Supplemental Materials

Transcription

1 Supplemental Materials Effects of three different nucleoid-associated proteins encoded on the IncP-7 plasmid pcar1 on the host Pseudomonas putida KT2440. by Suzuki-Minakuchi et al. Correspondence: The Supplemental Materials include: Supplemental text Figure S1 Figure S2 Figure S3 Figure S4 Figure S5 Table S1 Table S2 Table S3 Table S4 Table S5 Table S6 Table S7 Table S8 Data set S1 Data set S2

2 Supplemental Text Bacterial strains, plasmids, and oligonucleotide primers specifically described in the Supplemental Text are listed in Tables S7 and S8 in the Supplemental Material. Construction of ORF145-, ORF146-, and double-deletion mutants. The single- and double-deletion mutants of ORF145 and ORF146 were prepared similarly using a homologous recombination-based gene replacement system (1). Briefly, DNA fragments containing the 5'- and 3'-flanking regions of each gene and a Gm resistance cassette were cloned into the suicide vector pk18mobsacb (2) to yield pk18mobsacbδ145, pk18mobsacbδ146, and pk18mobsacbδ145δ146. The resultant plasmids were transferred from E. coli S17-1λpir to KT2440(pCAR1) via filter mating, and the double-crossover recombinants were screened using sucrose counterselection. Mating assays of ORF145-, ORF146-, and double-deletion mutants. Filter mating assays between each mutant and recipient strain (P. putida KT2440KR) were performed. Aliquots of 500 l of precultures from the donor recipient strains in LB liquid medium with appropriate antibiotics were resuspended in LB liquid medium. The mixture of donor and recipient cells was dropped onto the 0.22-μm pore size filter on LB plates and incubated at 30 C for 3 h. The cell suspensions were then spread on selective media at appropriate dilutions. The numbers of transconjugants were determined by counting colonies on selective media 1 2 days after mating. The frequency of plasmid transfer was expressed as the number of transconjugants per number of donors. Complementation assays. Complementation assays for the single- and double-deletion mutants of ORF145 and ORF146 were performed using KT2440 carrying both ORF145 and ORF146 genes on its chromosome inserted using minitn10 on pbsl199 (3) (Tc resistance). The BamHI PstI fragments containing ORFs145 and 146 were amplified by PCR with ORF145_up_F and ORF146_down_R primers, and then inserted into the suicide vector pbsl199. The resultant plasmid with minitn10 and ORF (pbsl_orf145_146) was transferred from E. coli S17-1λpir to each deletion mutant via filter mating, and the strains with the inserted minitn10 were then obtained on selective LB with Km and Tc. Overexpression of His-tagged and FLAG-tagged Pmr, Pnd, and Phu. Construction of the expression plasmids for C-terminal-His-tagged and C-terminal-FLAG-tagged Pmr (pet-c-his-pmr and pflagpmr, respectively) was as described previously (4). To construct the C-terminal-His-tagged Pnd and Phu expression plasmids, the DNA fragments were amplified by PCR using puc4 as a template and a primer set containing artificial NdeI and XhoI sites at the 5'- and 3'-ends, respectively, of the pnd and phu genes, and the inserts were ligated into the corresponding restriction sites of pet26b(+)

3 (Novagen, San Diego, CA). The resultant plasmids were designated pet-c-his-pnd and pet-c-his-phu, respectively. To construct the C-terminal-FLAG-tagged Pnd and Phu expression plasmids, pet-c-his-pnd and pet-c-his-phu were digested with NdeI and XhoI, the resulting DNA fragments containing the pnd or phu genes were purified, and the DNA fragments were ligated into the NdeI and SalI sites of pflag-ctc (Sigma-Aldrich, St. Louis, MO). The resultant plasmids were designated as pflagpnd and pflagphu, respectively. Transformed E. coli BL21(DE3) cells harboring each expression plasmid were grown in LB supplemented with Ap or Km at 25 C to OD 600 of Cells were then induced overnight by the addition of 0.1 mm isopropyl β-d-thiogalactopyranoside (IPTG). Pull-down assays. Pull-down assays were performed using the MagneHis protein purification system (Promega, Madison, WI) as described previously (4). Briefly, E. coli cells expressing one of the pcar1-borne tagged NAPs (such as His-tagged Pmr, Pnd, and Phu, and FLAG-tagged Pmr and Pnd) were harvested, washed twice with MagneHis binding/wash buffer, and disrupted by ultrasonication. Crude extracts were then obtained by centrifugation. Crude extracts containing FLAG-tagged Pmr or Pnd (400 g for Pmr and 1,200 g for Pnd) were mixed with the crude extract containing His-tagged proteins as follows: Pmr, 2,000 g; Pnd, 700 g; Phu, 200 g. After the addition of 30 l of MagneHis Ni particles (Promega), the protein mixtures were incubated at 4 C with rotation (~10 rpm, 1 h). His-tagged proteins were then eluted in accordance with the manufacturer s instructions. For Western blotting, protein samples were separated by Tricine-SDS PAGE (5, 6) and transferred onto Sequi-Blot PVDF membranes (Bio-Rad, Hercules, CA) using a semidry method. Proteins were detected as described previously (4) using monoclonal anti-flag M2 (Sigma-Aldrich) as the primary antibody. REFERENCES 1. Choi KH, Schweizer HP An improved method for rapid generation of unmarked Pseudomonas aeruginosa deletion mutants. BMC Microbiol. 5: Schäfer A, Tauch A, Jäger W, Kalinowski J, Thierbach G, Pühler A Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pk18 and pk19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145: Alexeyev MF, Shokolenko IN Mini-Tn10 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of gram-negative bacteria. Gene 160: Yun CS, Suzuki C, Naito K, Takeda T, Takahashi Y, Sai F, Terabayashi T, Miyakoshi M, Shintani M, Nishida H, Yamane H, Nojiri H Pmr, a

4 histone-like protein H1 (H-NS) family protein encoded by the IncP-7 plasmid pcar1, is a key global regulator that alters host function. J Bacteriol 192: Schägger H, von Jagow G Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kda. Anal Biochem 166: Schägger H Tricine-SDS-PAGE. Nature protocols 1: Takahashi Y, Shintani M, Takase N, Kazo Y, Kawamura F, Hara H, Nishida H, Okada K, Yamane H, Nojiri H Modulation of primary cell function of host Pseudomonas bacteria by the conjugative plasmid pcar1. Environ Microbiol. 17: Sambrook J, Russell D Molecular Cloning: A Laboratory Manual 3rd edition. Cold Spring Harbor Press, New York.

5 Figure S1 A 2,000 -strand transcripts ( ) 200 bp 0 ORF92 pnd ORF94 B 4,000 +strand transcripts ( ) 200 bp 0 ORF95 phu ORF96 ORF97 FIG S1 RNA maps of the flanking regions of pnd (A) and phu (B) on pcar1. Blue bars represent the signal intensities of each probe detected in the RNA maps of KT2440(pCAR1). Pentagons indicate the direction and locations of the annotated genes.

6 KT2440(pCAR1) KT2440(pCAR1DpmrDpnd) KT2440(pCAR1DpmrDphu) KT2440(pCAR1) KT2440(pCAR1DpmrDpnd) KT2440(pCAR1DpmrDphu) KT2440(pCAR1) KT2440(pCAR1DpmrDpnd) KT2440(pCAR1DpmrDphu) KT2440(pCAR1) KT2440(pCAR1DpmrDpnd) KT2440(pCAR1DpmrDphu) Number of colonies Figure S2 Ferric citrate 37 mm 370 mm 37 mm 370 mm Cycles of dilution-incubation procedures FIG S2 pcar1 stability assays in the presence of different concentrations of iron ions (37 and 370 μm ferric citrate). The strains were grown on succinate as the sole source of carbon for 24 h, and then the resultant cultures were diluted in fresh media and cultured again. The dilution incubation procedure was repeated five times, and the carriage of pcar1 in colonies from the first and the fifth passage in culture was examined using the repa and carac genes. Black, gray, and white bars indicate the numbers of colonies containing intact pcar1, pcar1 without carac gene, and no pcar1, respectively.

7 Number of colonies Figure S a b c a b c 1 5 Cycles of dilution-incubation procedures FIG S3 pcar1 stability assay using KT2440(pCAR1) overexpressing RecT in trans. The strains were grown on succinate as the sole source of carbon for 24 h, and then the resultant cultures were diluted in fresh media and cultured again. The dilution incubation procedure was repeated five times, and the carriage of pcar1 in colonies from the first and the fifth passage in culture was examined using the repa and carac genes. Black, gray, and white bars indicate the numbers of colonies containing intact pcar1, pcar1 without the carac gene, and no pcar1, respectively; a : KT2440(pCAR1) harboring pbbad18k-rect under arabinose-induced conditions; b : KT2440(pCAR1) harboring pbbad18k-rect under non-induced conditions; c : KT2440(pCAR1) harboring pbbad18k under arabinose-induced conditions. Representative data from six independent experiments are shown.

8 KT2440(pCAR1pmrHis::Gm r ) KT2440(pCAR1Δ145) KT2440(pCAR1Δ146) KT2440(pCAR1Δ145Δ146) KT2440(pCAR1pmrHis::Gm r ) KT2440(pCAR1Δ145) KT2440(pCAR1Δ146) KT2440(pCAR1Δ145Δ146) Conjugation frequency (per donor) Conjugation frequency (per donor) Figure S4 A 10-1 ** ** (p < 0.1*, 0.05** ) * B minitn(orf145146) 10-2 ** ** FIG S4 Transfer frequencies of ORF145-, ORF146-, and ORF145&146-deleted pcar1. The Gm resistance gene replaced each gene, and KT2440 was used as the donor. KT2440KR harboring the Km resistance cassette was used as the recipient. Means and standard errors are shown. (A) The frequency data were analyzed statistically using the Kruskal Wallis and Steel Dwass tests, and single and double asterisks indicate P < 0.1 and P < 0.05, respectively. (B) Complementation analyses of the deletion mutants were performed using each deletion mutant (donor) with chromosomally inserted ORF145 and ORF146.

9 Figure S5 A FLAG-tagged Pmr FLAG-tagged Pnd B FLAG-tagged Pmr FLAG-tagged Pnd (kda) M FIG S5 Pull-down assays using His-tagged Pmr, Pnd, and Phu, and FLAG-tagged Pmr and Pnd. (A) Tricine-SDS-PAGE profiles of the crude extracts and eluents after pull-down assays. M : the protein marker; 1 : the crude extract of cells expressing FLAG-tagged Pmr; 2, 3, and 4 : eluents after pull-down assays using crude extracts containing FLAG-tagged Pmr with His-tagged Pmr, Phu, and Pnd, respectively; 5 : the crude extract of cells expressing FLAG-tagged Pnd; 6, 7, and 8 : eluents after pull-down assays using crude extracts containing FLAG-tagged Pnd with His-tagged Pmr, Phu, and Pnd, respectively. The bands corresponding to FLAG-tagged Pmr and Pnd in the crude extracts are indicated by arrows in lanes 1 and 5, respectively. (B) Western blotting using anti-flag antibody and the same samples as shown in panel A using Tricine-SDS-PAGE.

10 TABLE S1 List of compounds supplemented as the sole carbon source differentially metabolized between KT2440(pCAR1) and NAP gene disruptants (from analyses using PM1and 2). PM Well Compound d Source KEGG ID KT2440 a KT2440(pCAR1) a KT2440(pCAR1Δpmr ) a KT2440(pCAR1Δpnd ) a KT2440(pCAR1Δphu ) a KT2440(pCAR1Δpmr Δpnd ) a KT2440(pCAR1Δpmr Δphu ) a P(K) b 1 2 P c 1 2 P c 1 2 P c 1 2 P c 1 2 P c PM01 A04 D-Saccharic Acid C-source C PM01 A05 Succinic Acid C-source C PM01 A07 L-Aspartic Acid C-source C PM01 A11 D-Mannose C-source C PM01 B03 Glycerol C-source C PM01 B06 D-Gluconic Acid C-source C PM01 B09 L-Lactic Acid C-source C PM01 B10 Formic Acid C-source C PM01 B12 L-Glutamic Acid C-source C PM01 C03 D,L-Malic Acid C-source C PM01 C07 D-Fructose C-source C PM01 C08 Acetic Acid C-source C PM01 D06 α-keto-glutaric Acid C-source C PM01 E05 Tween 80 C-source C PM01 F05 Fumaric Acid C-source C PM01 F06 Bromo-Succinic Acid C-source PM01 F07 Propionic Acid C-source C PM01 F08 Mucic Acid C-source C PM01 F12 Inosine C-source C PM01 G05 L-Alanine C-source C PM01 G06 L-Alanyl-Glycine C-source PM01 G12 L-Malic Acid C-source C PM02A B11 D-Fucose C-source C PM02A D11 d-amino-valeric Acid C-source C PM02A D12 Butyric Acid C-source C PM02A E02 Caproic Acid C-source C PM02A E07 4-Hydroxy-Benzoic Acid C-source C PM02A E08 β-hydroxy-butyric Acid C-source C PM02A E12 5-Keto-D-Gluconic Acid C-source C PM02A F06 Quinic Acid C-source C PM02A G10 L-Leucine C-source C PM02A H01 L-Ornithine C-source C PM02A H03 L-Pyroglutamic Acid C-source C PM02A H08 Putrescine C-source C a Values denote the cellular respiration of each strain. Two independent analyses were performed with each strain for one compound. b The number of times the differences of the respiration values between pcar1-containing and pcar1-free strains is over 7,000 (7). The upward (green) and downward (red) arrows indicate an increase or decrease, respectively, of respiration activity by pcar1 carriage. c The number of times the differences in respiratory values between each NAP gene disruption strain and KT2440(pCAR1) were over 7,000. The upward (green) and downward (red) arrows indicate increased or decreased respiratory activity, respectively, by gene disruption. d The compounds described in the text are shown in bold.

11 TABLE S2 List of compounds supplemented as the sole nitrogen source differentially metabolized between KT2440(pCAR1) and NAP gene disruptants (from analyses using PM3). PM Well Compound Source KEGG ID KT2440 a KT2440(pCAR1) a KT2440(pCAR1Δpmr ) a KT2440(pCAR1Δpnd ) a KT2440(pCAR1Δphu ) a KT2440(pCAR1Δpmr Δpnd ) a KT2440(pCAR1Δpmr Δphu ) a P(K) b 1 2 P c 1 2 P c 1 2 P c 1 2 P c 1 2 PM03B A03 Nitrite N-source C PM03B A09 L-Asparagine N-source C PM03B A12 L-Glutamic Acid N-source C PM03B B04 L-Isoleucine N-source C PM03B C01 L-Tyrosine N-source C PM03B C09 D-Valine N-source C PM03B D01 N-Acetyl-D,L-Glutamic Acid N-source C PM03B D03 L-Pyroglutamic Acid N-source C PM03B D07 N-Butylamine N-source PM03B D09 Ethanolamine N-source C PM03B D11 Putrescine N-source C PM03B D12 Agmatine N-source C PM03B E02 β-phenylethylamine N-source C PM03B E12 N-Acetyl-D-Galactosamine N-source C PM03B F02 Adenine N-source C PM03B F12 Inosine N-source C PM03B G01 Xanthine N-source C PM03B G03 Uric Acid N-source C PM03B G12 α-amino-n-valeric Acid N-source C PM03B H11 Gly-Met N-source a Values denote the cellular respiration of each strain. Two independent analyses were performed with each strain for one compound. b The number of times the differences of the respiration values between pcar1-containing and pcar1-free strains is over 7,000 (7). The upward (green) and downward (red) arrows indicate an increase or decrease, respectively, of respiration activity by pcar1 carriage. c The number of times the differences in respiratory values between each NAP gene disruption strain and KT2440(pCAR1) were over 7,000. The upward (green) and downward (red) arrows indicate increased or decreased respiratory activity, respectively, by gene disruption. P c

12 TABLE S3 List of compounds supplemented as the sole phosphate source differentially metabolized between KT2440(pCAR1) and NAP gene disruptants (from analyses using PM4). PM Well Compound Source KEGG ID KT2440 a KT2440(pCAR1) a KT2440(pCAR1Δpmr ) a KT2440(pCAR1Δpnd ) a KT2440(pCAR1Δphu ) a KT2440(pCAR1Δpmr Δpnd ) a KT2440(pCAR1Δpmr Δphu ) a P(K) b 1 2 P c 1 2 P c 1 2 P c 1 2 P c 1 2 PM04A A05 Tripolyphosphate P-source C PM04A A08 Adenosine- 2'-Monophosphate P-source C PM04A A09 Adenosine- 3'-Monophosphate P-source C PM04A B01 Thiophosphate P-source PM04A B08 Guanosine-2'-Monophosphate P-source PM04A B09 Guanosine-3'-Monophosphate P-source C PM04A B10 Guanosine-5'-Monophosphate P-source C PM04A C02 Phospho-Glycolic Acid P-source C PM04A C03 D-Glucose-1-Phosphate P-source C PM04A C04 D-Glucose-6-Phosphate P-source C PM04A C05 2-Deoxy-D-Glucose 6-Phosphate P-source C PM04A C06 D-Glucosamine-6-Phosphate P-source C PM04A C08 Cytidine- 2'-Monophosphate P-source C PM04A C09 Cytidine- 3'-Monophosphate P-source C PM04A C10 Cytidine- 5'-Monophosphate P-source C PM04A D01 D-Mannose-1-Phosphate P-source C PM04A D02 D-Mannose-6-Phosphate P-source C PM04A D03 Cysteamine-S-Phosphate P-source PM04A D05 O-Phospho-D-Serine P-source PM04A D06 O-Phospho-L-Serine P-source PM04A D08 Uridine- 2'-Monophosphate P-source C PM04A D09 Uridine- 3'-Monophosphate P-source C PM04A D10 Uridine- 5'-Monophosphate P-source C PM04A E02 O-Phospho-L-Tyrosine P-source C PM04A E03 Phosphocreatine P-source C PM04A E10 Thymidine- 5'-Monophosphate P-source C a Values denote the cellular respiration of each strain. Two independent analyses were performed with each strain for one compound. b The number of times the differences of the respiration values between pcar1-containing and pcar1-free strains is over 7,000 (7). The upward (green) and downward (red) arrows indicate an increase or decrease, respectively, of respiration activity by pcar1 carriage. c The number of times the differences in respiratory values between each NAP gene disruption strain and KT2440(pCAR1) were over 7,000. The upward (green) and downward (red) arrows indicate increased or decreased respiratory activity, respectively, by gene disruption. P c

13 TABLE S4 List of compounds supplemented as the sole sulfur source differentially metabolized between KT2440(pCAR1) and NAP gene disruptants (from analyses using PM4). PM Well Compound Source KEGG ID KT2440 a KT2440(pCAR1) a KT2440(pCAR1Δpmr ) a KT2440(pCAR1Δpnd ) a KT2440(pCAR1Δphu ) a KT2440(pCAR1Δpmr Δpnd ) a KT2440(pCAR1Δpmr Δphu ) a P(K) b 1 2 P c 1 2 P c 1 2 P c 1 2 P c 1 2 PM04A F11 Cysteamine S-source C PM04A G05 Glutathione S-source C PM04A G06 D,L-Ethionine S-source C PM04A H02 Thiourea S-source a Values denote the cellular respiration of each strain. Two independent analyses were performed with each strain for one compound. b The number of times the differences of the respiration values between pcar1-containing and pcar1-free strains is over 7,000 (7). The upward (green) and downward (red) arrows indicate an increase or decrease, respectively, of respiration activity by pcar1 carriage. c The number of times the differences in respiratory values between each NAP gene disruption strain and KT2440(pCAR1) were over 7,000. The upward (green) and downward (red) arrows indicate increased or decreased respiratory activity, respectively, by gene disruption. P c

14 TABLE S5 Osmotic conditions that caused different respiration activities between KT2440(pCAR1) and NAP gene disruptants (PM9). PM Well Compound KT2440 a KT2440(pCAR1) a KT2440(pCAR1Δpmr ) a KT2440(pCAR1Δpnd ) a KT2440(pCAR1Δphu ) a KT2440(pCAR1Δpmr Δpnd ) a KT2440(pCAR1Δpmr Δphu ) a P(K) b 1 2 P c 1 2 P c 1 2 P c 1 2 P c 1 2 PM09 A01 1% NaCl PM09 A02 2% NaCl PM09 A03 3% NaCl PM09 A04 4% NaCl PM09 A05 5% NaCl PM09 A06 5.5% NaCl PM09 A07 6% NaCl PM09 A08 6.5% NaCl PM09 A09 7% NaCl PM09 A10 8% NaCl PM09 A11 9% NaCl PM09 A12 10% NaCl PM09 D01 3% Potassium Chloride PM09 D02 4% Potassium Chloride PM09 D03 5% Potassium Chloride PM09 D04 6% Potassium Chloride PM09 D05 2% Sodium Sulfate PM09 D06 3% Sodium Sulfate PM09 D07 4% Sodium Sulfate PM09 D08 5% Sodium Sulfate PM09 D09 5% Ethylene Glycol PM09 D10 10% Ethylene Glycol PM09 D11 15% Ethylene Glycol PM09 D12 20% Ethylene Glycol PM09 E01 1% Sodium Formate PM09 E02 2% Sodium Formate PM09 E03 3% Sodium Formate PM09 E04 4% Sodium Formate PM09 E05 5% Sodium Formate PM09 E06 6% Sodium Formate PM09 F01 1% Sodium Lactate PM09 F02 2% Sodium Lactate PM09 F03 3% Sodium Lactate PM09 F04 4% Sodium Lactate PM09 F05 5% Sodium Lactate PM09 F06 6% Sodium Lactate PM09 F07 7% Sodium Lactate PM09 F08 8% Sodium Lactate PM09 F09 9% Sodium Lactate PM09 F10 10% Sodium Lactate PM09 F11 11% Sodium Lactate PM09 F12 12% Sodium Lactate PM09 H07 10mM Sodium Nitrite PM09 H08 20mM Sodium Nitrite PM09 H09 40mM Sodium Nitrite PM09 H10 60mM Sodium Nitrite PM09 H11 80mM Sodium Nitrite PM09 H12 100mM Sodium Nitrite a Values denote the cellular respiration of each strain. Two independent analyses were performed with each strain for one compound. b The number of times the differences of the respiration values between pcar1-containing and pcar1-free strains is over 7,000 (7). The upward (green) and downward (red) arrows indicate an increase or decrease, respectively, of respiration activity by pcar1 carriage. c The number of times the differences in respiratory values between each NAP gene disruption strain and KT2440(pCAR1) were over 7,000. The upward (green) and downward (red) arrows indicate increased or decreased respiratory activity, respectively, by gene disruption. P c

15 TABLE S6 ph conditions that caused different respiration activities between KT2440(pCAR1) and NAP gene disruptants (PM10). PM Well ph Condition/Compound KT2440 a KT2440(pCAR1) a KT2440(pCAR1Δpmr ) a KT2440(pCAR1Δpnd ) a KT2440(pCAR1Δphu ) a KT2440(pCAR1Δpmr Δpnd ) a KT2440(pCAR1Δpmr Δphu ) a P(K) b 1 2 P c 1 2 P c 1 2 P c 1 2 P c 1 2 PM10 A01 ph PM10 A02 ph PM10 A03 ph PM10 A04 ph PM10 A05 ph PM10 A06 ph PM10 A07 ph PM10 A08 ph PM10 A09 ph PM10 A10 ph PM10 A11 ph PM10 A12 ph PM10 D03 ph L-Norvaline PM10 D04 ph α- Amino-N-Butyric Acid PM10 D06 ph β-hydroxy Glutamate PM10 D07 ph γ-hydroxy Glutamic Acid PM10 D08 ph Hydroxy-L-Lysine PM10 E01 ph PM10 E02 ph L-Alanine PM10 E03 ph L-Arginine PM10 E04 ph L-Asparagine PM10 E05 ph L-Aspartic Acid PM10 E06 ph L-Glutamic Acid PM10 E07 ph L-Glutamine PM10 E08 ph Glycine PM10 E10 ph L-Isoleucine PM10 E11 ph L-Leucine PM10 E12 ph L-Lysine PM10 F01 ph L-Methionine PM10 F02 ph L-Phenylalanine PM10 F03 ph L-Proline PM10 F04 ph L-Serine PM10 F05 ph L-Threonine PM10 F08 ph L-Valine PM10 F09 ph Hydroxy-L-Proline PM10 F10 ph L-Ornithine PM10 F11 ph L-Homoarginine PM10 F12 ph L-Homoserine PM10 G01 ph Anthranilic Acid PM10 G02 ph L-Norleucine PM10 G03 ph L-Norvaline PM10 G04 ph Agmatine PM10 G06 ph Putrescine PM10 G08 ph Phenylethylamine PM10 G09 ph Tyramine PM10 G10 ph Tryptamine PM10 G12 ph Urea a Values denote the cellular respiration of each strain. Two independent analyses were performed with each strain for one compound. b The number of times the differences of the respiration values between pcar1-containing and pcar1-free strains is over 7,000 (7). The upward (green) and downward (red) arrows indicate an increase or decrease, respectively, of respiration activity by pcar1 carriage. c The number of times the differences in respiratory values between each NAP gene disruption strain and KT2440(pCAR1) were over 7,000. The upward (green) and downward (red) arrows indicate increased or decreased respiratory activity, respectively, by gene disruption. P c

16 TABLE S7 Bacterial strains and plasmids specifically used in the supplemental text. Strain or plasmid Relevant characteristics Source or reference Bacterial strains E. coli B BL21(DE3) F -, ompt, hsds(r - B m - B ), gal, dcm, (DE3) Novagen P. putida KT2440(pCAR1 145::Gm r ) KT2440(pCAR1 146::Gm r ) KT2440(pCAR ::Gm r ) KT2440::Tn KT2440 harboring pcar1 whose ORF145 gene was replaced by Gm r gene KT2440 harboring pcar1 whose ORF146 gene was replaced by Gm r gene KT2440 harboring pcar1 whose ORF145 and ORF146 genes was replaced by Gm r gene KT2440 possessing mini-tn10 carrying BamHI-PstI fragment containing Tc r gene, ORF145 and ORF146 genes on its chromosome KT2440::Tn (pCAR1pmrHis::Gm r ) KT2440::Tn carrying pcar1pmrhis::gm r KT2440::Tn (pCAR1 145::Gm r ) KT2440::Tn carrying pcar1 145::Gm r KT2440::Tn (pCAR1 146::Gm r ) KT2440::Tn carrying pcar1 146::Gm r KT2440::Tn (pCAR ::Gm r ) KT2440::Tn carrying pcar ::Gm r Plasmids pbsl199 Tc r, laci q, tnp (Tn10), mob (RP4), IS10 3

17 pbsl_orf145_146 pbsl199 carrying BamHI-PstI fragment containing ORF145 and ORF146 genes pet-26b(+) Km r, T7 promoter, laci, pbr322 replicon Novagen pet-c-his-pmr pet-26b(+), NdeI-XhoI fragment containing pmr 4 pet-c-his-pnd pet-26b(+), NdeI-XhoI fragment containing pnd pet-c-his-phu pet-26b(+), NdeI-XhoI fragment containing phu pflag-ctc Ap r, laci, tac promoter expressing FLAG-tag Sigma-Aldrich pflagpmr pflag-ctc, NdeI-SalI fragment containing pmr 4 pflagpnd pflagphu pflag-ctc, NdeI-XhoI fragment containing pnd which is ligated into NdeI-SalI site pflag-ctc, NdeI-XhoI fragment containing phu which is ligated into NdeI-SalI site pk18mobsacb Km r, orit (RP4), sacb, laczα, pmb1 replicon 2 pk18mobsacb 145 pk18mobsacb 146 pk18mobsacb pk18mobsacb containing 5'- and 3'-flanking regions of ORF145 and Gm r gene pk18mobsacb containing 5'- and 3'-flanking regions of ORF146 and Gm r gene pk18mobsacb containing 5'-flanking regions of ORF145 and 3'-flanking regions of ORF146, and Gm r gene

18 puc4 puc18 containing 93,142-98,682 region of pcar1 puc18 Ap r, lacz, pmb9 replicon 8

19 TABLE S8 Oligonucleotide primers specifically used in the supplemental text. Primer Sequence (5 3 ) a Reference ORF145_up_F GGATCCAACTTCGCCTGCTCAGTGTT ORF145_up_R TCAGAGCGCTTTTGAAGCTAATTCGTTCTCTTCTCCCTGGCGACG ORF145_down_F AGGAACTTCAAGATCCCCAATTCGCCAGCAATGCGCCCTTCGGGG ORF145_down_R CTGCAGCTGACAGGGCTGTTTCCAAT ORF146_up_F GGATCCCCGTGGTAATCCTGAATGCT ORF146_up_R TCAGAGCGCTTTTGAAGCTAATTCGGGGTACCTCCGTTTGGTTGA ORF146_down_F AGGAACTTCAAGATCCCCAATTCGGCCTCTGGCCTTCTCAACTTC ORF146_down_R CTGCAGGCCCAGTGTCGTACTGTGTG pnd_c_his_f CATATGCCAATACGTCACAT pnd_c_his_r CTCGAGGCCGCGCTTGAGTTG phu_c_his_f CATATGAATCGTCAAGAACT phu_c_his_r CTCGAGCTGGTTGACGCGTTC a Underlined nucleotides represent artificial restriction sites.