RNA Polymerase Pausing Regulates Translation Initiation by Providing Additional Time for TRAP-RNA Interaction

Transcription

1 Molecular Cell 24, , November 17, 2006 ª2006 Elsevier Inc. DOI /j.molcel RNA Polymerase Pausing Regulates Translation Initiation by Providing Additional Time for TRAP-RNA Interaction Alexander V. Yakhnin, 1 Helen Yakhnin, 1 and Paul Babitzke 1, * 1 Department of Biochemistry and Molecular Biology The Pennsylvania State University University Park, Pennsylvania Summary RNA polymerase (RNAP) pause sites have been identified in several prokaryotic genes. Although the presumed biological function of RNAP pausing is to allow synchronization of RNAP position with regulatory factor binding and/or RNA folding, a direct causal link between pausing and changes in gene expression has been difficult to establish. RNAP pauses at two sites in the Bacillus subtilis trpedcfba operon leader. Pausing at U107 and U144 participates in transcription attenuation and trpe translation control mechanisms, respectively. Substitution of U144 caused a substantial pausing defect in vitro and in vivo. These mutations led to increased trp operon expression that was suppressed by overproduction of TRAP, indicating that pausing at U144 provides additional time for TRAP to bind to the nascent transcript and promote formation of an RNA structure that blocks translation of trpe. These results establish that pausing is capable of playing a role in regulating translation in bacteria. Introduction Several regulatory mechanisms have been identified in bacteria that allow the organism to control the rate of transcription elongation in response to environmental changes. As transcription proceeds, the nascent transcript may fold into specific secondary structures that signal the transcribing polymerase to pause or to terminate transcription before reaching the structural genes (Gollnick and Babitzke, 2002; Henkin and Yanofsky, 2002). A central feature of several transcription attenuation mechanisms is that formation of an antiterminator structure prevents formation of a mutually exclusive intrinsic terminator hairpin, thereby promoting transcription readthrough into the structural genes. Regulatory molecules that interact with the nascent transcript, such as translating ribosomes (Winkler and Yanofsky, 1981), RNA binding proteins (Yakhnin and Babitzke, 2002; Zhang et al., 2005), trna (Grundy and Henkin, 2004), or metabolites (Mironov et al., 2002; Winkler et al., 2002), have been shown to be responsible for the decision as to which of the mutually exclusive structures form. Because the regulatory molecule must bind to the nascent transcript before the terminator structure forms, a relatively short window of opportunity exists for this interaction to take place. Thus, synchronization of RNAP position with the binding of regulatory factors is crucial in attenuation mechanisms. *Correspondence: pxb28@psu.edu The rate of transcription by RNAP is not constant as transcription elongation is punctuated by RNAP pausing in vitro (Landick, 1997; Mooney et al., 1998). It is generally assumed that the role of RNAP pausing is to allow synchronization of RNAP position with the binding of regulatory factors and/or RNA folding. Three general classes of RNAP pause sites have been described: promoter proximal, hairpin dependent, and hairpin independent (Kainz and Roberts, 1995; Artsimovitch and Landick, 2000a; Landick, 2004). RNAP pause sites have been identified in the untranslated leaders of the E. coli trp (Winkler and Yanofsky, 1981), his (Mooney et al., 1998), tna (Gong and Yanofsky, 2003), and S10 (Sha et al., 1995) operons, the bacteriophage lambda late transcript (Marr and Roberts, 2000), and the B. subtilis pyr (Zhang et al., 2005), glyqs (Grundy and Henkin, 2004), and trp (Yakhnin and Babitzke, 2002) operons. RNAP pausing has been documented for several eukaryotic genes as well; promoter-proximal pausing occurs for several Drosophila heat-shock genes (Rasmussen and Lis, 1993), whereas hairpin-dependent pausing occurs during transcription of HIV (Palangat et al., 1998). Hairpin-dependent RNAP pausing has been studied in considerable detail for the E. coli his and trp pause sites. The his pause signal is multipartite, consisting of a pause hairpin, the residue in the active site (i.e., the 3 0 nt), about 14 bp of the downstream DNA, and the 3 0 proximal region between the base of the hairpin and the 3 0 end of the transcript (Landick, 1997; Mooney et al., 1998). It is also known that the his pause hairpin interaction with the b subunit of RNAP favors pausing by altering the protein conformation such that the RNA 3 0 end and the NTP in the active site are not properly aligned for polymerization. In addition to the signals intrinsic to the nascent transcript, the general elongation factor NusA participates in hairpin-dependent pausing (Landick, 1997; Mooney et al., 1998). NusA enhances pausing by stimulating the basal interaction of pause hairpins with the b subunit of E. coli RNAP (Artsimovitch et al., 2000). The E. coli and Serratia marcescens trp leader pause RNAs that were identified in vivo were identical to those found in vitro (Landick et al., 1987); however, mutations that influence pausing in vitro and gene expression in vivo have not been reported. Mutations leading to in vitro RNAP pausing defects did not appear to influence gene expression of the B. subtilis glyqs (Grundy and Henkin, 2004) or pyr (Zhang et al., 2005) operons in vivo; however, in both cases, new RNAP pause sites arose. In the case of the pyr operon, it is possible that the mutations in the nascent transcript that altered pausing in vitro led to changes in the antiterminator structure, potentially overshadowing the effect of the pause defect in vivo (Zhang et al., 2005). Expression of the B. subtilis trpedcfba operon is regulated in response to tryptophan availability by both transcription attenuation and translation control mechanisms (Babitzke, 2004; Gollnick et al., 2005). The B. subtilis trp leader transcript is capable of forming RNA secondary structures involved in the transcription attenuation mechanism (Figure 1, top). An

2 Molecular Cell 548 Figure 1. Models of B. subtilis trp Operon Transcription Attenuation and trpe Translation Control Transcription attenuation model (top). During transcription, RNAP pauses after synthesis of U107. Under tryptophan-limiting conditions, TRAP is not activated and does not bind to trp leader RNA. RNAP eventually overcomes the pause and resumes transcription. In this case, formation of the antiterminator structure prevents formation of the terminator hairpin, resulting in transcription readthrough. Under tryptophan-excess conditions, tryptophan-activated TRAP binds to the (G/U)AG repeats, thereby releasing paused RNAP and simultaneously preventing formation of the antiterminator structure. As a consequence, formation of the terminator hairpin causes transcription to terminate at G140 or U141. Because termination is never 100% efficient, a fraction of RNAP molecules will not terminate in the leader despite the presence of bound TRAP. trpe translation control model (bottom). During transcription of trp operon readthrough transcripts, RNAP pauses after synthesis of U144. Under tryptophan-limiting conditions, TRAP is unable to bind to the nascent trp leader transcript. RNAP eventually overcomes the pause and resumes transcription. In this case, the RNA adopts a structure such that the trpe SD sequence is single stranded and available for ribosome binding. Under tryptophan-excess conditions TRAP can bind to the transcript paused at U144. RNAP eventually overcomes the pause and resumes transcription, which leads to formation of the trpe SD sequestering hairpin and inhibition of translation. antiterminator structure can form just upstream from an intrinsic terminator. Because these two structures overlap by four nucleotides, their formation is mutually exclusive. When activated by tryptophan, the 11 subunit trp RNA binding attenuation protein (TRAP) binds to 11 (G/U)AG repeats present in the nascent trp leader transcript, thereby preventing formation of the antiterminator. Thus, TRAP binding promotes formation of the overlapping intrinsic terminator hairpin, and transcription halts in the trp leader region. In limiting tryptophan growth conditions, TRAP is not activated and does not bind to the trp transcript. Under these conditions, the antiterminator forms and transcription proceeds into the trp operon structural genes (Figure 1, top). In addition to regulating transcription of the trp operon, TRAP regulates translation of trpe. When TRAP binds to a trp operon readthrough transcript, the RNA adopts a structure in which the trpe Shine-Dalgarno (SD) sequence is sequestered in a hairpin. In the absence of bound TRAP, the trp leader transcript adopts a large secondary structure in which the trpe SD sequence is single stranded and available for ribosome binding (Figure 1, bottom). Hairpin-dependent RNAP pause sites were recently identified in the B. subtilis trp leader at U107 and U144. NusA stimulates pausing at both of these sites in vitro (Yakhnin and Babitzke, 2002). Pausing at U107, the nucleotide just preceding the critical overlap between the antiterminator and terminator structures, is thought to provide additional time for TRAP to bind and promote termination (Figure 1, top). In contrast, because U144 is downstream of the site of termination in

3 RNAP Pausing Regulates Translation of trpe 549 Figure 2. The Identity of the 3 0 Nucleotide Is Critical for B. subtilis RNAP Pausing In Vitro Single-round in vitro transcription reactions were performed with WT and mutant trp leaders in the absence or presence of NusA. Gel slices of the region surrounding residues 144 (top) and 107 (bottom) are shown. Transcription reactions were stopped at the times indicated above each lane (seconds). Reactions corresponding to chase were extended for an additional 10 min in the presence of 500 mm of each NTP. Lanes marked with M correspond to an A (top) or G (bottom) RNA sequencing ladder. the trp leader (G140 and U141), pausing at U144 participates in the trpe translation control mechanism (Yakhnin and Babitzke, 2002). Importantly, the U rich region of trp leader RNA surrounding U144 is unstructured (Figure 1, bottom). This feature provided a unique opportunity to examine the role of pausing in gene regulation by substitution of U144 without causing undesired alterations of RNA secondary structures that participate in the regulatory mechanism. The data presented herein demonstrate that RNAP pausing at U144 is necessary for proper regulation of the trp operon. RNAP was found to pause at U144 in vitro and in vivo. Mutations in the trp leader that caused a pausing defect in vitro and in vivo led to elevated expression of the trp operon in vivo. Our results establish that RNAP pausing at U144 provides additional time for TRAP to bind to the nascent trp leader transcript and promote formation of the trpe SD sequestering hairpin, resulting in more effective control of trpe translation. Results The Identity of the 3 0 Nucleotide in the Active Site Is Critical for B. subtilis RNAP Pausing In Vitro The hairpin-dependent pause site in the E. coli his operon leader region has been the subject of intensive study (Landick, 1997; Mooney et al., 1998; Artsimovitch and Landick, 2000a; Artsimovitch et al., 2000; Toulokhonov and Landick, 2003). This multipartite pause signal consists of a short RNA hairpin, the nucleotide at the 3 0 end of the paused transcript within the active site of RNAP, the 3 0 proximal region between the base of the hairpin and the 3 0 end of the transcript, and a short region of the downstream DNA sequence. Like the E. coli his pause site, the U107 and U144 pause sites in the B. subtilis trp operon leader region were found to be hairpin dependent (Yakhnin and Babitzke, 2002). Because RNA species corresponding to pause complexes initially increase in abundance and subsequently chase to become longer transcripts, paused species are readily distinguished from terminated transcripts that cannot be extended. To determine whether the identity of the nucleotide at the 3 0 end of the paused transcript within the active site of RNAP was a component of the B. subtilis pause signal, positions U107 and U144 were changed to A, C, or G. The mutations at 107 did not influence pausing at 144 and vise versa (data not shown), indicating that these two pause events are independent from one another. Mutations at these positions resulted in a substantial reduction of both basal and NusA-stimulated pausing, with changes to purines having the most pronounced effects (Figure 2 and Table 1). NusA led to a 3-fold increase in the pause half-life at U107. NusA stimulated pausing with the U107A and U107C mutant templates; however, pausing was virtually absent with the U107G template in the absence or presence of NusA (Figure 2). In the case of U144, the presence of NusA led to a 6-fold increase in the pause half-life (Figure 2 and Table 1). Whereas the U144C substitution resulted in a relatively small pause defect in vitro, the U144A and U144G mutations led to substantial reductions in pause efficiencies and modestly reduced pause half-lives. These results indicate that the identity of the 3 0 nucleotide in the active site plays an important role in pause site selection by B. subtilis RNAP and that the pause-promoting capacity among all four bases was in the order U > C > A > G.

4 Molecular Cell 550 Table 1. Influence of trp Leader Mutations on RNAP Pausing Pause Site a Mutation NusA (mm) t 1/2 (s) b Efficiency (%) c 107 WT WT U107A U107C U107G WT U144A U144C U144G WT U144A U144C U144G a RNAP pause sites in the B. subtilis trp leader. b Half-lives of the pause complexes. Values are the averages of at least three independent experiments 6 standard deviation. c The efficiency of RNAP pausing. Values are the averages of at least three independent experiments 6 standard deviation. Identification of the U107 and U144 Paused Transcription Bubbles In Vitro Elongating RNAP maintains a transcription bubble containing a short DNA-RNA hybrid and a single-stranded segment of the nontemplate DNA strand. The singlestranded thymine residues within the transcription bubble are sensitive to oxidation by KMnO 4. Thus, transcription bubbles associated with paused RNAP can be mapped by permanganate footprinting (Kainz and Roberts, 1995; Marr and Roberts, 2000). Permanganate footprinting of the nontemplate DNA strand of paused transcription bubbles was carried out in vitro by performing single-round transcription reactions (Figure 3A). Every T residue in the trp leader was modified to a limited extent, thus providing a T ladder background. Modification of A, C, or G residues was not observed. The single-stranded T residues preceding the 107 and 144 pause sites were particularly susceptible to permanganate oxidation (Figure 3A, WT). In each case, the T residues positioned 5 10 nt upstream from the pause sites were more reactive than the pause site-proximal T residues. This observation, together with the high fraction of T residues in the nontemplate DNA strand, allowed us to estimate the minimum size of each transcription bubble. Because T98 and T134 were substantially more reactive than the neighboring T96 and T133, the upstream border of each transcription bubble was located w11 bases upstream from the 3 0 nucleotide in the active site. Assuming that the downstream edge of the transcription bubble is at least one base after the RNA 3 0 end, the minimum size of the transcription bubble is 12 nt. During the time course of the experiment, the intensity of the footprint corresponding to the U107 paused transcription bubble gradually decreased as the paused transcripts were extended by RNAP. In the case of the U144 paused transcription bubble, the intensity of the modified T residues initially increased and then gradually decreased (Figure 3A, WT). Because RNAP first pauses at U107, the initial increase of the U144 pause signal reflects the longer time that it takes RNAP to reach position 144. The rates of band disappearance are consistent with the half-lives determined for both pause sites in the presence of a saturating concentration of NusA (Table 1). Importantly, the point mutations at 107 and 144 caused a substantial pausing defect (Figure 3A), consistent with our previous in vitro transcription results (Figure 2). These results also confirm that the pausing events at positions 107 and 144 are independent from one another, although the 107 mutations resulted in Figure 3. In Vitro Permanganate Footprints of WT and Mutant trp Leader Transcription Bubbles (A) Single-round in vitro transcription reactions were performed with WT and mutant DNA templates in the presence of 1 mm NusA. KMnO 4 was added at the times indicated above each lane (seconds). Reactions corresponding to chase (Ch) were extended for an additional 5 min in the presence of 500 mm of each NTP before the addition of KMnO 4. Positions of selected T residues are shown. (B) Reactions were carried out as for (A) except that 1 mm GreA was added where indicated.

5 RNAP Pausing Regulates Translation of trpe 551 Figure 4. In Vivo Permanganate Footprints of WT and Mutant trp Leader Transcription Bubbles (A) Primer extension reactions were carried out on WT or mutant plasmid DNA purified from KMnO 4 -treated WT (mtrb + ) or TRAPdeficient (DmtrB) B. subtilis cells. trp leader mutations and a mock-treated DNA control (2KMnO 4 ) are indicated above each lane. Positions of T107, T142, and T144 are marked. (B) RNAP pause half-life determination in vivo. Cells were harvested at the times indicated above each lane (min) after rifampicin addition. Primer extension reactions were carried out on WT plasmid DNA purified from KMnO 4 -treated DmtrB cells. (C) Primer extension reactions were carried out on WT or mutant plasmid DNA purified from KMnO 4 -treated DmtrB cells. Cells also contained the DgreA allele where indicated. RNAP reaching the 144 pause position more quickly. Taken together, our in vitro results establish that the identity of the nucleotide in the active site plays a critical role in trp leader pause site selection by B. subtilis RNAP. Similar in vitro results were also obtained for the B. subtilis pyr operon (Zhang et al., 2005). Identification of the U144 Paused Transcription Bubble In Vivo Permanganate footprinting was used to examine Q- mediated P R 0 promoter-proximal transcription pausing of bacteriophage lambda in E. coli cells (Kainz and Roberts, 1995). The in vivo-modified bases were identified by primer extension with DNA polymerase using DNA templates purified from permanganate-treated bacteria. Using this method, we identified the transcription bubble associated with RNAP paused at position 144 of the trp leader in growing B. subtilis cells (Figure 4A). Interestingly, the profile of the in vivo permanganate footprint differed from the footprint observed in vitro. The most heavily modified residues in vitro were T134 and T135 (Figure 3A). These bases produced only weak signals near background levels in vivo. Instead, every residue between nucleotides 141 and 146 was modified in vivo, with T144 being the most reactive base (Figure 4A). In contrast to the in vivo results, no reactivity of A143 and A145 was observed in vitro (Figure 3A). Although T residues are preferentially modified by permanganate, footprints of A residues have been observed previously (Sasse-Dwight and Gralla, 1989). The half-life of permanganate reactivity of T144 and T142 was and s,

6 Molecular Cell 552 respectively (Figure 4B). Thus, the in vivo half-life of the U144 pause is w23 s. The finding that the permanganate reactivity disappeared with first-order kinetics confirms that the reactivity in the vicinity of U144 was associated with paused RNAP (Figure 4B). The T144A and T144G substitutions had profound effects on the pattern of the in vivo permanganate footprint (Figure 4A). Both of these mutations reduced the signals from residues to background levels while intensifying the signals from T141 and T142. The T144G substitution resulted in a stronger effect than the T144A substitution, which paralleled the relative effects of these mutations on pausing in vitro. Similar footprints were obtained in TRAP-deficient (DmtrB) strains (Figure 4A), confirming that TRAP binding does not influence RNAP pausing at U144 (Yakhnin and Babitzke, 2002). The in vivo permanganate footprint pattern of the T144C mutant was similar to the T144A and T144G footprints (data not shown). One potential explanation for the different permanganate footprint patterns observed in vitro and in vivo was due to differences in the dominant translocation state of RNAP at the U144 pause site. It was possible that RNAP backtracked at the U144 pause site in vitro, creating more upstream reactivity. Because the E. coli Gre factors (GreA and GreB) are known to stimulate RNAPmediated cleavage of backtracked RNA (Mooney et al., 1998; Marr and Roberts, 2000), we tested whether GreA of B. subtilis was responsible for the observed differences in the in vitro and in vivo footprints. Note that B. subtilis does not contain GreB. Purified GreA did not affect the in vitro permanganate footprint pattern of RNAP paused at U107 or U144 in the absence or presence of NusA (Figure 3B and data not shown). We next tested whether a grea null allele altered the permanganate footprint pattern of RNAP paused at U144 in vivo. The absence of GreA did not alter the footprint pattern of the wild-type (WT) or T144G mutant trp leaders (Figure 4C), indicating that GreA does not significantly affect the translocation state of B. subtilis RNAP at the U144 pause site. The U107A and U107G mutations did not qualitatively alter the in vivo permanganate footprint of the U144 pause site; however, the 107 substitutions resulted in a reduction in the intensity of the pause at 144 (Figure 4A). As U107 participates in formation of the antiterminator (Figure 1, top), any substitution at 107 is predicted to weaken the antiterminator and promote termination, thereby reducing the number of RNAP molecules that reach U144. The finding that both of these substitutions at 107 led to a 50% increase in the basal (TRAP-independent) termination efficiency in vitro is consistent with this interpretation (data not shown). No obvious footprint was observed in vivo that corresponded to RNAP pausing at U107 (Figure 4A), suggesting that pausing at this position is short lived in vivo. To provide further evidence that the in vivo permanganate footprints are caused by RNAP paused at U144, S1 nuclease mapping experiments were carried out on total cellular RNA to identify the 3 0 end of the paused RNA (Figure 5). Several bands were identified between U135 and A145. The band at U144 is indicative of paused RNAP. Because a low concentration of S1 nuclease was used to minimize digestion of the weak ru:da hybrid Figure 5. S1-Nuclease Mapping of the 3 0 End of the U144 Paused RNA Total cellular RNA purified from DmtrB cells was hybridized with a labeled DNA probe and subsequently treated with S1 nuclease (lane S1). A control reaction with probe only (no RNA) is shown. Selected residues are marked. Lanes corresponding to Maxim and Gilbert sequencing reactions of the probe used in this analysis are indicated. formed between the pause transcripts and the ssdna probe, the signal at A145 is likely due to incomplete digestion of a single unpaired nucleotide in the probe. The band at G140 corresponds to transcripts terminated at the trp leader terminator (Figure 5). The bands between U139 and U135 probably arose from limited S1-nuclease digestion of the weak ru:da hybrid formed between the terminated transcripts and the probe (Figure 1, top). Pausing at U144 Is Essential for Proper Regulation of the trp Operon In Vivo The U144 RNAP pause site in the B. subtilis trp leader differs from other known bacterial pause sites. First, because the U144 pause site is located downstream of the transcription terminator, pausing at this position would participate in the trpe translation control mechanism rather than in transcription attenuation. Second, U144 is located in a single-stranded segment of the leader RNA; U144 does not participate in the formation of any secondary structure known to play a role in regulating expression of the trp operon. Thus, the U144 pause site provided a rare opportunity to examine the influence of RNAP pausing on regulating gene expression.

7 RNAP Pausing Regulates Translation of trpe 553 Table 2. Effect of RNAP Pausing at U144 on trpe 0-0 lacz Expression and lacz mrna Half-Life Relevant b-galactosidase Activity a Inhibition Ratio mrna Half-Life (min) Genotype Plasmid b 2Trp +Trp (2Trp:+Trp) 2Trp +Trp WT None U144A None U144C None ND c ND U144G None DmtrB None ND U144A DmtrB None ND U144C DmtrB None ND ND U144G DmtrB None ND WT Vector WT mtrab U144A Vector U144A mtrab U144C Vector ND ND U144C mtrab ND ND U144G Vector U144G mtrab DgreA None ND ND DgreA DmtrB None ND ND a b-galactosidase activity is given in Miller units 6 standard deviation. b Vector phy300plk was used to construct the TRAP-overexpressing plasmid psi45 (mtrab). c ND, not determined. trp operon expression was measured by using trpe 0-0 lacz translational fusions integrated into the amye locus of the B. subtilis chromosome. TRAP-mediated regulation of a WT trp leader fusion was compared with those giving rise to the U144A, U144C, and U144G mutant transcripts. Each of these mutations led to elevated expression in the absence and presence of exogenously added tryptophan (Table 2). In the absence of tryptophan, expression from the mutant fusions increased 5- to 10-fold. Similarly, in the presence of exogenously added tryptophan, expression from the mutant fusions increased 10- to 18-fold. Although the increase in expression for the U144A and U144G mutants correlated with the severity of their pausing defects in vitro, the U144C mutation only had a modest reduction in pause half-life in vitro (Figure 2 and Table 1). The reason for this difference between the in vitro and in vivo results is not known. The effect of exogenous tryptophan from each fusion was assessed from the ratio of expression when cells were grown in the absence or presence of tryptophan (2Trp:+Trp inhibition ratio). Although the level of inhibition of the U144A mutant was similar to WT, inhibition of the U144C and U144G mutants was reduced 2- and 4- fold, respectively. To ascertain whether the change in expression was due to altered mrna stability of the mutant fusions, we determined the mrna half-lives from the WT, as well as the U144A and U144G mutant strains when grown in the absence and presence of tryptophan. An increase in the lacz mrna half-life of less than 2-fold was observed in the two mutant strains (Table 2). Because the increase in expression for these mutants was far greater than 2-fold, our results indicate that the RNAP pausing defect observed in vitro (Figures 2 and 3A) and in vivo (Figure 4A) caused elevated expression of the trp operon. Expression from the WT and mutant fusions was also examined in a DmtrB (TRAP-deficient) genetic background (Table 2). Expression from each fusion was elevated in the absence of TRAP and did not respond to tryptophan, as expected. However, we did not anticipate that expression from the mutant fusions would be higher than that from the WT fusion. Interestingly, the 3- to 5-fold increase in expression from the mutant fusions correlated with a 3- to 4-fold increase in message stability (Table 2). To determine whether RNAP pausing at U144 participated in a TRAP-dependent regulatory pathway, the effect of TRAP overproduction on expression from the WT and three mutant fusions was examined (Table 2). When TRAP was expressed from a multicopy plasmid carrying the mtrab operon, expression from all four fusions decreased slightly when grown in the absence of tryptophan. When cells were grown in the presence of exogenously added tryptophan, expression from the WT fusion decreased 4-fold. Importantly, when strains containing the mutant fusions were grown in the presence of tryptophan, overproduction of TRAP suppressed the expression defects associated with reduced RNAP pausing. mrna half-life experiments were carried out to determine whether suppression of the pausing defect by overproduced TRAP was related to message stability (Table 2). Overproduction of TRAP led to a slight stabilization of the fusion transcript containing the U144A mutation. Importantly, in no case did the stability of the message decrease when TRAP was overproduced, indicating that the observed reduction in expression caused by TRAP overproduction was not due to reduced mrna stability of the fusion transcripts (Table 2). Taken together, our results establish that RNAP pausing at U144 is required for proper regulation of the B. subtilis trp operon and that pausing at this position participates in a TRAP-dependent regulatory mechanism. As described above, the distinct footprint patterns of RNAP paused at U144 in vitro and in vivo could not be attributed to GreA (Figures 3B and 4C). Expression studies were carried out to determine whether grea

8 Molecular Cell 554 influenced expression of the trp operon. Expression of the trpe 0-0 lacz fusion was not affected by the absence of GreA when grown in the absence of tryptophan, although expression was somewhat lower when cells were grown in the presence of exogenous tryptophan (Table 2, compare WT and DgreA). Furthermore, expression in the DgreA DmtrB strain was indistinguishable from expression in the DmtrB single-mutant strain (Table 2). Thus, it appears that GreA has only a minor affect on expression of the trp operon and little or no affect on RNAP pausing at U144. Discussion RNAP Pausing Plays a Role in Regulating Expression of the trp Operon Since the first report of RNAP pausing (Winkler and Yanofsky, 1981), numerous studies have established that RNAP pausing occurs during transcription of several prokaryotic genes in vitro. In some instances, evidence for RNAP pausing has been obtained in vivo (Landick et al., 1987; Marr and Roberts, 2000). The role of RNAP pausing is generally thought to allow synchronization of RNAP position with the binding of regulatory factors (e.g., NusA, Q protein, and trna) and/or RNA folding. Although several elegant in vitro studies have provided a detailed mechanistic model for various intrinsic and extrinsic signals that participate in RNAP pausing (Landick, 1997; Mooney et al., 1998; Artsimovitch and Landick, 2000a; Marr and Roberts, 2000; Toulokhonov and Landick, 2003), verification of the role of hairpindependent pausing in controlling gene expression has remained elusive. Because RNAP pausing is a common feature of transcription attenuation mechanisms that involve overlapping pause, antiterminator, and terminator structures, the ability to demonstrate a causal relationship between pausing and gene regulation through genetic means has been confounded since mutations that diminish pausing in vitro typically led to undesired alterations in RNA structures that participate in the attenuation process (e.g., Zhang et al., [2005]). Indeed, the fact that all possible mutations at position 107 of the B. subtilis trp leader lead to destabilization of the antiterminator structure prevented us from testing whether pausing at this position participates in the attenuation mechanism in vivo. In contrast to U107, the U144 pause site in the B. subtilis trp leader region is not involved in the transcription attenuation mechanism, as this position is just downstream of G140 and U141, the two transcription termination positions in the trp leader region (Figure 1, top). Instead, it seemed likely that pausing at U144 would be capable of participating in the trpe translation control mechanism (Yakhnin and Babitzke, 2002). Moreover, because U144 does not participate in the formation of any RNA secondary structure involved in the attenuation or translation control mechanisms (Figure 1), changes in this position allowed us to directly test whether RNAP pausing at this position participated in regulating expression of the trp operon in vivo. Changing U144 to A, C, or G resulted in a pausing defect in vitro, with purine substitutions having the most pronounced effect (Figures 2 and 3A and data not shown). Furthermore, each of these mutations led to a similar alteration in the in vivo footprint of the paused RNAP transcription bubble (Figure 4A). Moreover, each of the U144 substitutions resulted in a substantial increase in expression of a trpe 0-0 lacz translational fusion (Table 2). These results demonstrate that RNAP pausing at U144 participates in regulating expression of the B. subtilis trp operon. The finding that overexpression of mtrb (TRAP) was capable of suppressing the defect caused by reduced pausing (Table 2) indicates that pausing at U144 participates in the TRAP-dependent trpe translation control mechanism by providing additional time for TRAP to bind to the nascent trp leader transcript and promote formation of the trpe SD sequestering hairpin (Figure 1, bottom). Differences were observed between the in vitro and in vivo footprints of the U144 (T144) paused transcription bubbles. Other than the expected absence of T144, the only obvious difference from the in vitro footprint of the WT trp leader was a shorter pause half-life for the mutants (Figure 3A). The finding that the footprint profile differed in vitro and in vivo (Figures 3A and 4A) suggested that the dominant translocation state of RNAP differed; the upstream permanganate reactivity can be indicative of backtracked RNAP. Although the GreA and GreB factors of E. coli are known to influence the translocation state of RNAP at pause and arrest sites (Mooney et al., 1998), GreA, the only B. subtilis Gre factor, did not influence the translocation state of RNAP at the U144 pause site (Figures 3B and 4C) and only had a small effect on expression of the trp operon (Table 2). The previous finding that the hairpin-dependent his pause site of E. coli was resistant to GreA-stimulated transcript cleavage led to the suggestion that backtracking may not occur in hairpin-stabilized paused transcription complexes (Artsimovitch and Landick, 2000b). Thus, backtracking might be limited at hairpindependent pause sites in general. Although crystallographic studies of RNAP transcription elongation complexes have not been able to define the size of the transcription bubble (Armache et al., 2005), our in vitro permanganate footprint suggests that the size of the U144 paused transcription bubble is w12 nt (Figure 3). Perhaps the in vivo U144 pause complex contains an additional factor(s) that shields the transcription bubble from permanganate. The in vivo footprint profiles of the WT and mutant templates also differed from one another (Figure 4A). Perhaps the U144 mutations resulted in a new pause site in vivo that was not observed in vitro; however, if the new pause site exists, it did not restore WT-like regulation in vivo. Model for the Role of RNAP Pausing in the B. subtilis trp Operon Once transcription of the B. subtilis trp operon initiates, RNAP continues to transcribe until it synthesizes U107, the nucleotide just preceding the critical 4 nt overlap between the mutually exclusive antiterminator and terminator structures (Figure 1, top). At this point, RNAP recognizes a hairpin-dependent pause signal and transcription halts transiently with NusA stimulating this pausing event (Yakhnin and Babitzke, 2002). NusA of E. coli is known to interact with the nascent transcript and stabilize the basal interaction of pause hairpins with the b flap domain of RNAP (Toulokhonov and

9 RNAP Pausing Regulates Translation of trpe 555 Landick, 2003). Thus, it is assumed that NusA performs a similar function in B. subtilis. TRAP is activated by tryptophan when a sufficient concentration of this amino acid accumulates in the cell. A likely explanation for why RNAP pausing occurs at U107 is to provide additional time for a limiting concentration of tryptophan-activated TRAP to bind to the nascent trp leader transcript before the antiterminator structure forms. Because 6 of the 11 (G/U)AG repeats that constitute the TRAP binding site are contained within the antiterminator, bound TRAP prevents formation of this structure. Once bound, TRAP disrupts the pause complex and RNAP resumes transcription. As transcription proceeds, the terminator hairpin forms and transcription terminates at G140 or U141 in the trp leader region. Because transcription termination is never 100% efficient, a fraction of RNAP molecules will transcribe the trp operon structural genes despite the presence of bound TRAP. In these instances, the TRAP-bound readthrough transcript will be subject to translation control. Under limiting tryptophan conditions, TRAP does not bind to trp leader RNA. In this case, RNAP eventually resumes transcription, the antiterminator forms, and RNAP transcribes past the terminator. The delicate balance between transcription readthrough and termination in the trp leader, and therefore the level of trp operon expression, is further modulated by the amount of anti-trap in the cell because this protein antagonizes the ability of tryptophan-activated TRAP to bind RNA (Valbuzzi et al., 2002; Yang and Yanofsky, 2005). In addition to the transcription attenuation mechanism, TRAP plays a central role in regulating translation of trpe (Du and Babitzke, 1998). TRAP binding to a trp operon readthrough transcript promotes formation of an RNA structure that sequesters the trpe SD sequence (Figure 1, bottom). Formation of this structure inhibits ribosome binding and TrpE synthesis. In the absence of bound TRAP, a portion of the TRAP binding site (antianti-sd sequence) base pairs with the anti-sd sequence such that the SD sequence is available for ribosome binding. RNAP pausing at U144 allows additional time for a limiting concentration of tryptophan-activated TRAP to bind to the nascent transcript, thereby promoting formation of the trpe SD sequestering hairpin such that translation initiation is inhibited. The finding that TRAP overproduction suppresses the pause defect caused by the U144 mutations supports this model (Table 2). Because TRAP binding does not influence pausing at U144, RNAP eventually resumes transcription whether or not TRAP is bound to the transcript. In situations where TRAP is bound, the trpe SD sequestering hairpin will form as soon as this region of the leader is transcribed. Alternatively, in the absence of bound TRAP, continued transcription will lead to formation of the anti-anti-sd-containing structure such that the trpe SD sequence is single stranded and available for ribosome binding. Eventually, either by synthesis or transport, a sufficient level of tryptophan could build up to activate TRAP. Tryptophan-activated TRAP would then be capable of binding to the trp leader and promote RNA refolding and formation of the trpe SD sequestering hairpin. Although TRAP can bind to trp leader transcripts containing the entire leader in vitro (Du and Babitzke, 1998), it is likely that TRAP binds preferentially to the shorter paused transcripts in vivo because it is known that RNA secondary structure inhibits TRAP binding (Gollnick et al., 2005). Finally, although RNAP pausing at U144 provides additional time for TRAP binding, it is also possible that pausing at this position promotes formation of the translation-proficient structure in situations where TRAP does not bind to the nascent transcript. Whether this is the case remains to be determined, although it is important to point out that these two possibilities are not mutually exclusive. Experimental Procedures Plasmids and Bacterial Strains Plasmid pay62 contains the B. subtilis trp promoter and leader region (2113 to +206 relative to the start of transcription) cloned into the E. coli-b. subtilis shuttle vector phy300plk (Merino et al., 1995). pay62 derivatives containing T107A, T107C, T107G, T144G, T144A, or T144C trp leader mutations were generated according to the QuikChange protocol (Stratagene). Each of these plasmids was introduced into B. subtilis strains PLBS338 (prototrophic) and PLBS470 (DmtrB) (Yakhnin et al., 2004). The resulting strains were used for in vivo permanganate footprinting. The T144G, T144A, or T144C trp leader mutations were also introduced into trpe 0-0 lacz translational fusions and subsequently integrated into the amye locus of the B. subtilis chromosome as described (Yakhnin et al., 2004). Strains lacking functional TRAP protein were generated by transforming recipient strains with chromosomal DNA from strain BG4233 (DmtrB) (Hoffman and Gollnick, 1995). Plasmid psi45 containing the B. subtilis mtrab operon (Gollnick et al., 1990) was used to create TRAP-overproducing B. subtilis strains. grea is located between the udk and yrrr genes on the B. subtilis chromosome. A grea knockout cassette was constructed in plasmid pqe30 (Qiagen). The tetracycline resistance (Tet R ) gene from phy300plk was inserted between the complete udk and yrrr coding sequences on the plasmid. The resulting plasmid (pay73) was linearized and subsequently used to transform preexisting B. subtilis strains. Proper allelic replacement was confirmed by PCR amplification of chromosomal DNA. b-galactosidase Assays B. subtilis was cultured in minimal-acid casein hydrolysate (ACH) medium in the absence or presence of 200 mm tryptophan. Growth medium for TRAP-overproducing strains contained tetracycline (15 mg/ml). Cells were harvested during late exponential phase and assayed for b-galactosidase activity as described (Du and Babitzke, 1998). DNA Templates and Proteins The untranslated leader of the B. subtilis trp operon was found to contain a cryptic promoter that interfered with our initial in vitro transcription analysis (data not shown). To avoid problems associated with transcription initiation from two promoters in vitro, all templates for in vitro transcription were obtained by PCR amplification of the untranslated leader region of the B. subtilis trp operon (21 to +175 relative to the natural start of transcription). The upstream primer 5 0 CAGCTTGACAAATACACAAGAGTGTGTTATAATGCAATTAGAA TG 3 0 was designed such that the cryptic promoter was converted into a consensus promoter with an extended 210 region. This synthetic promoter directed transcription initiation from residue +37 in the trp leader region. His-tagged B. subtilis NusA protein was overproduced and purified as described (Yakhnin and Babitzke, 2002). B. subtilis s A RNAP was purified from strain MH5636 as described (Qi and Hulett, 1998) with an additional purification step of chromatography on HiTrap Heparin HP (Amersham). grea and a downstream intrinsic transcription terminator were PCR amplified from the B. subtilis chromosome. The grea coding sequence was fused in frame with the N-terminal His 6 tag in a pqe80l-derived vector (Qiagen). His-tagged B. subtilis GreA protein was purified on Ni-NTA agarose (Qiagen) according to the manufacturer s protocol.

10 Molecular Cell 556 In Vitro Transcription Single-round in vitro transcription reactions and data analysis were performed as described previously (Yakhnin and Babitzke, 2002) except that transcription was initiated from the synthetic consensus promoter (see above). Stable transcription-elongation complexes containing a 29 nt long transcript were formed in a reaction containing ATP and UTP (10 mm each), 2 mm GTP, and 2 mci [a- 32 P]GTP. Transcription elongation was halted after nucleotide 65 of the trp leader due to the absence of CTP. Elongation was resumed by the addition of all four NTPs together with heparin. The final concentrations were 150 mm of CTP, GTP, and UTP, 10 mm of ATP, and 100 mg/ml of heparin. NusA was added to a final concentration of 1 mm when used. Aliquots of the elongation reaction were removed at various times. The last aliquot was chased for an additional 5 min at 37 C with 0.5 mm of each NTP. For the subsequent modification with KMnO 4, transcription reactions were initiated on PCR fragments that were 5 0 end labeled with [g 32 P]ATP on the nontemplate strand. Permanganate Footprinting DNA templates were labeled at the 5 0 end of the nontemplate strand. An equal volume of 4 mm KMnO 4 was added to 3 ml aliquots of in vitro transcription reactions collected at various time points. After incubation for 1 min at 25 C, permanganate-mediated oxidation was stopped by the addition of five volumes of stop/cleavage solution (10 mm EDTA [ph 8.0], 40 mm b-mercaptoethanol, 0.15 mg/ml of calf thymus DNA, and 7% [v/v] piperidine). Modified DNA was cleaved by incubation for 15 min at 90 C. Piperidine was removed by two extractions with seven volumes of N-butanol. The DNA was precipitated and subsequently dissolved in 3 ml of gel loading buffer (95% formamide, 20 mm EDTA [ph 8.0], 0.2% SDS, 0.3 mg/ml bromophenol blue, and 3 mg/ml xylene cyanol). In vivo permanganate footprinting followed a previously published procedure (Marr and Roberts, 2000) with some modifications. Plasmid-containing B. subtilis cultures were grown at 37 C in minimal- ACH medium containing tetracycline (12.5 mg/ml) until late exponential phase. Ten milliliters of each culture was incubated with 1 ml of 110 mm KMnO 4 for 1 min at 37 C. In experiments for determining the in vivo RNAP pause half-life, 50 ml of 20 mg/ml rifampicin was added to 10 ml of cell culture prior to KMnO 4 to block transcription initiation. Cells were incubated with rifampicin for various times at 37 C followed by the addition of KMnO 4 as described above. The KMnO 4 treatment was quenched with 1 ml of stop solution (150 mm EDTA [ph 6.0], 50 mm Tris-Citrate [ph 6.0], 0.5 M NaCl, 1.4 M b-mercaptoethanol, and 7.5% [v/v] glycerol). Cells were pelleted and resuspended in 200 ml of STE buffer (8% sucrose, 50 mm Tris-HCl [ph 8.0], 50 mm EDTA [ph 8.0], and 0.5% Triton X- 100). Lysozyme and RNase A were added to final concentrations of 2 mg/ml and 0.1 mg/ml, respectively, and cell suspensions were incubated for 20 min at 37 C. SDS and proteinase K were then added to final concentrations of 0.5% and 0.1 mg/ml, respectively, and incubation was continued for 1 hr at 37 C. The DNA was then extracted with phenol-chlorophorm (1:1). The aqueous phase was mixed with 250 ml of solution 3 from the StrataPrep Plasmid Miniprep Kit (Stratagene), and the subsequent purification was according to the manufacturer s protocol. Modified bases were mapped by primer extension with sequenase (USB) on plasmid DNA from KMnO 4 -treated cells (Sasse-Dwight and Gralla, 1989), using a primer that annealed to the vector. S1-Nuclease Mapping A PCR fragment corresponding to nt +66 to +265 relative to trp operon transcription was used as a probe for mapping the 3 0 ends of in vivo paused and terminated transcripts. The probe was labeled with [a- 32 P]dGTP and the Klenow enzyme. The labeled probe strand was purified from a denaturing polyacrylamide gel. Total RNA was purified from DmtrB (TRAP-deficient) B. subtilis cells grown in minimal-ach medium. The ssdna probe was hybridized with total RNA by heating for 2 min at 90 C, followed by incubation for 1 hr at 65 C in hybridization buffer (60 mm KCl, 4 mm Tris, 4 mm Tricine, and 0.4 mm EDTA [ph 8.2]). Hybridization reactions were mixed with equal volumes of S1 nuclease dilutions and incubated for 1 hr at 37 C. Reactions were stopped by adding an equal volume of formamide-edta gel loading buffer. The Maxam-Gilbert sequencing ladder was generated from the 3 0 end-labeled probe (Sambrook and Russell, 2001). Acknowledgments The authors thank Anamika Missra for technical assistance, Robert Switzer for sharing data prior to publication, and Tina Henkin for strain MH5636. This work was supported from grant GM52840 from the National Institutes of Health. Received: October 18, 2005 Revised: August 10, 2006 Accepted: September 22, 2006 Published: November 16, 2006 References Armache, K.-J., Kettenberger, H., and Cramer, P. (2005). The dynamic machinery of mrna elongation. Curr. Opin. Struct. Biol. 15, Artsimovitch, I., and Landick, R. (2000a). Pausing by bacterial RNA polymerase is mediated by mechanistically distinct classes of signals. Proc. Natl. Acad. Sci. USA 97, Artsimovitch, I., and Landick, R. (2000b). Interaction of a nascent RNA structure with RNA polymerase is required for hairpin-dependent transcriptional pausing but not for transcript release. Genes Dev. 12, Artsimovitch, I., Svetlov, V., Anthony, L., Burgess, R.R., and Landick, R. (2000). RNA polymerases from Bacillus subtilis and Escherichia coli differ in recognition of regulatory signals in vitro. J. Bacteriol. 182, Babitzke, P. (2004). Regulation of transcription attenuation and translation initiation by allosteric control of an RNA-binding protein: the Bacillus subtilis TRAP protein. Curr. Opin. Microbiol. 7, Du, H., and Babitzke, P. (1998). trp RNA-binding attenuation proteinmediated long distance RNA refolding regulates translation of trpe in Bacillus subtilis. J. Biol. Chem. 273, Gollnick, P., and Babitzke, P. (2002). Transcription attenuation. Biochim. Biophys. Acta 1577, Gollnick, P., Ishino, S., Kuroda, M.I., Henner, D.J., and Yanofsky, C. (1990). The mtr locus is a two-gene operon required for transcription attenuation in the trp operon of Bacillus subtilis. Proc. Natl. Acad. Sci. USA 87, Gollnick, P., Babitzke, P., Antson, A., and Yanofsky, C. (2005). Complexity in Regulation of Tryptophan Biosynthesis in Bacillus subtilis. Annu. Rev. Genet. 39, Gong, F., and Yanofsky, C. (2003). A transcriptional pause synchronizes translation with transcription in the tryptophanase operon leader region. J. Bacteriol. 185, Grundy, F.J., and Henkin, T.M. (2004). Kinetic analysis of trna-directed transcription antitermination of the Bacillus subtilis glyqs gene in vitro. J. Bacteriol. 186, Henkin, T.M., and Yanofsky, C. (2002). Regulation by transcription attenuation in bacteria: how RNA provides instructions for transcription termination/antitermination decisions. Bioessays 24, Hoffman, R.J., and Gollnick, P. (1995). The mtrb gene of Bacillus pumilus encodes a protein with sequence and functional homology to the trp RNA-binding attenuation protein (TRAP) of Bacillus subtilis. J. Bacteriol. 177, Kainz, M., and Roberts, J. (1995). Kinetics of RNA polymerase initiation and pausing at the lambda late gene promoter in vivo. J. Mol. Biol. 254, Landick, R. (1997). RNA polymerase slides home: pause and termination site recognition. Cell 88, Landick, R. (2004). Active-site dynamics in RNA polymerases. Cell 116, Landick, R., Carey, J., and Yanofsky, C. (1987). Detection of transcription-pausing in vivo in the trp operon leader region. Proc. Natl. Acad. Sci. USA 84,