Molecular biology and biochemistry of archaeal DNA replication
|
|
|
- Helena Payne
- 5 years ago
- Views:
Transcription
1 Molecular biology and biochemistry of archaeal DNA replication Isaac Cann Institute for Universal Biology, NASA Astrobiology Institute Department of Animal Science & Department of Microbiology University of Illinois at Urbana-Champaign Urbana, IL 61801, USA
2 Objectives To identify proteins that are unique and essential to DNA replication in methanogens, and to block their biological activity to reduce or inhibit methanogenesis in ruminants.
3 An unrooted phylogenetic tree of life Bacteria Archaea Eukarya Haloarcula marismortui Methanococcoides burtonii Methanopyrus kandleri Ferroplasma acidarmanus Based on: Woese et al Proc Natl Acad Sci USA. 87:4576
4 Initiation and processive DNA synthesis steps in replication Function Archaea Eukarya Bacteria Origin recognition ORC1/Cdc6 ORC1-6 DnaA Helicase MCM-like (1) MCM2-7 DnaB ssdna-binding RPA-like (1) RPA(3) SSB Primer synthesis Euk-like primase Pola-primase DnaG Clamp PCNA PCNA Pol-III b-subunit Clamp loader RFC (1 or 2) RFC (5) Pol-III g-complex DNA synthesis PolB, PolD Pold, Pole Pol-III Cann & Ishino 1999: Genetics 152:1249
5 Initiation of DNA replication in the 3 domains of life Kelman & Kelman Molecular Microbiology. 48:
6 The architecture of the origin of DNA replication in the archaeon M. acetivorans Mth-ORB8 Msm-ORB1 Msm-ORB2 Msm-ORB3 Sso-ORB1 Sso-ORB2 Sso-ORB3 Mac-ORB Mma-ORB Mba-ORB TTGAAAGGGTTTACACTTGAAATGGATGTCT ATAATTAATAATACACTTGAAACAATACATG AAGCTTTCAATAGTAGCTGAAACAATATGTT TTTCTGCTTACTAAATAGGAAACTGCCTGTC ACCTTAAGTTCTCCAGTGGAAACAAAGGGGT ATTAATAATTTTCCAAACGAAACAATGGGGT ATTAAGTAATTTCCAGAGGAAATAGATGGGT TAAAATACTATTCCAGTGGAAACAAAGGGGT CAAATAACTGTTCCAGTGGAAACAAAGGGGT TATAAATCTTTTCCAGTGGAAATACAGGGGT Mth: Methanothermobacter thermautotrophicus Msm: Methanobrevibacter smithii Sso: Sulfolobus solfataricus Mac: Methanosarcina acetivorans Mma: Methanosarcina mazei Mba: Methanosarcina barkeri orc1/cdc6-1 M. acetivorans M. mazei M. barkeri (genomes) orc1/cdc6-2
7 Tetracycline-regulation of gene expression in Methanosarcina acetivorans Upstream PmcrB tetr Tetracycline repressor gene PmcrB (teto) Target gene Chromosome Expression of tetracycline repressor Tetracycline repressor + tetracycline - tetracycline teto Target gene Transcriptional activation teto Target gene Transcriptional repression
8 Suppression of cdc6-1 expression inhibits proliferation of M. acetivorans cells Cdc6-1 Cdc6-2
9 Alignment of putative origin recognition proteins in methanogenic archaea
10 Expression and purification of M. acetivorans putative origin binding protein
11 M. acetivorans Cdc6-1 specifically binds to the putative origin of replication Fl-Mac 5 fluorophore-tatttaaggtaaaatactattccagtggaaacaaaggggtc ATAAATTCCATTTTATGATAAGGTCACCTTTGTTTCCCCAC-5 Dissociation constants and Hill coefficients of Cdc6-1 determined by FPA DNA substrate Kd (nm) Hill coefficient Origin-like DNA 62.9 ± ± 0.1 Origin-like DNA + competitor DNA 53.7 ± ± 0.1 The dissociation constants and Hill coefficients for interaction of M. acetivorans ORC/Cdc6-1 with a 41 bp DNA corresponding to an origin-recognition-like sequence in M. acetivorans. The data values are means of six replicate experiments ± standard error of the mean. Where the competitor DNA was added, it was at 100x molar excess.
12 Polyclonal antibodies of the origin recognition proteins do not cross-react Cdc6 proteins Western blots Anti-Cdc6-1 Anti-Cdc6-2
13 Expression of cdc6-1 is blocked in the absence of tetracycline anti-cdc6-1 anti-cdc6-1 DAPI anti-cdc6-1 anti-cdc6-1 DAPI 5 mm 5 mm
14 DNA synthesis is reduced in cells lacking Cdc6-1 5 mm
15 Cell proliferation, substrate utilization and methane production by wild type and cdc6-1 mutant cells OD 600nm OD 600nm Wild-type Wt Time (h) cdc6-1 Cdc61 +tet +Tet Time (h) Trimethylamine (mm) Trimethylamine (mm) Methane (mmoles/ml) Methane (mmoles/ml) OD 600 nm OD 600nm Wt +Tet Wild-type +tet Time (h) cdc6-1 Cdc6-1 Time (h) Trimethylamine (mm) Trimethylamine (mm) Methane (mmoles/ml) Methane (mmoles/ml)
16 Scanning electron micrograph of wild-type and cdc6-1 mutant after 96 hr of culturing
17 Auto-fluorescence, Differential Interference Contrast (DIC) microscopy and cell size of M. acetivorans cells 555 nm 555 nm
18 Disruption of protein-protein interface in RPA abolishes biological function MacRPA3 A B Zn: Cx 2 Cx 8 Cx 2 H MkaRPA3 A B Zn: Cx 2 Cx 8 Cx 2 H
19 Protein-protein interface in ORC1 model
20 CONCLUSIONS Our genetic system allows us to identify DNA replication proteins that are essential for proliferation of methanogens. Inhibition of the origin recognition protein (Cdc6-1) leads to cell expansion and death of Methanosarcina acetivorans cells. The gene for Cdc6-1 is highly conserved in methanogens. Screening for molecules that block the biological activity of the origin recognition protein should reduce or inhibit methanogenesis in the rumen.
21 Acknowledgements Cann & Mackie Lab Li-Jung Lin Jaigeeth Deveryshetty Kingsley Boateng Yuyen Lin Michael Iakiviak Satish Nair Lab (UIUC) Brian Bae Metcalf Lab (UIUC) Gargi Kulkarni Standley Lab, Osaka University) Taehon Kim Funding NASA Astrobiology Institute National Science Foundation
22 Thank you
23 Fluorescence Polarization Anisotropy (FPA) for determination of binding constants Low Anisotropy Polarized Excitation Light Free DNA Small molecule Rapid rotation High Anisotropy DNA/Protein Complex Big molecule Slower rotation :DNA :Protein :Fluorescence Dye
Review Article Diversity of the DNA Replication System in the Archaea Domain
Archaea, Article ID 675946, 15 pages http://dx.doi.org/10.1155/2014/675946 Review Article Diversity of the DNA Replication System in the Archaea Domain Felipe Sarmiento, 1 Feng Long, 1 Isaac Cann, 2 and
16 The Cell Cycle. Chapter Outline The Eukaryotic Cell Cycle Regulators of Cell Cycle Progression The Events of M Phase Meiosis and Fertilization
The Cell Cycle 16 The Cell Cycle Chapter Outline The Eukaryotic Cell Cycle Regulators of Cell Cycle Progression The Events of M Phase Meiosis and Fertilization Introduction Self-reproduction is perhaps
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary
GENOME-WIDE SURVEY OF GENE FUNCTIONALITY FOR THE METHANOGENIC ARCHAEON METHANOCOCCUS MARIPALUDIS. Felipe Andres Sarmiento Boban
GENOME-WIDE SURVEY OF GENE FUNCTIONALITY FOR THE METHANOGENIC ARCHAEON METHANOCOCCUS MARIPALUDIS by Felipe Andres Sarmiento Boban (Under the Direction of William B. Whitman) ABSTRACT Methanogens are obligately
Chapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
Bacterial strains, plasmids, and growth conditions. Bacterial strains and
I Text I Materials and Methods acterial strains, plasmids, and growth conditions. acterial strains and plasmids used in this study are listed in I Table. almonella enterica serovar Typhimurium strains
Introduction. Gene expression is the combined process of :
1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression
Lecture 4: Transcription networks basic concepts
Lecture 4: Transcription networks basic concepts - Activators and repressors - Input functions; Logic input functions; Multidimensional input functions - Dynamics and response time 2.1 Introduction The
REVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E
REVIEW SESSION Wednesday, September 15 5:30 PM SHANTZ 242 E Gene Regulation Gene Regulation Gene expression can be turned on, turned off, turned up or turned down! For example, as test time approaches,
Affinity Purification of an Archaeal DNA Replication Protein Network
RESEARCH ARTICLE Affinity Purification of an Archaeal DNA Replication Protein Network Zhuo Li, a Thomas J. Santangelo, b L ubomíra Čuboňová, b John N. Reeve, b and Zvi Kelman a Institute for Bioscience
Initiation of DNA Replication Lecture 3! Linda Bloom! Office: ARB R3-165! phone: !
Initiation of DNA Replication Lecture 3! Linda Bloom! Office: ARB R3-165! email: lbloom@ufl.edu! phone: 392-8708! 1! Lecture 3 Outline! Students will learn! Basic techniques for visualizing replicating
Gene regulation I Biochemistry 302. Bob Kelm February 25, 2005
Gene regulation I Biochemistry 302 Bob Kelm February 25, 2005 Principles of gene regulation (cellular versus molecular level) Extracellular signals Chemical (e.g. hormones, growth factors) Environmental
INTERACTIVE CLUSTERING FOR EXPLORATION OF GENOMIC DATA
INTERACTIVE CLUSTERING FOR EXPLORATION OF GENOMIC DATA XIUFENG WAN xw6@cs.msstate.edu Department of Computer Science Box 9637 JOHN A. BOYLE jab@ra.msstate.edu Department of Biochemistry and Molecular Biology
7.06 Problem Set #4, Spring 2005
7.06 Problem Set #4, Spring 2005 1. You re doing a mutant hunt in S. cerevisiae (budding yeast), looking for temperaturesensitive mutants that are defective in the cell cycle. You discover a mutant strain
Transcription initiation of stress (heat-shock) genes in archaea
Transcription initiation of stress (heat-shock) genes in archaea A.J.L. Macario, E. Conway de Macario Wadsworth Center, New York State Department of Health; and Department of Biomedical Sciences, The University
REQUIREMENTS FOR THE BIOCHEMISTRY MAJOR
REQUIREMENTS FOR THE BIOCHEMISTRY MAJOR Grade Requirement: All courses required for the Biochemistry major (CH, MATH, PHYS, BI courses) must be graded and passed with a grade of C- or better. Core Chemistry
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA
An Archaeal Chromosomal Autonomously Replicating Sequence Element from an Extreme Halophile, Halobacterium sp. Strain NRC-1
JOURNAL OF BACTERIOLOGY, Oct. 2003, p. 5959 5966 Vol. 185, No. 20 0021-9193/03/$08.00 0 DOI: 10.1128/JB.185.20.5959 5966.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. An
Molecular Biology of the Cell
Alberts Johnson Lewis Morgan Raff Roberts Walter Molecular Biology of the Cell Sixth Edition Chapter 6 (pp. 333-368) How Cells Read the Genome: From DNA to Protein Copyright Garland Science 2015 Genetic
REQUIREMENTS FOR THE BIOCHEMISTRY MAJOR
REQUIREMENTS FOR THE BIOCHEMISTRY MAJOR Grade Requirement: All courses required for the Biochemistry major (CH, MATH, PHYS, BI courses) must be graded and passed with a grade of C- or better. Core Chemistry
RNA Synthesis and Processing
RNA Synthesis and Processing Introduction Regulation of gene expression allows cells to adapt to environmental changes and is responsible for the distinct activities of the differentiated cell types that
How the host sees and responds to pathogens
How the host sees and responds to pathogens David A. Relman, Stanford University IOM Forum on Microbial Threats March 17, 2005 Issues Pathogens and commensals: conserved patterns and pathways Sources of
MICROBIOLOGIA GENERALE. The Archaea
MICROBIOLOGIA GENERALE The Archaea The Archaea s traits 1. The cell wall of Archaea: pseudopeptidoglycan, polysaccharide, glycoprotein 2. The cytoplasmic membrane of Archaea: ether linkage, glycerol
something about srna in archaea
something about srna in archaea or: Processed Small RNAs in Archaea and BHB Elements Sarah Berkemer Bioinformatics Vienzig Archaea? Sarah Berkemer (Bioinformatics Vienzig) BHB elements in Archaea 2 / 23
APGRU6L2. Control of Prokaryotic (Bacterial) Genes
APGRU6L2 Control of Prokaryotic (Bacterial) Genes 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP u if they have enough of a product, need to stop production
Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
Initiation of translation in eukaryotic cells:connecting the head and tail
Initiation of translation in eukaryotic cells:connecting the head and tail GCCRCCAUGG 1: Multiple initiation factors with distinct biochemical roles (linking, tethering, recruiting, and scanning) 2: 5
Prokaryotic Gene Expression (Learning Objectives)
Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control
Fitness constraints on horizontal gene transfer
Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:
Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example
A synthetic oscillatory network of transcriptional regulators
A synthetic oscillatory network of transcriptional regulators Michael B. Elowitz & Stanislas Leibler, Nature, 403, 2000 igem Team Heidelberg 2008 Journal Club Andreas Kühne Introduction Networks of interacting
Lecture 10: Cyclins, cyclin kinases and cell division
Chem*3560 Lecture 10: Cyclins, cyclin kinases and cell division The eukaryotic cell cycle Actively growing mammalian cells divide roughly every 24 hours, and follow a precise sequence of events know as
Basic Synthetic Biology circuits
Basic Synthetic Biology circuits Note: these practices were obtained from the Computer Modelling Practicals lecture by Vincent Rouilly and Geoff Baldwin at Imperial College s course of Introduction to
Bi 1x Spring 2014: LacI Titration
Bi 1x Spring 2014: LacI Titration 1 Overview In this experiment, you will measure the effect of various mutated LacI repressor ribosome binding sites in an E. coli cell by measuring the expression of a
Biological Pathways Representation by Petri Nets and extension
Biological Pathways Representation by and extensions December 6, 2006 Biological Pathways Representation by and extension 1 The cell Pathways 2 Definitions 3 4 Biological Pathways Representation by and
Warm-Up. Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22)
Warm-Up Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22) Yesterday s Picture The first cell on Earth (approx. 3.5 billion years ago) was simple and prokaryotic,
Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
Grade Level: AP Biology may be taken in grades 11 or 12.
ADVANCEMENT PLACEMENT BIOLOGY COURSE SYLLABUS MRS. ANGELA FARRONATO Grade Level: AP Biology may be taken in grades 11 or 12. Course Overview: This course is designed to cover all of the material included
Lecture 18 June 2 nd, Gene Expression Regulation Mutations
Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase
Name: SBI 4U. Gene Expression Quiz. Overall Expectation:
Gene Expression Quiz Overall Expectation: - Demonstrate an understanding of concepts related to molecular genetics, and how genetic modification is applied in industry and agriculture Specific Expectation(s):
The architecture of transcription elongation A crystal structure explains how transcription factors enhance elongation and pausing
The architecture of transcription elongation A crystal structure explains how transcription factors enhance elongation and pausing By Thomas Fouqueau and Finn Werner The molecular machines that carry out
CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON
PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter
4. Why not make all enzymes all the time (even if not needed)? Enzyme synthesis uses a lot of energy.
1 C2005/F2401 '10-- Lecture 15 -- Last Edited: 11/02/10 01:58 PM Copyright 2010 Deborah Mowshowitz and Lawrence Chasin Department of Biological Sciences Columbia University New York, NY. Handouts: 15A
the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)
Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic
Measuring TF-DNA interactions
Measuring TF-DNA interactions How is Biological Complexity Achieved? Mediated by Transcription Factors (TFs) 2 Regulation of Gene Expression by Transcription Factors TF trans-acting factors TF TF TF TF
CHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
Bacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
REGULATION OF GENE EXPRESSION. Bacterial Genetics Lac and Trp Operon
REGULATION OF GENE EXPRESSION Bacterial Genetics Lac and Trp Operon Levels of Metabolic Control The amount of cellular products can be controlled by regulating: Enzyme activity: alters protein function
From Gene to Protein
From Gene to Protein Gene Expression Process by which DNA directs the synthesis of a protein 2 stages transcription translation All organisms One gene one protein 1. Transcription of DNA Gene Composed
Division Ave. High School AP Biology
Control of Prokaryotic (Bacterial) Genes 20072008 Bacterial metabolism n Bacteria need to respond quickly to changes in their environment u if they have enough of a product, need to stop production n why?
Genetic transcription and regulation
Genetic transcription and regulation Central dogma of biology DNA codes for DNA DNA codes for RNA RNA codes for proteins not surprisingly, many points for regulation of the process DNA codes for DNA replication
Insertion Sequence Diversity in Archaea
MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS, Mar. 2007, p. 121 157 Vol. 71, No. 1 1092-2172/07/$08.00 0 doi:10.1128/mmbr.00031-06 Copyright 2007, American Society for Microbiology. All Rights Reserved.
Introduction to Bioinformatics
CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics
Macromolecular assemblies in DNAassociated
Macromolecular assemblies in DNAassociated functions DNA structures: Chromatin (nucleosome) Replication complexes: Initiation, progression Transcription complexes: Initiation, splicing, progression Voet
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Detailed overview of the primer-free full-length SSU rrna library preparation.
Supplementary Figure 1 Detailed overview of the primer-free full-length SSU rrna library preparation. Detailed overview of the primer-free full-length SSU rrna library preparation. Supplementary Figure
3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.
3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of
Functional Genomics Research Stream. Lecture: May 5, 2009 The Road to Publication
Functional Genomics Research Stream Lecture: May 5, 2009 The Road to Publication Final Lab Issues Lab Hours this Week: Wednesday 10 AM - 6 PM Thursday 10 AM - 6 PM One Hour Required (sign in, sign out)
Bi 8 Lecture 11. Quantitative aspects of transcription factor binding and gene regulatory circuit design. Ellen Rothenberg 9 February 2016
Bi 8 Lecture 11 Quantitative aspects of transcription factor binding and gene regulatory circuit design Ellen Rothenberg 9 February 2016 Major take-home messages from λ phage system that apply to many
Biology 112 Practice Midterm Questions
Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,
Principles of Genetics
Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics
Flow of Genetic Information
presents Flow of Genetic Information A Montagud E Navarro P Fernández de Córdoba JF Urchueguía Elements Nucleic acid DNA RNA building block structure & organization genome building block types Amino acid
Lecture Series 1. and Molecular Biology 205
Lecture Series 1 Introduction to Cellular and Molecular Biology 205 Reading Assignments Read Chapter 1 Review Chapter 2 (I am assuming you know this stuff!) A. Evolutionary Milestones A major theme in
Eukaryotic Gene Expression
Eukaryotic Gene Expression Lectures 22-23 Several Features Distinguish Eukaryotic Processes From Mechanisms in Bacteria 123 Eukaryotic Gene Expression Several Features Distinguish Eukaryotic Processes
DNA Technology, Bacteria, Virus and Meiosis Test REVIEW
Be prepared to turn in a completed test review before your test. In addition to the questions below you should be able to make and analyze a plasmid map. Prokaryotic Gene Regulation 1. What is meant by
2. Mathematical descriptions. (i) the master equation (ii) Langevin theory. 3. Single cell measurements
1. Why stochastic?. Mathematical descriptions (i) the master equation (ii) Langevin theory 3. Single cell measurements 4. Consequences Any chemical reaction is stochastic. k P d φ dp dt = k d P deterministic
Whole-genome based Archaea phylogeny and taxonomy: A composition vector approach
Article SPECIAL TOPIC Bioinformatics August 2010 Vol.55 No.22: 2323 2328 doi: 10.1007/s11434-010-3008-8 Whole-genome based Archaea phylogeny and taxonomy: A composition vector approach SUN JianDong 1*,
Computational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
Plant Molecular and Cellular Biology Lecture 8: Mechanisms of Cell Cycle Control and DNA Synthesis Gary Peter
Plant Molecular and Cellular Biology Lecture 8: Mechanisms of Cell Cycle Control and DNA Synthesis Gary Peter 9/10/2008 1 Learning Objectives Explain why a cell cycle was selected for during evolution
Chapter 16 Lecture. Concepts Of Genetics. Tenth Edition. Regulation of Gene Expression in Prokaryotes
Chapter 16 Lecture Concepts Of Genetics Tenth Edition Regulation of Gene Expression in Prokaryotes Chapter Contents 16.1 Prokaryotes Regulate Gene Expression in Response to Environmental Conditions 16.2
3 RFC1-like clamps (Ctf18, Elg1 and Rad24) have nonessential and overlapping functions as seen by the increased sensitivity to DNA damage or slowed
3 RFC1-like clamps (Ctf18, Elg1 and Rad24) have nonessential and overlapping functions as seen by the increased sensitivity to DNA damage or slowed replication Initiation of Replication http://www.orst.edu/instruction/bb492/figletters/figh3.gif
Control of Cyclic Chromosome Replication in Escherichia coli
MICROBIOLOGICAL REVIEWS, Sept. 1991, p. 459-475 Vol. 55, No. 3 0146-0749/91/030459-17$02.00/0 Copyright X) 1991, American Society for Microbiology Control of Cyclic Chromosome Replication in Escherichia
Written Exam 15 December Course name: Introduction to Systems Biology Course no
Technical University of Denmark Written Exam 15 December 2008 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open book exam Provide your answers and calculations on separate
Comparing Prokaryotic and Eukaryotic Cells
A prokaryotic cell Basic unit of living organisms is the cell; the smallest unit capable of life. Features found in all cells: Ribosomes Cell Membrane Genetic Material Cytoplasm ATP Energy External Stimuli
Genetic transcription and regulation
Genetic transcription and regulation Central dogma of biology DNA codes for DNA DNA codes for RNA RNA codes for proteins not surprisingly, many points for regulation of the process https://www.youtube.com/
I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes.
I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes. A. Chemistry of Life B. Cells 1. Water How do the unique chemical
Translation Part 2 of Protein Synthesis
Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation
AST 205. Lecture 20. November 26, Assignments for week of Dec 1
AST 205. Lecture 20. November 26, 2003 The Evolution of Advanced/Multicellular Organisms Context The Three Domains of Life The Tree of Life and Biodiversity on Earth Evolution as the origin of diversity
Topic 4: Equilibrium binding and chemical kinetics
Topic 4: Equilibrium binding and chemical kinetics Outline: Applications, applications, applications use Boltzmann to look at receptor-ligand binding use Boltzmann to look at PolII-DNA binding and gene
Bioinformatics: Network Analysis
Bioinformatics: Network Analysis Kinetics of Gene Regulation COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 The simplest model of gene expression involves only two steps: the
Topic 4 - #14 The Lactose Operon
Topic 4 - #14 The Lactose Operon The Lactose Operon The lactose operon is an operon which is responsible for the transport and metabolism of the sugar lactose in E. coli. - Lactose is one of many organic
Dynamic optimisation identifies optimal programs for pathway regulation in prokaryotes. - Supplementary Information -
Dynamic optimisation identifies optimal programs for pathway regulation in prokaryotes - Supplementary Information - Martin Bartl a, Martin Kötzing a,b, Stefan Schuster c, Pu Li a, Christoph Kaleta b a
Classification Cladistics & The Three Domains of Life. Biology Mrs. Flannery
Classification Cladistics & The Three Domains of Life Biology Mrs. Flannery Finding Order in Diversity Earth is over 4.5 billion years old. Life on Earth appeared approximately 3.5 billion years ago and
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Purification of yeast CKM. (a) Silver-stained SDS-PAGE analysis of CKM purified through a TAP-tag engineered into the Cdk8 C-terminus. (b) Kinase activity
Holding it together: chromatin in the Archaea
Review Holding it together: chromatin in the Archaea 621 Malcolm F. White and Stephen D. Bell Recently, several advances have been made in the understanding of the form and function of archaeal chromatin.
Chapter 19. Microbial Taxonomy
Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/345/ra91/dc1 Supplementary Materials for TGF-β induced epithelial-to-mesenchymal transition proceeds through stepwise activation of multiple feedback loops Jingyu
Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2.
Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice. Percentage of marginal zone B cells in the spleen of wild-type mice (+/+), mice homozygous for cpm or pri
Translation - Prokaryotes
1 Translation - Prokaryotes Shine-Dalgarno (SD) Sequence rrna 3 -GAUACCAUCCUCCUUA-5 mrna...ggagg..(5-7bp)...aug Influences: Secondary structure!! SD and AUG in unstructured region Start AUG 91% GUG 8 UUG
ydci GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC
Table S1. DNA primers used in this study. Name ydci P1ydcIkd3 Sequence GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC Kd3ydcIp2 lacz fusion YdcIendP1 YdcItrgP2 GAC AGC
Microscopy, Staining, and Classification
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 4 Microscopy, Staining, and Classification Microscopy Light Microscopy 1) Bright-field
Mestrado em Microbiologia Aplicada. FRM Fisiologia e Regulação Microbiana. IFRM Introdução à Fisiologia e Regulação Microbiana. Ano Lectivo 2017/2018
Mestrado em Microbiologia Aplicada FRM Fisiologia e Regulação Microbiana IFRM Introdução à Fisiologia e Regulação Microbiana Ano Lectivo 2017/2018 Program FRM /IFRM- Fisiologia e Regulação Microbiana 1.
The Research Plan. Functional Genomics Research Stream. Transcription Factors. Tuning In Is A Good Idea
Functional Genomics Research Stream The Research Plan Tuning In Is A Good Idea Research Meeting: March 23, 2010 The Road to Publication Transcription Factors Protein that binds specific DNA sequences controlling
SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.
THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR
GENETICS - CLUTCH CH.12 GENE REGULATION IN PROKARYOTES.
GEETICS - CLUTCH CH.12 GEE REGULATIO I PROKARYOTES!! www.clutchprep.com GEETICS - CLUTCH CH.12 GEE REGULATIO I PROKARYOTES COCEPT: LAC OPERO An operon is a group of genes with similar functions that are
Chapter 20. Initiation of transcription. Eukaryotic transcription initiation
Chapter 20. Initiation of transcription Eukaryotic transcription initiation 2003. 5.22 Prokaryotic vs eukaryotic Bacteria = one RNA polymerase Eukaryotes have three RNA polymerases (I, II, and III) in
AP Biology Essential Knowledge Cards BIG IDEA 1
AP Biology Essential Knowledge Cards BIG IDEA 1 Essential knowledge 1.A.1: Natural selection is a major mechanism of evolution. Essential knowledge 1.A.4: Biological evolution is supported by scientific
Multiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
Hiromi Nishida. 1. Introduction. 2. Materials and Methods
Evolutionary Biology Volume 212, Article ID 342482, 5 pages doi:1.1155/212/342482 Research Article Comparative Analyses of Base Compositions, DNA Sizes, and Dinucleotide Frequency Profiles in Archaeal
Unit 3: Control and regulation Higher Biology
Unit 3: Control and regulation Higher Biology To study the roles that genes play in the control of growth and development of organisms To be able to Give some examples of features which are controlled
PACING GUIDE ADVANCED PLACEMENT BIOLOGY
PACING GUIDE ADVANCED PLACEMENT BIOLOGY BIG IDEAS: 1: The process of evolution drives the diversity and unity of life. 2: Biological systems utilize free energy and molecular building blocks to grow, to