Positions of Trp Codons in the Leader Peptide-Coding Region of the at Operon

Transcription

1 JB Accepts, published online ahead of print on January 0 J. Bacteriol. doi:.1/jb.00-0 Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. 1 Positions of Trp Codons in the Leader Peptide-Coding Region of the at Operon Influences Anti-Trap Synthesis and trp Operon Expression in Bacillus licheniformis Anastasia Levitin 1 and Charles Yanofsky 1* 1 Department of Biology, Stanford University, Stanford, CA 0-00 Running title: B. licheniformis at operon leader peptide Keywords: at operon, leader peptide-trp residue location, AT protein, trp operon expression * Corresponding author. Mailing address: Department of Biology, Stanford University, Stanford, CA 0. Phone: (0) -1. Fax: (0) yanofsky@stanford.edu. Present address: Department of Genetics, Stanford University School of Medicine, Stanford, CA

2 ABSTRACT Tryptophan, phenylalanine, tyrosine and several other metabolites are all synthesized from a common precursor, chorismic acid. Since tryptophan is a product of an energetically expensive biosynthetic pathway, bacteria have developed sensing mechanisms to down-regulate synthesis of the enzymes of tryptophan formation when synthesis of this amino acid is not needed. In Bacillus subtilis, and some other grampositive bacteria, trp operon expression is regulated by two proteins, TRAP (the tryptophan-activated RNA binding protein), and AT (the Anti-TRAP protein). TRAP is activated by bound tryptophan, and AT synthesis is increased upon accumulation of uncharged trna Trp. Tryptophan-activated TRAP binds to trp operon leader RNA, generating a terminator structure that promotes transcription termination. AT binds to tryptophan-activated TRAP, inhibiting its RNA binding ability. In B. subtilis, AT synthesis is up-regulated both transcriptionally and translationally in response to the accumulation of uncharged trna Trp. In this paper we focus on explaining the differences in organization and regulatory functions of the at operon s leader peptide coding region, rtplp, of B. subtilis and B. licheniformis. Our objective was to correlate the greater growth sensitivity of B. licheniformis to tryptophan starvation with the spacing of the three Trp codons in its at operon leader peptide-coding region. Our findings suggest that Trp codon location in rtplp of B. licheniformis is designed to allow a mild charged trna Trp deficiency to expose the Shine/Dalgarno sequence and start codon for the AT protein, leading to increased AT synthesis.

3 INTRODUCTION Bacteria regulate expression of their tryptophan (trp) biosynthetic genes and operons by using various strategies that sense the levels of free tryptophan (Trp) and/or uncharged trna Trp (). Trp is synthesized from chorismic acid, which is also the precursor of phenylalanine, tyrosine, p-aminobenzoic acid (PABA), and several other metabolites (0). Trp biosynthesis involves catalysis by the protein products of seven genes or genetic segments. Many bacilli have all seven trp genes in one operon, and this operon is regulated transcriptionally by an uncharged trna Trp -sensing T-box sequence, or by tandem T-box sequences (, ). In some bacilli, including B. subtilis and B. licheniformis, the trp operon is organized differently. A cluster of six of the seven trp genes, trpedcfba, is located as a trp suboperon, within a larger, aromatic (aro) supraoperon (1). Initiation of transcription of the trp suboperon occurs at two promoters, one at the beginning of the aro supraoperon, and the second preceding trpe of the trp suboperon (0). The seventh trp gene, trpg/paba, specifying a bifunctional protein involved in both Trp and PABA synthesis, is located in the unlinked folate operon (1, 1, ). Expression of trpg/paba is also regulated in response to the availability of Trp (1, ). Prior studies (, 0, 1, ) identified many genes, operons, and regulatory molecules and events, that are involved in Trp biosynthesis and its regulation in B. subtilis (Table 1). These same genes and other cell components appear to be present in B. licheniformis, a closely related bacterium (). However, the aro supraoperon, containing a trp suboperon, is a relatively uncommon organizational strategy in the bacilli () or in

4 other bacteria, and the presence of a regulatory at operon, responding to uncharged trna Trp as a regulatory signal, is even rarer (). Transcription of the trp suboperon of B. subtilis and of B. licheniformis, initiated at either the aro or trp suboperon promoter, is regulated by transcription attenuation (termination) in the region immediately preceding trpe. The principal regulator is the Trp-activated RNA-binding attenuation protein, TRAP (1, 1-1, ). When free Trp is plentiful, and available, it binds to - and activates - TRAP. The TRAP protein contains identical protein subunits, Trp binding sites, and Lys-Lys-Arg motifs on the periphery of the protein complex (,,, ). When activated by Trp, each Lys-Lys- Arg motif is capable of binding to a (G/U)AG repeat in a target transcript, resulting in the RNA being wrapped around TRAP's perimeter (,, ). This prevents formation of an RNA anti-terminator structure, thereby promoting formation of an RNA terminator structure that causes transcription termination (,, ). Activated TRAP also binds to (G/U)AG repeats in mrna segments for other genes, and inhibits initiation of their translation. This occurs in transcripts of the following genes: trpe (1), trpg/paba (1, ), trpp/yhag, a putative Trp import protein (), and ycbk, a putative Trp efflux protein (). The ycbk gene is located within the rtpa-ycbk (at) operon (, ). The rtpa gene encodes the anti-trap protein, AT, that is capable of binding to Trp-activated TRAP at its RNA binding surface (,, ) and preventing TRAP from binding to its target RNA s. Thus, by binding to TRAP, AT can regulate transcription or translation of all the operons regulated by TRAP (, 0). AT synthesis is highly regulated itself, both transcriptionally and translationally, in response to the accumulation of uncharged trna Trp (, ).

5 In a number of bacilli, AT-dependent mechanisms appear to exist for regulating trp operon expression. These include: B. subtilis, B. licheniformis, B. amyliquefaciens, B. mojavensis and B. spizizenii (). Most studies on AT and TRAP synthesis and function have been performed with B. subtilis (1, 1, -1,, ). In this organism, AT synthesis is regulated both transcriptionally and translationally by sensing the accumulation of uncharged trna Trp. Transcription regulation of at mrna synthesis is achieved in one segment of the operon's leader region, by an uncharged trna Trp sensing T-box transcription anti-termination mechanism (, ). In B. subtilis, AT synthesis is also regulated translationally, at a -residue leader peptide coding region, rtplp, located immediately upstream of rtpa, the structural gene for the AT protein. The rtplp-coding region of B. subtilis contains three adjacent Trp codons, and its stop codon is located six nucleotides preceding the rtpa Shine/Dalgarno (SD) sequence (Fig.1) (). Completion of translation of rtplp mrna of B. subtilis inhibits initiation of AT synthesis, presumably by ribosome blockage of the rtpa SD sequence. However, when there is a cellular charged trna Trp deficiency, the ribosome translating rtplp mrna presumably stalls at any one of its three Trp codons, exposing the SD region of rtplp mrna, allowing rtpa mrna translation and AT synthesis (). In B. licheniformis AT synthesis is also regulated transcriptionally by the T-box mechanism, and translationally by rtplp, the at operon's leader peptide coding region. However, in B. licheniformis rtplp is a residue-coding region rather than a residue-coding region, as it is in B. subtilis. In addition, in B. licheniformis the rtplp coding region includes the SD sequence as well as the start codon of rtpa, the structural gene for the AT protein (Fig.1). Most importantly, the three Trp codons of rtplp mrna of B. licheniformis are dispersed throughout this

6 coding region, rather than adjacent to one another as they are in rtplp of B. subtilis. In the studies described in this article we analyze the significance of the different Trp codon locations within the rtplp leader peptide-coding region of B. licheniformis. We focus on explaining the differences in organization and function of this rtplp coding region, relative to rtplp of B. subtilis. Our findings suggest that Trp codon location and other features of the rtplp leader mrna of B. licheniformis are designed to allow this organism to respond predominantly to conditions leading to the accumulation of low levels of uncharged trna Trp. MATERIALS AND METHODS Bacterial strains, plasmids and transformations. The strains used in this study are listed in Table 1: CYBS00 is a B. subtilis prototroph, BlA is a B. licheniformis prototroph, and CYBS1 (CYBS00 (rtpa-ycbk)::sp r ), is a B. subtilis strain lacking its AT coding region and the region encoding the end of the ycbk open reading frame; it does not produce either the AT or YcbK protein. This strain was constructed by replacing a -bp chromosomal segment of the rtpa-ycbk region with a gene conferring spectinomycin resistance (). The plasmid Pat-LR- T-rtpLP-rtpA-ycbK -lacz was used to construct CYBL derivative strains (Table ). It contained a -bp leader region encompassing the rtpa-ycbk promoter, leader region, rtpa ORF, the intergenic region (), and nucleotides of the ycbk coding region followed by the lacz gene. A part of the terminator region was deleted to disrupt terminator function, as described in Sarsero et al. (). Strain CYBL has the B. subtilis rtpa-ycbk promoter with the terminator region deleted (), followed by B. licheniformis rtplr replacing B. subtilis rtplp, followed by B. subtilis rtpa-ycbk -lacz. In other constructs each of the Trp codons of B.

7 licheniformis rtplp in the hybrid plasmid was replaced with an arginine codon (Trp1 Arg or Trp Arg), or with a cysteine codon (Trp Cys), thereby preserving the predicted rtplp RNA secondary structure and the normal location of the rtpa ATG start codon (strains CYBL1, CYBL, and CYBL). A 1-nucleotide spacer ( GAT repeats) introducing repeat UGAs in the coding region, was also inserted at nucleotide position 1 of B. licheniformis rtplp (strain CYBL1 spacer; see Fig. ). Transformations were carried out by using natural competence (1). Gene fusions and cloned DNA fragments were integrated into the chromosomal amye locus by homologous recombination after being introduced into the integration vector p trp BG1- PLK (). Mutant strains were isolated following transformation by selecting for chloramphenicol resistance, and disruption of amye was confirmed by the absence of amylase production by iodine staining (). Growth curves. All strains were grown in Vogel-Bonner minimal medium () supplemented with 0.% glucose, and trace elements, at C (). Where indicated, the following supplements were included: various concentrations of indole acrylic acid, 0 μg/ml phenylalanine, 0 μg/ml tryptophan, 0 μg/ml tyrosine, or 0 μg/ml PABA. Growth rates were determined by measuring cell density using a Klett-Summerson colorimeter equipped with a 0 nm filter. RNA extraction. ml of cultures grown to Klett unit densities were harvested by centrifugation. RNA extraction was performed as described (1). Real-time PCR. cdna synthesis was carried out with a SuperScript III First Strand Synthesis System for RT-PCR from Invitrogen (cat# ) using 1 µg of RNA. 1/th of the total cdna reaction was used for real time PCR analyses. Gene specific

8 primers were designed to amplify 0 nucleotide fragments of target genes (Table ). Each reaction was carried out in a 1 µl volume with 0% of the SYBR green mixture, according to the manufacturer s protocol (BioRad IQ SYBR Green Supermix, cat# - ). Reactions were performed in a MyiQ Single-color Real-Time PCR Detection System (cat# -0) with the following cycling conditions: C for min, C for min, followed by 0 cycles of the following steps: C 1 s, C for 1 s, and C for 0 s, plus min at C as a final step. Expression of each gene analyzed was normalized against rpob gene expression, which served as the internal control (1). Relative mrna levels were subsequently calculated using the - ΔΔCt threshold cycle method (). Western blot analysis. Cells were harvested by centrifugation and resuspended in 00 µl of 0 mm Tris-HCl, ph.0, and 0 mm NaCl. Samples were disrupted by sonic oscillation and cell debris was removed by centrifugation. 00 µl of SDS tris-tricine buffer was added and protein extracts were boiled for min. The Quick start Bradford protein assay (BioRad cat# ) was performed on the final samples and equal amounts of protein were loaded in each lane. Samples were electrophoresed on SDS-1% polyacrylamide gels in tris-tricine buffer and were electrophoretically transferred on the Trans-Blot transfer Medium Nitrocellulose membrane (BioRad cat# -0). Immunoblotting was performed using rabbit polyclonal antibodies against B. subtilis AT prepared by the Covance company and peroxidase conjugated affinity purified anti-rabbit antibodies from Rockland (cat# -0). The bound antibodies were visualized using Super Signal WestPico Chemiluminescent Substrate from ThermoScientific (cat# 0). Their levels were quantitated by the Adobe Photoshop program, version.0.

9 RESULTS Real Time PCR comparisons of transcription of the trp operon and other operons of B. subtilis and B. licheniformis. To compare trp operon sensitivity to Trp starvation in B. subtilis and B. licheniformis we analyzed relevant mrna levels in cultures grown in minimal medium with or without excess Trp and in minimal medium containing different levels of indole acrylic acid (IA), a structural homolog of Trp that is an inhibitor of tryptophanyl-trna synthetase activity (). IA presence reduces trna Trp availability of Trp-tRNA Trp for new protein synthesis. charging, and, therefore, the Gene expression (mrna) levels were related to expression levels for the rpob gene, which served as the internal control (See Materials and Methods). The mrna s analyzed (Table ) were transcribed from the following genes: rtpa, encoding the AT protein (, ), mtrb, encoding the TRAP protein (0, 1), (0, 1), arof, the first gene in the aromatic supraoperon (1, 0), trpe, the first gene of the trp suboperon (1), and trps, the gene encoding tryptophanyl trna synthetase - the enzyme responsible for charging of trna Trp with Trp (). Our RT-PCR analyses show that in B. licheniformis, expression of rtpa and trpe are upregulated in response to IA addition, as they are in B. subtilis. However, most noticeable, B. licheniformis produces substantially higher relative trp operon (trpe) mrna levels than B. subtilis, when grown in the presence of IA (Table ). One possible explanation for this response might be that B. licheniformis may need to produce more of the trp operon enzymes under these conditions, if it is to provide sufficient Trp for overall protein synthesis and near-normal growth rates (Table ).

10 Growth sensitivities of B. subtilis and B. licheniformis to Trp starvation. Our RT- PCR results suggest that Trp starvation caused by IA addition is more pronounced in B. licheniformis than in B. subtilis. Thus, the growth of B. licheniformis should be more sensitive to Trp starvation. To test this hypothesis we grew cultures of both organisms under different mild Trp starvation conditions; low levels of IA. We observed that B. licheniformis was in fact more sensitive to growth inhibition by IA, an inhibitor of tryptophanyl-trna synthetase charging (Fig. ). B. licheniformis metabolism presumably is more sensitive to IA addition because it does not produce enough charged trna Trp under these conditions Growth sensitivity of B. licheniformis to IA addition, in the presence or absence of tryptophane, phenylalanine, tyrosine and p-aminobenzoic acid. To obtain additional understanding of the consequences of Trp starvation on B. licheniformis growth, we also analyzed the growth rates of IA-treated Trp-starved cells grown in the presence of different products of the aromatic biosynthetic pathway that have chorismic acid as a common precursor (0). Thus we examined the effects of added phenylalanine, tyrosine, PABA, and Trp, on IA-produced growth inhibition (Fig. ). Addition of phenylalanine, tyrosine, and PABA did not reverse the IA-produced growth inhibition of B. licheniformis, whereas added Trp did, in the absence - or presence - of phenylalanine, tyrosine, and PABA (Fig. ). Thus IA addition appears to create a charged trna Trp deficiency that can be reversed by Trp addition. Effects of replacing individual rtplp Trp codons on AT production in B. subtilis strains with rtplp of B. licheniformis. We assume that synthesis of the AT protein is

11 regulated both transcriptionally and translationally, and that the location of the Trp codons in rtplp plays a role in regulating AT synthesis. With these possibilities under consideration, experiments were performed (Fig. ) to examine the effects on AT synthesis of replacing each of the Trp codons of the leader peptide-coding region by some other codon. As previously described in studies with B. subtilis, translation of the entire rtplp coding region inhibits AT synthesis whereas ribosome stalling at the rtplp Trp codon cluster increases AT synthesis (). Presumably the ribosome reaching the rtplp stop codon of B. subtilis masks the rtpa SD sequence, reducing initiation of AT synthesis, whereas a ribosome stalled at any one of the three rtplp Trp codons should expose this SD sequence, allowing efficient initiation of AT synthesis (). The experiments described in Fig. were performed to determine the regulatory significance of ribosome stalling at each of the dispersed Trp codons in the B. licheniformis rtplp message, on the level of AT synthesized. Strains were constructed in which a hybrid plasmid bearing a modified at operon of B. subtilis containing rtplp of B. licheniformis was integrated into the chromosome of a B. subtilis strain bearing a deletion of the resident at operon. In this plasmid, rtplp of B. licheniformis replaced rtplp of B. subtilis, and the B. subtilis T-box terminator was deleted. Thus, at operon mrna would be synthesized, and rtplp translational control of AT synthesis would determine the level of AT protein that is produced. In the specific constructs, each of the three Trp codons of B. licheniformis rtplp was replaced by a codon specifying another amino acid. Thus the first Trp codon (UGG) was replaced by an Arg codon (AGG) in one construct, the second Trp codon (UGG) was replaced by an Arg codon (AGG) in a second construct, and the third Trp codon (UGG) was replaced by a Cys codon (UGU) in a third construct.

12 These changes did not alter the predicted important RNA secondary structure of B. licheniformis rtplp RNA (Fig. ). Each plasmid construct was integrated into the amye locus of a B. subtilis strain lacking the at operon, thus production of B. subtilis AT in these strains would be expected to be based on the organism's ability to translate the modified B. licheniformis rtplp mrna coding region (Fig. 1). Strains were grown both in minimal medium, minus inducer, and in minimal medium plus inducer (IA). The results obtained in Western blot AT measurements performed with these strains are shown in Fig.. Clearly, replacing the first Trp codon (Trp1) of B. licheniformis rtplp had the greatest effect on increasing AT production. In this strain, the Trp1 to Arg replacement would presumably allow the translating ribosome to reach the second Trp codon - and stall at this codon when there is a deficiency of charged trna Trp (Fig. ). Ribosome stalling at this codon would presumably disrupt the RNA secondary structure that blocks the SD needed for AT synthesis, and AT synthesis would be elevated. Apparently, even during growth in minimal medium (mild Trp starvation) there must be some increased stalling at Trp using this strain, since AT production in minimal medium is also higher in the Trp1 mutant than in the wild type construct. When the wild type rtplp construct was grown with IA (severe Trp starvation), the AT level was also elevated, but not as high as with the Trp1 mutant. This result indicates that the presence of the Trp1 codon can prevent the large increase in AT production observed with the construct lacking Trp1 (Fig. ). Therefore, in the wild type construct there must be little pausing at the Trp codon, under the conditions tested. In the construct with the Trp codon replaced by an Arg codon, AT synthesis was comparable to that of the wild type control culture, in cultures grown in minimal medium, and with IA (Fig. ). Thus there

13 must be little or no ribosome stalling at the Trp codon in wild type under these growth conditions. Clearly the existence of Trp codon is not solely responsible for the increased AT production associated with a charged trna Trp deficiency. Replacing the Trp codon by a Cys codon did not result in a significant change in AT production (Fig. ). We suspect that a ribosome reaching this position or stalled at this codon would block initiation of AT synthesis. Additional experiments are required to explain the significance, if any, of the location of the Trp codon To confirm the significance of the close proximity of the second Trp codon of rtplp to the presumed downstream rtplp mrna secondary structure that sequesters the SD sequence, we introduced a 1-nucleotide spacer downstream from Trp codon in the context of the Trp1 codon mutant (Fig. ). This spacer should prevent a ribosome stalled at the Trp codon from disrupting the RNA secondary structure that presumably limits AT production. Western blot analyses showed that indeed introduction of the spacer sequence reduced AT production to the same level observed with the wild type rtplp construct (Fig. ). Complicating interpretation of these findings is the predicted formation of different RNA secondary structures in the various transcripts. However these findings do suggest that in the rtplp leader peptide-coding region of B. licheniformis the location of the Trp codon is critical in obtaining elevated AT protein production under certain Trp starvation conditions. The existence of the Trp1 codon, at its location, may reduce this elevation, whenever a translating ribosome stalls at this codon and does not reach the Trp codon.

14 DISCUSSION The purpose of this study was to examine trp operon regulation in two closely related species, B. licheniformis and B. subtilis, and to determine the significance of the organizational differences in Trp codon location in their respective at operon leader peptide coding regions, rtplp (Fig. 1). In both B. subtilis and B. licheniformis, the trp operon is located within an aro supraoperon which is regulated by sensing the levels of Trp and uncharged trna Trp, and by the action of the TRAP and AT proteins. These two signal molecules and two regulatory proteins influence both transcription and translation. In addition, expression of trps, the gene encoding tryptophanyl-trna synthetase, is regulated in both organisms by the T-box mechanism - in response to uncharged trna Trp accumulation (1). The tryptophanyl-trna synthetase level is a major determinant of how much charged trna Trp will be produced and maintained per cell. However, the free Trp level is also rate-limiting for trna Trp charging. In the studies described in this paper we have shown that the growth of B. licheniformis is more sensitive to IA addition, an inhibitor of tryptophanyl-trna synthetase activity, than is B. subtilis growth (Fig. ). B. licheniformis responds to IA addition by producing higher trp operon mrna levels (and presumably trp operon protein levels), than does B. subtilis (Table ). Furthermore, the lower arof mrna level (arof is the first gene in the aro supraoperon) in B. licheniformis may indicate that this organism synthesizes less chorismate than B. subtilis. Therefore, it presumably must synthesize higher trp enzyme levels for the Trp pathway to compete effectively with the Phe and Tyr pathways, for chorismate, their common precursor. Possibly, B. licheniformis must form higher levels of each of the Trp pathway enzymes in order to provide sufficient Trp to support growth. However, the relative

15 contribution of Trp vs uncharged trna Trp, as a regulatory signal molecule, and potential differences in Trp, Phe, and Tyr biosynthesis, must be further analyzed in these two organisms, before an explanation can be given for their differences in sensitivity to IA Some organisms which have their trp operon within an aro supraoperon contain an at operon, providing the anti-trap protein AT, and allowing a regulatory response to a charged trna Trp deficiency (). These include: B. subtilis, B. licheniformis, B. amyloliquefaciens, B. mojavensis and B. spizizenii (). In each of these organisms the Trp-activated regulatory protein, TRAP, is primarily responsible for regulating trp operon transcription (-,, 1, 1, ). Depending on how many TRAP molecules per cell are Trp-activated, and AT free, TRAP will be partially or fully active. Thus, TRAP can bind up to molecules of Trp, to some extent cooperatively (, 0,, ), and each bound Trp can contribute to TRAP's RNA binding ability. However, even when TRAP is fully activated, AT can bind to TRAP and block TRAP's RNA binding ability. AT s synthesis is regulated both transcriptionally and translationally in response to the accumulation of uncharged trna Trp. The existence of the at operon in B. subtilis and B. licheniformis allows post-transcriptional decisions to influence regulation of synthesis of the enzymes of the Trp biosynthetic pathway The leader peptide coding region of the at operon's of B. licheniformis and B. subtilis are organized differently, and these differences are presumably designed to allow each organism to respond appropriately, to a charged trna Trp deficiency. Both B. subtilis and B. licheniformis have three Trp codons in their rtplp leader mrna sequence. However, in B. subtilis, the three Trp codons are adjacent, and the SD and start codon of AT are located downstream from the rtplp stop codon (Fig. A). Pausing at any one of 1

16 these three codons would be expected to have a near-equivalent severe effect - promoting maximal AT production. In B. licheniformis, its three Trp codons are spaced throughout the sequence with the third Trp codon located just upstream of the stop codon, overlapping the SD and start codon for AT (Fig. A). The locations of the Trp codons in the rtplp leader mrna sequence is designed to allow this organism to be particularly sensitive to a slight reduction in the level of charged trna Trp, and to be relatively less sensitive to a severe charged deficiency (this study) Ribosome stalling at the first Trp codon of rtplp leader RNA (upon severe Trp starvation conditions) of B. licheniformis should reduce leader peptide synthesis by allowing the rtppl RNA secondary structure to form, reducing translation initiation at the rtpa (AT) SD and start codon (Fig. B). Stalling at the second rtplp Trp codon, upon a mild charged trna Trp deficiency, should eliminate this secondary structure, allowing efficient ribosome binding and translation initiation at the rtpa SD and start codon (Fig. C). However, ribosome stalling at the Trp codon would allow a second potential RNA secondary structure to form, but presumably it is less effective in inhibiting ribosome binding at the rtpa SD and start codon region. Thus, depending upon the severity of Trp starvation and the accumulation of uncharged trna Trp, and the timing of charged trna Trp availability, the ribosome translating the rtplp coding region could stall at either Trp codon, Trp1 or Trp, and determine the efficiency of translation initiation at the rtpa start codon. Perhaps the objective of this design is to allow appreciable AT synthesis only when there is a slight charged trna Trp deficiency, and to prevent additional AT synthesis, when most of the trna Trp in the cell is uncharged. This would be advantageous if, under severe starvation conditions, there was insufficient Trp to activate 1

17 the TRAP protein. Therefore there would be no need to produce additional AT protein to inactivate TRAP. When a translating ribosome reached the third Trp codon of rtplp mrna, it would block AT synthesis - until translation of rtplp was completed. To explain the purpose of each of the three Trp codons in the rtplp coding region of B. licheniformis, additional experiments are needed in which stalling at each of these Trp codons is related to the level of uncharged trna Trp in the cell, and the level of AT protein that is produced. ACKNOWLEDGMENTS 1 1 The authors are indebted to Paul Babitzke and Paul Gollnick for their excellent comments on this manuscript. We also thank Luis Cruz-Vera for help with the figures. This paper will be the last publication based on research being performed in my laboratory (Charles Yanofsky). I would like to express my heartfelt appreciation to the many undergraduates, graduate students, postdocs, visiting fellows, and other investigators, who have contributed to our investigations. I have enjoyed every minute! The studies described in this paper were performed with the support of the National Science Foundation (MCB-00). 1 REFERENCES Anagnostopoulos, C., and J. Spizizen.. Requirements For Transformation In Bacillus subtilis. J. Bacteriol. 1:1-.. Antson, A. A., A. M. Brzozowski, E. J. Dodson, Z. Dauter, K. S. Wilson, T. Kurecki, J. Otridge, and P. Gollnick. 1. -fold symmetry of the trp RNA- 1

18 binding attenuation protein (TRAP) from Bacillus subtilis determined by X-ray analysis. J. Mol. Biol. :1-.. Antson, A. A., E. J. Dodson, G. Dodson, R. B. Greaves, X. Chen, and P. Gollnick. 1. Structure of the trp RNA-binding attenuation protein, TRAP, bound to RNA. Nature 01:-.. Antson, A. A., J. Otridge, A. M. Brzozowski, E. J. Dodson, G. G. Dodson, K. S. Wilson, T. M. Smith, M. Yang, T. Kurecki, and P. Gollnick. 1. The structure of the trp RNA attenuation protein. Nature :-00.. Babitzke, P. 00. Regulation of transcription attenuation and translation initiation by allosteric control of an RNA-binding protein: the Bacillus subtilis TRAP protein. Curr. Opin. Microbiol. :-.. Babitzke, P. 1. Regulation of tryptophan biosynthesis: Trp-ing the TRAP or how Bacillus subtilis reinvented the wheel. Mol. Microbiol. :1-.. Babitzke, P., J. T. Stults, S. J. Shire, and C. Yanofsky. 1. TRAP, the trp RNA-binding attenuation protein of Bacillus subtilis, is a multisubunit complex that appears to recognize G/UAG repeats in the trpedcfba and trpg transcripts. J. Biol. Chem. :1-0.. Babitzke, P., and C. Yanofsky. 1. Reconstitution of Bacillus subtilis trp attenuation in vitro with TRAP, the trp RNA-binding attenuation protein. Proc. Natl. Acad. Sci. U S A 0:-.. Babitzke, P., and C. Yanofsky. 1. Structural features of L-tryptophan required for activation of TRAP, the trp RNA-binding attenuation protein of Bacillus subtilis. J. Biol. Chem. 0:-. 1

19 Berka, R. M., X. Cui, and C. Yanofsky. 00. Genomewide transcriptional changes associated with genetic alterations and nutritional supplementation affecting tryptophan metabolism in Bacillus subtilis. Proc. Natl. Acad. Sci. U S A 0:-.. Chen, G., and C. Yanofsky. 00. Features of a leader peptide coding region that regulate translation initiation for the anti-trap protein of B. subtilis. Mol. Cell :0-.. Chen, G., and C. Yanofsky. 00. Tandem transcription and translation regulatory sensing of uncharged tryptophan trna. Science 01:-.. Chen, X., A. A. Antson, M. Yang, P. Li, C. Baumann, E. J. Dodson, G. G. Dodson, and P. Gollnick. 1. Regulatory features of the trp operon and the crystal structure of the trp RNA-binding attenuation protein from Bacillus stearothermophilus. J. Mol. Biol. :0-1.. Chen, Y., and P. Gollnick. 00. Alanine scanning mutagenesis of anti-trap (AT) reveals residues involved in binding to TRAP. J. Mol. Biol. :-. 1. Cruz-Vera, L. R., M. Gong, and C. Yanofsky. 00. Physiological effects of anti-trap protein activity and trna Trp charging on trp operon expression in Bacillus subtilis. J. Bacteriol. 10: Du, H., and P. Babitzke. 1. trp RNA-binding attenuation protein-mediated long distance RNA refolding regulates translation of trpe in Bacillus subtilis. J. Biol. Chem. :0-0. 1

20 1. Du, H., R. Tarpey, and P. Babitzke. 1. The trp RNA-binding attenuation protein regulates TrpG synthesis by binding to the trpg ribosome binding site of Bacillus subtilis. J. Bacteriol. 1:-. 1. Folmsbee, M., K. Duncan, S. O. Han, D. Nagle, E. Jennings, and M. McInerney. 00. Re-identification of the halotolerant, biosurfactant-producing Bacillus licheniformis strain JF- as Bacillus mojavensis strain JF-. Syst. Appl. Microbiol. :-. 1. Gollnick, P., and P. Babitzke. 00. Transcription attenuation. Biochim. Biophys. Acta 1: Gollnick, P., and P. Babitzke, and C. Yanofsky. 1. The mtrab Operon of Bacillus subtilis Encodes GTP Cyclohydrolase I (MtrA), an Enzyme Involved in Folic Acid Biosynthesis, and MtrB, a Regulator of Tryptophan Biosynthesis. J. Bacteriol. : Gollnick, P., P. Babitzke, A. Antson, and C. Yanofsky. 00. Complexity in regulation of tryptophan biosynthesis in Bacillus subtilis. Annu. Rev. Genet. :-.. Gutierrez-Preciado, A., T. M. Henkin, F.J. Grundy, C. Yanofsky, and E. Merino. 00. Functional implications of the RNA-based T-box regulatory mechanism. Microbiol. Mol. Biol. Rev. : Henkin, T. M Transcription termination control in bacteria. Curr. Opin. Microbiol. :-.. Henner, D., and C. Yanofsky. 1. Biosynthesis of aromatic amino acids. American Society for Microbiology, Washington, DC. -0 0

21 Livak, K. J., and T. D. Schmittgen Analysis of relative gene expression data using real-time quantitative PCR and the (-Delta Delta C(T)) Method. Methods :0-.. Matchett, W. H., 1. Inhibition of tryptophan synthetase by indoleacrylic acid. J. Bacteriol. 1:-1. Merino, E., P. Babitzke, and C. Yanofsky. 1. trp RNA-binding attenuation protein (TRAP)-trp leader RNA interactions mediate translational as well as transcriptional regulation of the Bacillus subtilis trp operon. J. Bacteriol. 1:-0.. Merino, E., R. A. Jensen, and C. Yanofsky. 00. Evolution of bacterial trp operons and their regulation. Curr. Opin. Microbiol. :-.. Otridge, J., and P. Gollnick. 1. MtrB from Bacillus subtilis binds specifically to trp leader RNA in a tryptophan-dependent manner. Proc. Natl. Acad. Sci. U S A 0:-. 0. Li, Pan T. X. and P. Gollnick. 00. Using hetero--mers composed of wild type and mutant subunits to study tryptophan binding to TRAP and its role in activating RNA binding. J. Biol. Chem. :-. 1. Qi, Y., G. Patra, X. Liang, L. E. Williams, S. Rose, R. J. Redkar, and V. G. DelVecchio Utilization of the rpob gene as a specific chromosomal marker for real-time PCR detection of Bacillus anthracis. Appl. Environ. Microbiol. :0-.. Sarsero, J. P., E. Merino, and C. Yanofsky A Bacillus subtilis gene of previously unknown function, yhag, is translationally regulated by tryptophan- 1

22 activated TRAP and appears to be involved in tryptophan transport. J. Bacteriol. 1:-1.. Sarsero, J. P., E. Merino, and C. Yanofsky A Bacillus subtilis operon containing genes of unknown function senses trna Trp charging and regulates expression of the genes of tryptophan biosynthesis. PNAS. : -1. Sekiguchi, J., N. Takada, and H. Okada. 1. Genes affecting the productivity of alpha-amylase in Bacillus subtilis Marburg. J. Bacteriol. 1:-.. Shevtsov, M. B., Y. Chen, P. Gollnick, and A. A. Antson. 00. Crystal structure of Bacillus subtilis anti-trap protein, an antagonist of TRAP/RNA interaction. Proc. Natl. Acad. Sci. U S A :0-.. Snyder, D., J. Lary, Y. Chen, P. Gollnick, and J. L. Cole. 00. Interaction of the trp RNA-binding attenuation protein (TRAP) with anti-trap. J. Mol. Biol. :-.. Steinberg, W. 1. Temperature-induced derepression of tryptophan biosynthesis in a tryptophanyl-transfer ribonucleic acid synthetase mutant of Bacillus subtilis. J. Bacteriol. :-.. Sudershana, S., H. Du, M. Mahalanabis, and P. Babitzke. 1. A ' RNA stem-loop participates in the transcription attenuation mechanism that controls expression of the Bacillus subtilis trpedcfba operon. J. Bacteriol. :-.. Valbuzzi, A., P. Gollnick, P. Babitzke, and C. Yanofsky. 00. The anti-trp RNA-binding attenuation protein (Anti-TRAP), AT, recognizes the tryptophanactivated RNA binding domain of the TRAP regulatory protein. J. Biol. Chem. :0-.

23 Valbuzzi, A., and C. Yanofsky Inhibition of the B. subtilis regulatory protein TRAP by the TRAP-inhibitory protein, AT. Science : Valbuzzi, A., and C. Yanofsky. 00. Zinc is required for assembly and function of the anti-trp RNA-binding attenuation protein, AT. J. Biol. Chem. :-.. Vogel, H. J., and D. M. Bonner. 1. Acetylornithinase of Escherichia coli: partial purification and some properties. J. Biol. Chem. 1:-.. Watanabe, M., J. G. Heddle, K. Kikuchi, S. Unzai, S. Akashi, S. Y. Park, and J. R. Tame. 00. The nature of the TRAP-Anti-TRAP complex. Proc. Natl. Acad. Sci. U S A :1-1.. Yakhnin, A. V., H. Yakhnin, and P. Babitzke. 00. RNA polymerase pausing regulates translation initiation by providing additional time for TRAP-RNA interaction. Mol. Cell :-.. Yakhnin, H., and P. Babitzke. 00. Gene replacement method for determining conditions in which Bacillus subtilis genes are essential or dispensable for cell viability. Appl. Microbiol. Biotechnol. :-.. Yakhnin, H., A. V. Yakhnin, and P. Babitzke. 00. Translation control of trpg from transcripts originating from the folate operon promoter of Bacillus subtilis is influenced by translation-mediated displacement of bound TRAP, while translation control of transcripts originating from a newly identified trpg promoter is not. J. Bacteriol. 1:-.. Yakhnin, H., A. V. Yakhnin, and P. Babitzke. 00. The trp RNA-binding attenuation protein (TRAP) of Bacillus subtilis regulates translation initiation of

24 ycbk, a gene encoding a putative efflux protein, by blocking ribosome binding. Mol. Microbiol. 1:-.. Yang M, Chen X, Militello K, Hoffman R, Fernandez B, Baumann C, Gollnick P. 1. Alanine-scanning mutagenesis of Bacillus subtilis trp RNAbinding attenuation protein (TRAP) reveals residues involved in tryptophan binding and RNA binding. JMB 0:-. Yang, W. J., and C. Yanofsky. 00. Effects of tryptophan starvation on levels of the trp RNA-binding attenuation protein (TRAP) and anti-trap regulatory protein and their influence on trp operon expression in Bacillus subtilis. J. Bacteriol. 1: Yanofsky, C. 00. RNA-based regulation of genes of tryptophan synthesis and degradation, in bacteria. RNA :-. FIGURE LEGENDS FIG. 1. Comparison of the at operon s leader peptide nucleotide sequence (rtplp) and amino acid sequence (LP), and neighboring nucleotide regions, of B. subtilis and B. licheniformis. The at operon of both B.subtilis and B.licheniformis contains two structural genes, rtpa and ycbk, preceded by a short leader peptide-coding region, rtplp. The rtplp, rtpa, and ycbk coding regions of both organisms are transcriptionally regulated by a T-box leader RNA region that is responsive to uncharged vs. charged trna Trp. The T-box region is followed by the leader peptide-coding region, rtplp. (A) The B. subtilis leader peptide (LP) consists of amino acids, with three Trp residues arranged in tandem. The Shine/Dalgarno sequence for rtpa of B. subtilis is in an untranslated region

25 preceding the leader peptide-coding region. (B) The B. licheniformis LP contains amino acids. It also has three Trp residues; however these are spaced throughout the leader peptide. In B. licheniformis the rtpa Shine/Dalgarno sequence and the rtpa start codon are located within the segment of the rtplp leader peptide-coding region. The start codon of rtpa is out of frame with the third Trp codon of the rtplp leader peptidecoding region, and is followed by an out-of-phase stop codon, for rtplp. FIG.. Comparative growth sensitivities of B. subtilis and B. licheniformis to different levels of IA (μg IA/ml) added to minimal medium. Wild type cultures of B.subtilis CYBS00 (A) and B.licheniformis BlA (B) were grown in Vogel-Bonner minimal medium (0) supplemented with 0.% glucose and trace elements, at C. Various amounts of IA were added to selected cultures. Cell density was determined hourly, using a Klett-Summerson colorimeter (0 nm filter). Klett units were plotted vs. time to obtain the growth curves shown FIG.. Comparative growth sensitivities of B. licheniformis to IA in the presence or absence of Trp, and/or Phe, Tyr and PABA. Wild type cultures of B.licheniformis BlA were grown in Vogel-Bonner minimal medium with and without IA: μg/ml (A) or μg/ml (B), with the various additional supplements indicated, plus 0.% glucose and trace elements at C. Cell density was determined hourly, using a Klett-Summerson colorimeter (0 nm filter). Klett units were plotted vs. time to obtain the growth curves shown. 1 FIG.. (A) Predicted secondary structures and their stabilities in B. licheniformis at operon leader RNA. Trp codons are indicated in grey and the SD sequences of rtplp and

26 rtpa are in bold. The start codon of rtpa overlaps the third Trp codon of rtplp, followed by the rtplp stop codon. The ' end of the segment of nucleotides of rtplp mrna that are presumably masked by a ribosome stalling at the Trp1 codon, or the Trp codon, are indicated thus:. The arrow indicates the site of insertion of a 1 nucleotide spacer in the rtplp coding region. (B-D) Predicted secondary structures and their stabilities upon ribosome stalling in B. licheniformis at operon leader RNA in strains in which rtplp Trp 1 and codons are replaced (B and C respectively), and D. a nucleotide spacer is inserted into the strain in which rtplp Trp 1 is replaced FIG.. AT production in B. subtilis strains containing an integrated recombinant plasmid with the B. licheniformis rtplp leader peptide coding region, without (Wild type) or with the specific changes indicated. (A) A plasmid construct was integrated at the amye locus of a B. subtilis strain bearing a deletion of the entire at operon (0). (B) An individual Trp codon was replaced in each construct by an Arg codon (Trp1 and Trp) or a Cys codon (Trp), respectively, to retain the secondary structure of the leader RNA. Western blots were analyzed with extracts of cultures of mutant strains grown in minimal medium, and in minimal medium supplemented with IA, 0 µg/ml (-Inducer and +Inducer respectively). The AT level in each culture grown with IA was appoximately -fold higher than the AT level in the same strain grown in minimal medium without IA. Antibodies to B. subtilis AT do not react with B. licheniformis AT. 0 1

27 TABLE 1. Operons, product functions, regulating signals, regulatory products, and transcription and translation regulators, involved in Trp biosynthesis and its regulation in B. subtilis and B. licheniformis. Operon Product Function Regulating Signals Regulatory Product Transcription Regulators Translation Regulators at operon Regulation trna Trp AT T box rtplp TRAP operon Regulation none identified TRAP aro supraoperon Biosynthesis Trp, trna Trp TRAP, AT TRAP, AT Folate operon Biosynthesis Trp, trna Trp TRAP, AT trps operon trna charging trna Trp T box trpp operon Trp transport Trp, trna Trp TRAP, AT

28 TABLE. Strains, constructs, and primers used in the studies described in this paper. Strains and constructs Strain Genotype Change Source CYBS 00 B. subtilis wild type control, prototroph Our stock BlA B. licheniformis wild type control, prototroph Our stock CYBS1 r CYBS00 Δ(rtpA-ycbK')::Sp no AT, no YcbK CYBL CYBS1 amye:: [Pat-LR-ĘT-Bl rtplp-rtpa-ycbkõ-lacz ] ΔT, Bl rtplp This study CYBL1 CYBS1 amye:: [Pat-LR-ĘT-Bl rtplp-rtpa-ycbkõ-lacz ] ΔT, Bl rtplp, WR This study CYBL1 spacer CYBS1 amye:: [Pat-LR-ĘT-Bl rtplp-rtpa-ycbkõ-lacz ] ΔT, Bl rtplp, WR, 1 nt spacer This study CYBL CYBS1 amye:: [Pat-LR-ĘT-Bl rtplp-rtpa-ycbkõ-lacz ] ΔT, Bl rtplp, WR This study CYBL CYBS1 amye:: [Pat-LR-ĘT-Bl rtplp-rtpa-ycbkõ-lacz ] ΔT, Bl rtplp, WC This study Primers used to create the constructs analyzed Gene Sequence Remarks BlLP Set1-' ATGGAGGAAGGCTGGCCGGAGTGGCCGCATAGATGAGTTAGAAAGGAGGATATCAAATGGTC Bl rtplp 'end BlLP Set1-' ATGCGGCCACTCCGGCCAGCCTTCCTCCATTGGCCGTCACCTCCTTTAAGAAAC Bl rtplp 'end BlLP Set-' AATACTAAACGGAAACGGAGGTGTGATCGTAAATGGTGATTGCAACTGATGATCTTG Bl rtplp 'end BlLP Set-' ACGATCACACCTCCGTTTCCGTTTAGTATTATGCGGCCACTCCGGC Bl rtplp 'end BlLP WR-' CAATGGAGGAAGGCAGGCCGGAG Replace WR BlLP WR-' GCCGTCACCTCCTTTAAGGCAAAGGAC Replace WR BlLP WR spacer-' CAGATTAATACTAAACGGAAACGGAGGTGTGATC Introduce spacer to Bl rtplp WR BlLP WR spacer-' CAATCATCTGCGGCCACTCCGGC Introduce spacer to Bl rtplp WR BlLP WR-' CTGGCCGGAGAGGCCGCATAATAC Replace WR BlLP WR-' CCTTCCTCCATTGGCCGTCACCTC Replace WR BlLP WC-' GTGTGATCGTAAATGTTGATTGCAACTGATGATC Replace WC BlLP WC-' CTCCGTTTCCGTTTAGTATTATGCGGCCAC Replace WC BsTeminator ' AGGACGGGGGTTTTTTGTGTTTCTTAAAGGAGGTGACGGCCAATG Introduce terminator BsTeminator ' AAACACAAAAAACCCCCGTCCTATGCAAAGGACGAGGGTCTCG Introduce terminator

29 TABLE. cont d RT-PCR primers used in determining relative mrna levels Gene ' Sequence ' Sequence Bs rpob CGTGTTATCGTTTCCCAGC GTGTGCGATCAATGCGGAC Bs rtpa GGTCATTGCAACTGATGATC AGCAGTCAGAATAACACC Bs mtrb GCATTCAAGTGATTTTGTCG ATCAGTGCCTCTCCTCCTGAC Bs mtra GAGGGCCTTCTTGATACACCGAAA AGAACAAGCTCTTCGTGATCCTCG Bs arof ATGATGGCTGCCATTGATGAAGC ACAGCGGCAGCAAGCTTGCTATCC Bs trpe GTTTGCCGGACATTAATTGC AATGAGATTTTGAAGCTCC Bs trpg CACGGGAAAAACCTCGGATATC GTGGCGAATAGCCATGATTTC Bs pabb GGCAGATATAGTATAGCCGGTC CTGAGAAACCCGATTGCCCC Bs trps AAAGAATATCCGCAATCTCG TAAATTGAGTCATCCGCTCA Bl rpob CGCCAATTGAGGATTTCACT AGCGGAGCTGAATAGGTCAC Bl rtpa GGACGATTTGGAAACGACAT CTGCGCCGTCAAAATCAC Bl mtrb TAATCAAAGCCGTTGAAGACG CTGGCAGATCATCACTTCTCC Bl mtra AAGCGATCGGAGAAGACCCGAATA TGGATCTTCATTCAAGCCGGAG Bl arof AGCGGGGCTTTATATCACAA CCTGGTCTTTTTCGATTTGC Bl trpe ATTGAACCGTCCATCAAAGG TGCAGCTTTTTCAGTTCGTG Bl trpg TGTCGCCTGACTTTTTGATG AAACCCCGAAAATCGGTATC Bl pabb AGCCGTCTATGACCATGAGC ACATTTGCTCAAGCCTGTCC Bl trps TGCTTCAGTGTGTCGCCTAC TATGTCAAAAGCCCGGAGAC 0

30 TABLE. Relative real time PCR gene expression (mrna) levels in B. subtilis vs. B. licheniformis grown under the two different conditions indicated. Strain(s) B. subtilis Gene mm/trp b IA c /Trp IA/Trp IA0/Trp IA0/Trp rtpa mtrb arof trpe.... trps B. licheniformis Gene mm/trp IA/Trp IA/Trp IA0/Trp IA0/Trp rtpa mtrb arof trpe... trps B. licheniformis / B. subtilis Gene mm/trp IA/Trp IA/Trp IA0/Trp IA0/Trp rtpa mtrb arof trpe 1 trps

31 Legend to Table a RNA was extracted from cultures grown in minimal medium with the supplements indicated (see Materials and Methods). b Ratios of relative gene expression; mm, minimal medium; Trp, minimal medium supplemented with 0 µg/ml of L-tryptophan; IA, minimal medium supplemented with IA. All mrna levels were normalized against the rpob mrna level in the same extract, as an internal control. The relative mrna levels were subsequently calculated using the - ΔΔCt threshold cycle method. c IA, IA, IA0 and IA0 correspond to the various levels of IA (µg/ml) added to cultures.

32

33

34

35

36

37