widespread Western European chaffinch population. 2.2 Introduction The question of what constitutes a species is not without its share of controversy; and species delimitation continues to be a source of debate among biologists (Mallet 1995; Sites Jr and Marshall 2003; Hey 2006). Although the most commonly used definition of species today is the biological species concept (Mayr 1963), species are 12

22 frequently described based only on morphology. In addition to morphological and biological species concepts, other species concepts such as genealogical species (Baum and Shaw, 1995) rely on a phylogenetic framework, and define a species as a basal, exclusive group of organisms, whose members are more closely related to each other than they are to any organism outside the group. Furthermore, some have argued that species is a human classification constructed to divide the biodiversity continuum and not a real separate entity (Mallet 2008). Regardless, species is the best recognized unit of biodiversity in evolutionary biology and conservation. Even though the large majority of described species are morphological species, genetics has played an increasingly important role in species delimitation in the past few decades (Hebert et al. 2003; Sites Jr and Marshall 2003). In the continuum of biological organization from genes to populations to higher levels of organization such as phyla, subspecies represents an intermediate step between populations and species. In general, subspecies are populations that have sufficiently diverged in morphological traits to warrant a distinction, but these trait differences are not pronounced enough to classify them as distinct species. The common chaffinch (Fringilla coelebs), a widespread Palearctic passerine species, provides a great opportunity to study this continuum from structured populations to recognized species. Common chaffinches occupy much of Eurasia, Northern Africa and the Atlantic islands in the Canaries, Madeira and Azores, and these populations have undergone marked phenotypic differentiation to warrant designation of multiple subspecies (>19) (Grant 1979; Baker et al. 1990; Marshall and Baker 1999; Suárez et al. 2009). 13

23 The study of geographic variation in a species is often the first step in the quest to understand how a single ancestral species gives rise to two or more daughter species. Since the advent of phylogeography, mtdna has played a crucial role in furthering our understanding about genetic variation within species and it continues to play a critical role. mtdna is the molecule of choice for phylogeographic and population genetic studies because it is easy to amplify, does not recombine (but see Rokas et al. 2003; White et al. 2008) and mutates faster than the average nuclear locus. These properties make mtdna genes ideal for building gene genealogies and to estimate population genetic parameters. However, insight from coalescent theory predicts that gene trees from different loci can differ substantially in topology, and different genes can have different histories even though they come from the same populations (Maddison 1997; Wakeley 2008; Nielsen and Beaumont 2009). Therefore, population genetic parameters estimated from a single locus may not accurately reflect the true evolutionary history of the population (Hey and Machado 2003; Nielsen and Beaumont 2009). Additionally, population genetic parameters estimated from a single locus have very large 95% credible intervals due to stochastic variance in the coalescent process (Edwards and Beerli 2000; Baker 2007). Due to these reasons, over-interpretation of phylogeographies and population genetic parameter estimates from a single locus has been criticized (Knowles and Maddison 2002; Edwards et al. 2005). Furthermore, concerns have been raised about historical demography based solely on mtdna because mtdna genes could be affected by selective sweeps (Bensch et al. 2006) and sex biases in fitness or dispersal (Hare 2001). With rapidly advancing DNA sequencing technology and development of new 14

24 analytical tools based on coalescent theory, population genetic parameter estimates and interpretations from multiple loci can avoid problems inherent in single locus interpretations. Baker et al. (1990) conducted a population genetic survey of the common chaffinch using 22 polymorphic allozyme loci and showed that the highest level of genetic differentiation was between continental (Europe and Africa populations pooled together) and Atlantic island populations (F ST = 0.386). There was a high level of genetic differentiation among Atlantic islands (F ST = 0.321) but the European population was weakly differentiated from the African population (F ST = 0.092). Furthermore, populations in different islands of the Canaries have undergone significantly more differentiation compared to populations among Azores Islands. The mean F ST among Canary populations was while it was in Azores Islands (Baker et al. 1990). This suggests that even though distances between Azores islands are greater than Canary Islands, Azores populations are essentially panmictic. They also reported that the Azores Islands support much larger populations than the Canary Islands because of more agricultural land and a much more humid climate in the Azores. The widespread distribution of common chaffinches in continents and oceanic islands provide an excellent opportunity to investigate the effects of geographic isolation and genetic drift on population divergence and speciation. In this study, I focus on common chaffinch populations in Western Europe, Northern Africa and the Atlantic islands to investigate population structure and demographic history using coalescent- 15

25 based multilocus population genetic tools. For simplicity, I use current subspecies designations to refer to the putative populations because subspecies names correspond very closely to geographic locations (Figure 1). However, the validity of certain subspecies designations has been questioned. One such point of contention is the validity of the British chaffinch (F. c. gengleri) as a separate subspecies from the more widespread F. c. coelebs in rest of Western Europe. Others have questioned the validity of three subspecies from the Canary Islands. For example, Mayr (1968) assigns the El Hierro population as a separate subspecies (F. c. ombriosa) from the La Palma population (F. c. palmae), while Baker et al. (1990) claimed that these two populations were phenotypically indistinguishable. Here, I investigate genetic structure of the common chaffinch populations using haplotype networks, Bayesian genetic clustering and by estimating migration rates between populations. I also estimate the effective population size and investigate the possibility of historical population size changes. Population genetic parameters are estimated in a multilocus coalescent framework to avoid problems inherent to single locus methods, thus providing more reliable inferences about the history of the common chaffinch. 16

26 Figure 1: Distribution map of the common chaffinch (Fringilla coelebs) showing part of its total range. The populations are named corresponding to the subspecies designation. There are three putative populations in the Canaries, each occupying different islands. 2.3 Methods Sampling A total of 121 chaffinches were sampled from nine populations corresponding to their subspecies designation (Figure 1). Appendix I provide the details of the sampled individuals. Nineteen individuals were sampled from continental Europe (Denmark and Greece) that were classified as F. c. coelebs, eight individuals from the United Kingdom that were classified as F. c. gengleri, and fourteen individuals from Morocco and twelve from Tunisia, corresponding to F. c. africana and F. c. spodiogenys. From the Atlantic islands, fourteen individuals were sampled from the Azores islands population of F. c. moreletti, fourteen from the Madeira population of F. c. maderensis, and thirty-nine 17

27 individuals from the Canary Islands. Twelve of the Canary Island individuals were from the island of El Hierro, classified as the F. c. ombriosa subspecies; fourteen from La Palma, classified as the F. c. palmae subspecies and fourteen from La Gomera, classified as F. c. canariensis subspecies DNA extraction, amplification and sequencing Genomic DNA was extracted from frozen muscle tissue using the standard proteinase K-phenol-chloroform method (Sambrook and Russell 2001) or rapid alkaline extraction (Rudbeck and Dissing 1998). Briefly, rapid alkaline extraction was carried out by first adding a minute amount of muscle tissue (2-3 ul equivalent of blood) to a 96 well PCR plate containing 20 ul of 0.2 M NaOH. The plate was covered and heated to 75 C for 20 minutes in a thermocycler. Finally, the solution was neutralized by adding 180 ul of a 0.04 M Tris-HCl ph 7.5 solution and frozen. The control region of the mtdna and 9 nuclear loci were amplified using locus specific primers (Table 1). The amplified loci are: Aconitase II (ACON: Backström et al. 2008); B-Actin (B-ACT: Waltari and Edwards 2002); Elongation factor 1 alpha (EF1α: Backström et al. 2008); Glyceraldehyde-3-phosphate dehydrogenase (GAPD: Friesen et al. 1999); Locus L27331 (L27331: Backström et al. 2008); Protein tyrosine phosphatase non-receptor 12 (PTPN12; Townsend et al. 2008), Tropomyosin (TROP: Friesen et al. 1999); and Ubiquitin carboxyl-terminal esterase (UBIQ: Backström et al. 2008), Anonymous locus OH (ANON OH), and the Control region of mtdna (Marshall and 18

28 Baker 1997). All the nuclear loci with the exception of PTPN12 were non-coding. The anonymous locus OH was developed by the following method. First, Chaffinch genomic DNA was isolated, purified and digested using five different restriction enzymes which were selected to leave single stranded overhangs at each cut site. The enzymes used were Hind III, Eco RI, Xba I, Xho I and Nhe I. The digested DNA was then size selected and ligated to double stranded linkers containing specific single strand overhangs complementary to the restriction enzyme cut sites. The library that resulted represented the complete Chaffinch genome with the average fragment size being approximately 1,500 bp and each fragment having amplifiable ends. Using a primer specific for the retrotransposon CR1 and a primer specific for the linker, fragments were amplified, size selected and cloned. A number of clones were sequenced to identify flanking regions to the repetitive element. The flanking regions were blasted against the chicken genome to ensure they were present as a single copy, and from the candidate sequences primers were designed to amplify this region but to exclude the repetitive element. 19

29 Table 1: Sampled loci for population genetic analysis Locus Primer sequence Fragment size (bp) Chromosomal location in zebra finch Model of sequence evolution Reference Aconitase II (ACON) Anonymous locus OH (ANON OH) B-Actin (B- ACT) Elongation factor 1 alpha (EF1α) Glyceraldehyde 3 phosphase dehydrogenase (GAPD) Locus (L27331) Protein tyrosine phosphatase non-receptor 12 (PTPN12) Tropomyosin (TROP) Ubiquitin carboxyl-terminal esterase (UBIQ) mtdna Control region (CR) F- CCAATGCTTGTGGGCCATG R- ATTGCGACCTGTGAAATTCC 750 1A GTR+I Backström et al F- TCCCATTGCAACAACCTGTTCAC R- GGGCACTTCAGTCACTCTGAC GTR+I NA F- CCTGATGGTCAGGTCATCA R- CAGCAATGCCAGGGTACAT GTR+I+G Waltari and Edwards 2002 F- ATTGGCTACAACCCAGACAC R- CAGGATGCAGTCCAAGGCT HKY+G Backström et al F- ACCTTTAATGCGGGTGCTGGCATTGC R- CATCAAGTCCACAACACGGTTGCTGTA HKY+G Friesen et al F- CCTAGCTAAATATGTTCTGGC R- TAGGCTTCCTGATGATGGCT GTR+I+G Backström et al F- AGTTGCCTTGTWGAAGGRGATGC R- CTRGCAATKGACATYGGYAATAC 830 1A HKY+I Townsend et al F- GAGTTGGATCGGGCTCAGGAGCG R- CGGTCAGCCTCTTCAGCAATGTGCTT GTR+I Friesen et al F- GCTTGTGGGACAATTGGG R- TATTTGGCCCTCTCTTCAGG HKY+I Backström et al F- TCAGGGTATGTATAATATGC R- CACTTGCTGTGAAGAGC 480 NA GTR+I+G Baker and Marshall

30 Polymerase chain reactions (PCR) were carried out using 1.5 µl of DNA in a 12.5 µl of total reaction volume, with 1.25 µl of PCR buffer (10mM TrisHCl ph8.3, 2.5 mm MgCl, 50mM KCl and 0.01% gelatin), 0.28 µl of 1X dntp s, 0.5 µl of each primer, and 0.05 µl of Platinum Taq (5units/ µl) (Invitrogen Inc). The thermocycling profile was as follows: an initial 94 C denaturation step for 4 min, followed by a total of 35 cycles consisting of a 30 sec at 94 C denaturation step, a 30 sec annealing step starting at 65 C and decreasing by a degree per cycle until the annealing temperature reached 55 C, and 30 sec 72 C extension step, and a final extension of 5 min at 72 C. Amplified product was isolated by separation in a 2% agarose gel, the DNA band was cut out of the gel and purified for sequencing. Cycle sequencing reactions with forward and reverse PCR primers were carried out using BigDye Terminator 3.1 (Applied Biosystems) and visualized on an ABI 3100 DNA Sequencer Data analysis For each locus, all sequences were edited using Chromas Pro 1.42 (Technelysium Pty. Ltd., Australia). The sequences were aligned initially with the program ClustalW (Thompson et al. 1994) in the BioEdit Sequence Alignment Editor (Hall 1999) and adjusted manually. For nuclear loci, heterozygous sites were identified from the presence of two equal height peaks in the chromatograms. The program PHASE 2.1 (Stephens and Scheet 2005) was used to resolve the haplotypes from the unphased genotype data when a sequence contained multiple heterozygous sites. A small subset of individuals that did not sequence well directly or that were needed for phasing were cloned into the PCR

31 TOPO TA cloning vector (Invitrogen) and sequenced in both directions using M13 primers. This was done to eliminate the possibility of using paralogous genes for analysis and to verify that statistically inferred haplotypes were correct. For each locus, the number of segregating sites (S), nucleotide diversity (π), haplotype diversity (H d ), Tajima's D statistic (Tajima 1989), Fu and Li s F* statistic (Fu and Li 1993) and minimum number of recombination events (R M, (Hudson and Kaplan 1985) were estimated using the DnaSP 5.0 software package (Librado and Rozas 2009). Deviation from the standard neutral model was tested using Tajima s D and Fu and Li s F* statistic, and significance was assessed by conducting 1000 coalescent simulations. The Hudson-Kreitman-Aguade (HKA) test (Hudson et al. 1987) implemented in DnaSP was conducted on loci that deviated from neutral predictions according to Tajima s D and Fu and Li s F* test. The HKA test compares observed and expected number of segregating sites within a species and the number of pairwise differences between species at two or more loci, and is more sensitive in detecting natural selection than neutrality tests based on site frequency spectrum (Zhai et al. 2009). I also conducted the fourgamete test (Hudson and Kaplan 1985) implemented in DnaSP to determine whether recombination needs to be incorporated into the coalescent model for population genetic parameter estimates. I constructed median-joining haplotype networks for each locus using NETWORK (available at to explore relationships among sequences at each locus. The goal of constructing haplotype 22

32 networks was to determine whether a) haplotypes segregate according to geographic locations and b) if there are signatures of recent population expansion. Therefore, haplotype networks function as a qualitative first pass test for exploring population structure and expansion. To determine historical population expansion events, mismatch distributions were calculated using the program Arlequin 3.1 (Excoffier et al. 2005). The expected distribution under a sudden demographic expansion model (Rogers and Harpending 1992) was generated using 1000 parametric bootstrap replicates. The sum-of-squared deviations (SSD) between observed and expected mismatch distribution were computed and significant deviation from the demographic expansion model was assessed by calculating the proportion of simulations producing a larger SSD than the observed SSD (α = 0.05). To determine the genetic structure of the common chaffinch, I used the Bayesian genetic clustering program Structure (Pritchard et al. 2000), which utilizes allele frequencies from multiple loci to assign sampled individuals to genetic clusters. Data were coded as haplotypes. Analysis was conducted with a burn-in of 400,000 and two million MCMC iterations after the burn-in under admixture model with correlated allele frequencies (Falush et al. 2003). Ten independent runs were conducted at each K with different seed numbers to calculate Ln [Pr(X K)]. Simulations were run from K=1 to K=10. I used the coalescent genealogy sampler program LAMARC (Kuhner and Smith 2007) to estimate population genetic parameters theta (θ), migration rates (M) and population growth parameter (g), and incorporated recombination into the model. Two 23

33 Bayesian replicates with four simultaneous searches with adaptive heating were conducted. The first 10,000 trees were discarded as burn-in, and then 50,000 trees were collected for parameter estimates by sampling every 50 th tree. The best model of nucleotide sequence evolution for each locus was identified using Akaike Information Criterion (AIC) in MrModeltest 2.3 (Nylander 2004) and specified for the analysis in LAMARC. Overall curve files for each parameter were inspected to ensure that parameter space was searched adequately and estimates were reliable. 2.4 Results Summary statistics and neutrality tests In general, the number of segregating sites (S) and the average pair-wise number of nucleotide differences per site between sequences (π) was higher in continental populations than island populations (Table 2). The Canary island populations harbored the least amount of genetic diversity, while the continental European F. c. coelebs population was the most diverse. The diversity statistics (S, π, H d ) among the three Canaries populations were very similar. In Atlantic islands, the Azores appears to be the most genetically diverse, but the Madeira population is close to the Azores population in the level of genetic diversity. The F. c. coelebs and F. c. gengleri populations had comparable numbers of segregating sites and nucleotide diversity at most loci. In the African continent, the F. c. africana population appears to be slightly more genetically diverse than the F. c. spodiogenys population. Recombination was detected for all examined loci except for the EF1a locus. The B-Actin locus contained the highest 24

34 number of recombination events as detected by the four gamete test. Only one recombination event was detected for the GAPD, PTPN 12, TROP and UBIQ loci. The results from Tajima s D and Fu and Li s F* neutrality tests were not significant (α =0.05) except in a few cases; suggesting conformity to the neutral coalescent model. In general, Tajima s D and Fu and Li s F* statistic for most populations were negative but not significant (Table 2). Fu and Li s F* statistic was negative for at least seven of the 10 loci in F. c. africana, F. c. spodiogenys, F. c. coelebs, F. c. gengleri, F. c. maderensis and F. c. palmae populations. Fu and Li s F* was negative across all loci for the F. c. coelebs population. Both Tajima s D and Fu and Li s F* were significantly negative for the F. c. palmae population at the EF1α locus (D = , F* = ), and the F. c. coelebs population at the L27331 locus (D= , F* = ). At the TROP locus, Tajima s D was significantly negative for the F. c. maderensis population (D = ) and Fu and Li s F* was significantly negative for the F. c. ombriosa population (F* = ). Since both these tests are sensitive to demographic history, the HKA test was conducted with Blue chaffinch as the outgroup. The HKA test did not detect significant deviation from neutrality (χ 2 = 0.215, p = 0.64). Both Tajima s D and Fu and Li s F* were significantly positive for the control region of mtdna in the F. c. moreletti population in the Azores (D = 2.186, F* =1.780). 25

35 Table 2: Population genetic summary statistics Locus Population N S π H d Tajima's D Fu and Li's F* ACON F. c. canariensis F. c. maderensis F. c. africana F. c. spodiogenys F. c. coelebs F. c. gengleri F. c. ombriosa F. c. palmae F. c. moreletti ANON OH F. c. canariensis F. c. maderensis F. c. africana F. c. spodiogenys F. c. coelebs F. c. gengleri F. c. ombriosa F. c. palmae F. c. moreletti B- ACT F. c. canariensis F. c. maderensis F. c. africana F. c. spodiogenys F. c. coelebs F. c. gengleri F. c. ombriosa F. c. palmae F. c. moreletti EF1α F. c. canariensis F. c. maderensis F. c. africana F. c. spodiogenys F. c. coelebs F. c. gengleri F. c. ombriosa F. c. palmae * * 0 F. c. moreletti GAPD F. c. canariensis F. c. maderensis F. c. africana F. c. spodiogenys F. c. coelebs R M 26

36 F. c. gengleri F. c. ombriosa F. c. palmae F. c. moreletti L27331 F. c. canariensis F. c. maderensis F. c. africana F. c. spodiogenys F. c. coelebs * * 1 F. c. gengleri F. c. ombriosa F. c. palmae F. c. moreletti PTPN12 F. c. canariensis F. c. maderensis F. c. africana F. c. spodiogenys F. c. coelebs F. c. gengleri F. c. ombriosa F. c. palmae F. c. moreletti TROP F. c. canariensis F. c. maderensis * F. c. africana F. c. spodiogenys F. c. coelebs F. c. gengleri F. c. ombriosa * 0 F. c. palmae F. c. moreletti UBIQ F. c. canariensis F. c. maderensis F. c. africana F. c. spodiogenys F. c. coelebs F. c. gengleri F. c. ombriosa F. c. palmae F. c. moreletti CR F. c. canariensis (1) F. c. maderensis F. c. africana F. c. spodiogenys F. c. coelebs (1) F. c. gengleri

37 F. c. ombriosa F. c. palmae F. c. moreletti * 1.78* (1) N: Sample size S: Number of segregating sites π: Average number of nucleotide differences per site between two sequences H d : Haplotype (gene) diversity Tajima's D: Tajima s D statistic (Tajima 1989) calculated in DnaSP. * p<0.05 Fu and Li's F*: Fu and Li's F* statistic (Fu and Li 1993) calculated in DnaSP. * p<0.05 R M : Minimum number of recombinant events estimated using four-gamete test (Hudson and Kaplan 1985) Haplotype networks The mtdna haplotype network (Figure 2) shows a clear distinction between Atlantic island and continental populations. There is no haplotype sharing between the islands and the continents, and five mutational steps separate the two groups. In the Atlantic islands, the birds from the Canaries, Madeira and Azores islands are separated into different haplo-groups with little haplotype sharing. Haplotype 4 is shared between the Azores and Madeira populations while haplotype 2 is shared between Madeira and Canary Islands. Within the Canary Islands, the three populations appear to segregate into distinct haplotypes with no haplotype sharing. The continental haplotype relationships are slightly more complex than islands. Haplotype 9 is shared between all four putative continental populations. Haplotypes 15 and 21 are shared between F. c. gengleri and F. c. coelebs populations. There are many low frequency haplotypes, mostly belonging to the F. c. coelebs population. 28