Expression Patterns of OsPIL11, a Phytochrome-Interacting Factor in Rice, and Preliminary Analysis of Its Roles in Light Signal Transduction

Rice Science, 2012, 19(4): 263 268 Copyright 2012, China National Rice Research Institute Published by Elsevier BV. All rights reserved Expression Patterns of OsPIL11, a Phytochrome-Interacting Factor in Rice, and Preliminary Analysis of Its Roles in Light Signal Transduction LI Li 1, 2, PENG Wei-feng 1, 2, LIU Qian-qian 1, 3, ZHOU Jin-jun 1, LIANG Wei-hong 2, XIE Xian-zhi 1 ( 1 High-Tech Research Center, Shandong Academy of Agricultural Sciences, Ji nan 250100, China; 2 College of Life Science, Henan Normal University, Xinxiang 453007, China; 3 College of Life Sciences, Shandong Normal University, Ji nan 250014, China) Abstract: The expression patterns of OsPIL11, one of six putative phytochrome-interacting factors, were analyzed in different organs of transgenic tobacco (Nicotiana tabacum). The expression of OsPIL11 was organ-specific and was regulated by leaf development, abscisic acid (ABA), jasmonic acid (JA) and salicylic acid (SA). To further explore the role of OsPIL11 in plant light signal transduction, a plant expression vector of OsPIL11 was constructed and introduced into tobacco. When grown under continuous red light, OsPIL11-overexpressed transgenic tobacco exhibited shorter hypocotyls and larger cotyledons and leaves compared to wild-type seedlings. When grown under continuous far-red light, however, transgenic and wild-type seedlings showed similar phenotypes. These results indicate that OsPIL11 is involved in red light induced de-etiolation, but not in far-red light induced de-etiolation in transgenic tobacco, which lays the foundation for dissecting the function of OsPIL11 in phytochrome-mediated light signal transduction in rice. Key words: rice; phytochrome-interacting factor; transgenic tobacco; light signal transduction For higher plants, light is not only a source of energy for photosynthesis, but also one of key environmental signals that regulate plant growth and development. Plant monitors external light conditions including the wavelength, intensity and photoperiod of incident light and makes light-specific adjustments in physiological and developmental processes to adapt the changing environment (Takano et al, 2005, 2009; Franklin and Quail, 2010). To accomplish this vital task, plants use an array of photoreceptors that includes phytochromes (phy), cryptochromes, phototropins and several others. Among them, phytochrome family mainly perceives and responds to the red and far-red light regions, and is involved in controlling multiple responses in plant life cycle. Phytochromes exist in a biologically inactive red lightabsorbing (Pr) form which localizes in cytoplasm in the etiolated seedlings. Red light induces conformational shift of the Pr form to a biologically active far-red light-absorbing (Pfr) form. Following conversion to the Pfr form, phytochromes translocate to the nucleus and interact with other proteins (Rockwell et al, 2006; Kevei et al, 2007; Franklin and Quail, 2010). Among phytochrome associated proteins, phytochrome-interacting factors (PIFs) are central player in phytochromemediated signal transduction (Zhao, 2009; Leivar and Quail, 2011). PIFs, as a small subset of the basic helix-loop-helix (bhlh) transcription factor superfamily, Received: 10 April 2012; Accepted: 16 July 2012 Corresponding authors: XIE Xian-zhi (xzhixie2010@163.com); LIANG Wei-hong (liangwh226@henannu.edu.cn) have been found to bind to the G-box motif in the promoter region of light-regulated genes. Thus, PIFs constitute a signal transfer pathway from photoactivated phytochromes to the light-regulation of gene expression that controls photomorphogenesis in plants. PIF3, the foundation member of the PIF subset in Arabidopsis, was identified in yeast two-hybrid (Y2H) screen using the C-terminal domain of phyb as bait (Ni et al, 1998). Subsequently, it was shown, using Y2H and in vitro coimmunoprecipitation (co-ip) assays that PIF3 interacts with the C-terminal domains of both phya and phyb from Arabidopsis and rice. Moreover, it was shown that PIF3 selectively interacts with the full-length biologically active Pfr forms of both phya and phyb (Ni et al, 1999; Martinez-Garcia et al, 2000; Zhu et al, 2000). In Arabidopsis, PIF family is composed of at least eight members, PIL1, PIF1/PIL5, PIF3, PIF4, PIF5/PIL6, PIF6/PIL2, PIF7 and PIL8/PIF8. Except PIL1, the other PIFs can interact with photoactivated phyb, whereas only PIF1 and PIF3 can interact with photoactivated phya (Zhu et al, 2000; Huq et al, 2004; Leivar and Quail, 2011). These data suggest that PIFs might interact with multiple phytochromes with differential affinities and might transduce light signals with varying efficiency to control gene expression (Castillon et al, 2007). Nakamura et al (2007) identified six candidate genes encoding PIFs, designated OsPIL11 to OsPIL16, via homologous analysis in rice genome. However, the expression characteristics of these genes and their roles in phytochrome-mediated light signal transduction have not been comprehensively investigated yet. In

264 Rice Science, Vol. 19, No. 4, 2012 this study, we analyzed the expression patterns of OsPIL11 as well as the roles of OsPIL11 in seedling de-etiolation in transgenic tobacco. Our results reveal that the expression of OsPIL11 was organ-specific and was regulated by leaf development, abscisic acid (ABA), jasmonic acid (JA) and salicylic acid (SA). Moreover, OsPIL11 is involved in red light-induced de-etiolation, but not in far-red lignt-induced de-etiolation in transgenic tobacco. MATERIALS AND METHODS Plant materials Rice (Oryza sativa L. cv. Nipponbare) and tobacco (Nicotiana tabacum, cv. Petit Havana SR) were used. Plant growth Seeds of wild-type rice were surface-sterilized in 70% ethanol for 30 s and then in 5% NaClO for 20 min. The seeds were then rinsed six times with sterile double-distilled water, placed on 0.4% agar medium in glass pots and grown for 7 d at 28 C in an artificial climate box (RXZ-280B; Jiangnan Company, Ningbo, China). Seedlings were then transferred to soil and grown in a greenhouse to the six-leaf stage with natural light conditions and controlled temperatures (28 C day/23 C night). Roots, shoots, old leaves (the second leaf and the third leaf) and new leaves (the sixth leaf) were harvested for examining organ-specificity of OsPIL11 gene. For examining the effects of light on OsPIL11 expression, the seedlings were grown in continuous darkness for 7 d, and then transferred to white light (7200 lux, 28 C). The above-ground parts were harvested at 0, 2, and 12 h after exposed to white light. For ABA treatment, the most uniformly germinated seeds were sown in a 96-well plate with the bottom removed. The plate was floated in 1/2 MS culture solution in a growth chamber under controlled photoperiodic conditions (14 h light, 28 C/10 h dark, 23 C). Three-leaf-stage seedlings were transferred to culture solution containing 100 mol/l cis-trans ABA (Sigma) for different time points before analyzing OsPIL11 mrna levels. For JA and SA treatments, surface-sterilized seeds of wild-type rice were grown for 8 d in the 0.4% agarose containing 2 µmol/l JA, 20 µmol/l JA, 100 µmol/l SA and 400 µmol/l SA, respectively, under continuous light conditions. The above-ground parts were harvested for examining the effects of JA and SA on OsPIL11 gene expression. For analyzing the OsPIL11 transcripts in transgenic tobacco, the transgenic seedlings were grown in soil till adult plants. Young leaves in adult transgenic tobacco were harvested and frozen in liquid nitrogen. Expression pattern of OsPIL11 Total RNAs were isolated from the harvested leaves using the RNAiso reagent (TaKaRa, Dalian, China) according to the manufacturer s instructions. DNaseItreated RNA was subjected to reverse transcription- PCR using High Fidelity Primescript RT-PCR Kit (TaKaRa, Dalian, China). RT-PCR products were electrophorisized in 2.0% agarose. The rice ubiquitin gene (OsUBQ, AK119731) was used as an internal control to quantify the relative transcript level of each target gene. For real-time PCR, first-strand cdnas were synthesized from DNase I-treated total RNA using PrimeScript RT Enzyme Mix I (TaKaRa), according to the manufacturer s instructions. Quantitative PCR was performed in an ABI 7000 Real-time PCR System (Applied Biosystems) using SYBR Premix Ex Taq (TaKaRa). Each reaction contained 10 µl of 2 SYBR Premix Ex Taq (TaKaRa), 2.0 µl of cdna samples, and 0.2 µmol/l gene-specific primer pairs (Table 1) in a final volume of 20 µl. The PCR thermal cycle used was as follows: denaturation at 95 C for 30 s, and 40 cycles of at 95 C for 5 s and at 60 C for 31 s. Three Table 1. Primer pairs and PCR conditions used in this study. Gene Accession number Purpose Primer sequence (5-3 ) OsPIL11 Os12g0610200 RT-PCR F1: GCTCCAGCTACAGATGATGTGG R1: GCTGCTGCTGAAGGTTCTTGG Real-time PCR qf1: CAACTAGCATCTCCTCCTCTACTTG qr1: CTCTTTCTCTTTGAGCTGAGATGAC Expression vector construction F2: ATGGATCCATGAACCAGTTCGTCCC R2: ATACTAGTCAGGAGTCAGCGGCTG NtActin AB158612 RT-PCR F: TCCGGCGACGGTGTCTCACA R: CGCGGACAATTTCCCGTTCAGC OsUBQ AK119731 RT-PCR F: ATCACGCTGGAGGTGGAGT R: AGGCCTTCTGGTTGTAGACG OsUBQ AK059011 Real-time PCR qf: ACCACTTCGACCGCCACTACT qr: ACGCCTAAGCCTGCTGGTT Annealing temperature (ºC) Cycle number 62 25 60 53 30 62 24 55 21 60

LI Li, et al. Expression Patterns of OsPIL11 and Its Roles in Light Signal Transduction 265 replicate biological experiments were performed. Plant expression vector construction and tobacco transformation For construction of the OsPIL11-overexpression vector, the ORF of OsPIL11 was amplified by PCR with PrimeSTAR HS DNA Polymerase (TaKaRa) from rice leaf cdna. Primer pairs used for amplification were F2: 5 -ATGGATCCATGAACCAGTTCGTCCC-3 (BamH I site underlined) and R2: 5 -ATACTAGTCAGGAGTC AGCGGCTG-3 (Spe I site underlined). The PCR product was digested with BamH I and Spe I and was subcloned into the p1390-ubi vector between the maize ubiquitin promoter and the nos terminator. This plasmid was introduced into Agrobacterium tumefaciens strain EHA105 (Hood et al, 1993) by electrotransformation. Tobacco (Nicotiana tabacum cv. Petit Havana SR) was transformed via the agroinfection methods (Horsch et al, 1985). Measurements of plant For characterizing the de-etiolation in transgenic tobacco, sterilized seeds of transgenic tobacco were sown onto 1/2 MS medium. After incubation at 4 C for 3 d, the seeds were irradiated with white light for 3 h and then grown in continuous darkness, red light, or far-red light at 26 C for 10 d. Hypocotyl length, cotyledon and leaf widths were measured. Statistical analysis was performed using Student s t-test. Fluence rates were 150 µmol/(m 2 s) for red light and 29 µmol/(m 2 s) for far-red light. RESULTS Expression patterns of OsPIL11 gene To better understand the function of OsPIL11, we examined the transcript levels of OsPIL11 in different organs using real-time PCR. OsPIL11 mrna levels accumulated to relatively high levels in leaves as compared in the roots and stems (Fig. 1-A). It is deduced that OsPIL11 probably plays important roles in light signal transduction in rice leaves. In addition, OsPIL11 expressed higher in the new leaves than in the old leaves (Fig. 1-A), suggesting that the expression of OsPIL11 gene is regulated by rice development. To examine the effects of light on OsPIL11 gene expression, we determined the transcript levels of OsPIL11 in seedlings grown for 7 d in continuous darkness (0 h) or for 7 d in the dark followed by either 2 h or 12 h in white light. As shown in Fig. 1-B, 2 h-white light irradiation obviously repressed the expression of OsPIL11 gene, while 12 h-white light irradiation caused dramatic decrease of OsPIL11 Fig. 1. Expression patterns of OsPIL11 gene in rice seedlings. A, Organ-specificity of OsPIL11 gene expression. Real-time PCR analysis of the transcript levels of OsPIL11 gene in roots (R), stems (S), old leaves (OL) and new leaves (NL) in the wild-type plants at the 6-leaf stage. B, Effects of white light on the transcript levels of OsPIL11 gene. RT-PCR analysis of the transcript levels of OsPIL11 gene in the wild-type seedlings grown in the dark for 7 d or in the dark but irradiated with 2 h and 12 h of continuous white light. C, Effects of exogenous abscisic acid (ABA) on transcript levels of OsPIL11 gene. The wild-type seedlings at the 3-leaf stage were incubated in 100 µmol/l ABA for 2 h and 6 h. The transcript levels of OsPIL11 gene were compared before and after ABA treatment by real-time PCR. D, Effects of exogenous jasmonic acid (JA) and salicylic acid (SA) on the transcript levels of OsPIL11 gene. Wild-type seedlings were grown in 0.4% agar medium or in the medium including different concentrations of JA (2 and 20 µmol/l) or SA (100 and 400 µmol/l) for 7 d. RT-PCR was used to analyze the transcript levels of the OsPIL11 gene. expression in rice seedlings. In the previous study, we observed that phytochromes are involved in JA, SA and ABA pathways in rice (Xie et al, 2011). Thus, it is worth investigating whether JA, SA and ABA affect the expression of OsPIL11 gene. We compared the effects of exogenous ABA, JA and SA on OsPIL11 mrna levels. OsPIL11 mrna levels were decreased upon 100 mol/l ABA treatment for 6 h (Fig. 1-C), whereas exogenous JA and SA treatments slightly enhanced the accumulation of OsPIL11 mrna (Fig. 1-D). Therefore, the expression of OsPIL11 gene was regulated by hormones in rice. Characterization of photomorphogenesis in transgenic tobacco overexpressing OsPIL11 gene To investigate the roles of OsPIL11 in light signal transduction, we generated transgenic tobacco plants overexpressing OsPIL11 (Fig. 2-A). Three independent T3 lines (#5, #7 and #15) were used for further phenotypic characterizations based on their expression levels (Fig. 2-B). To characterize photomorphogenesis in transgenic tobacco, we compared the hypocotyl lengths of non-transgenic tobacco (SR) and OsPIL11- overexpression lines grown either in darkness or under red or far-red light. In darkness, OsPIL11-overexpression lines and SR exhibited similar hypocotyl lengths (Fig.

266 Rice Science, Vol. 19, No. 4, 2012 Fig. 2. Ectopic expression of OsPIL11 affects hypocotyl growth in transgenic tobacco. A, Diagram of the OsPIL11-overexpression vector. Expression of the OsPIL11 gene was driven by maize ubiquitin (Pubi) promoter. B, RT-PCR analysis of the transcript levels of OsPIL11 in leaves of transgenic and wild-type tobacco. C, Hypocotyl lengths of transgenic and wild-type tobacco grown under different light conditions. Wild-type and transgenic seedlings were grown under continuous dark (Dc), red light (Rc) and far-red light (FRc) for 10 d. Error bars indicate the standard error (SE). The means ± SE obtained from at least 30 seedlings were plotted. Three different transgenic lines (#5, #7 and #15) and wild-type tobacco (SR) were analyzed. Asterisk (**) denotes significant differences (P < 0.01) according to the t-test. 2-C), suggesting that OsPIL11 did not affect the skotomorphogenesis in tobacco. Continuous red light inhibited hypocotyl elongation in both transgenic tobacco and SR, whereas the inhibitory effects triggered by red light were more obvious in OsPIL11-overexpression lines than in SR (Fig. 2-C). These results suggest that OsPIL11 positively regulate the red light induced inhibition of hypocotyl growth in tobacco. Continuous far-red light similarly inhibited the hypocotyl growth in OsPIL11-overexpression lines and in SR (Fig. 2-C), which suggests OsPIL11 is likely not to be involved in the far-red light induced inhibition of hypocotyl growth in tobacco. In Arabidopsis, de-etiolation is also characterized by the expansion of cotyledons. Thus, we compared the width of cotyledon as well as the first leaf in OsPIL11-overexpression transgenic tobacco and SR. As shown in Fig. 3-A, three transgenic tobacco lines had significantly larger cotyledon and the first leaf than SR. These results reveal that OsPIL11 positively regulate de-etiolation responses in tobacco. DISCUSSION At present, Arabidopsis PIF family was found to contain at least eight members, PIL1, PIF1/PIL5, PIF3, PIF4, PIF5/PIL6, PIF6/PIL2, PIF7 and PIL8/PIF8 Fig. 3. Ectopic expression of OsPIL11 affects cotyledon and the first leaf sizes in transgenic tobacco. A, Visual phenotypes of wild-type and transgenic tobacco seedlings grown under continuous red light for 10 d. B and C, Effects of the continuous red light on the cotyledon (B) and leaf (C) width. Wild-type and transgenic tobacco seeds were germinated and grown in the 1/2 MS medium under continuous red light. Error bars indicate the standard error (SE). The means ± SE obtained from at least 30 seedlings were plotted. Three independent transgenic lines (#5, #7 and #15) and wild-type tobacco (SR) were analyzed. Asterisks (*) and (**) denote significant differences (P < 0.05 and P < 0.01, respectively) according to the t-test. (Leivar and Quail, 2011). Sequence alignments showed that all of these PIFs share in common a conserved sequence motif at their N-terminal regions, designated as the active phytochrome-binding (APB) motif (active phytochrome-binding protein, also named as PIL motif). Four invariant amino acid residues (ELxxxxGQ) common in all PIFs are critical determinants of the APB motif. This motif is necessary for binding to the biologically active Pfr form of phyb (Khanna et al, 2004). Nakamura et al (2007) identified six candidate genes encoding putative PIFs via homologous analysis in rice genome, designated as OsPIL11 to OsPIL16. These six putative PIF factors contain APB motif at their N-termini, suggesting the possible interaction between PIF and phytochromes in rice (Nakamura et al, 2007). In this study, the expression of OsPIL11 gene showed organ-specificity and was regulated by rice development (Fig. 1). Thus, it is deduced that OsPIL11 acts in some developmental stages or in different organs in rice. Nakamura et al (2007) could not detect OsPIL11 transcripts using Northern blot hybridization, probably due to the low mrna abundance in rice cell. In this study, we observed the light-induced repression of OsPIL11 gene expression using RT-PCR analysis (Fig. 1-B), which is similar to the expression pattern of OsPIL5 (Nakamura et al, 2007). In addition, our results suggest that exogenous ABA repressed the

LI Li, et al. Expression Patterns of OsPIL11 and Its Roles in Light Signal Transduction 267 expression of OsPIL11, whereas JA and SA induced the expression of OsPIL11 (Fig. 1-C and -D). Based on these results, we deduce that OsPIL11 might function in multiple hormone signaling pathways. Regulation of Arabidopsis PIF genes by various hormones was searched in Genevestigator database. ABA induced the expression of PIF3 gene, but repressed the PIF1 expression, similar to the effect of ABA on OsPIL11 gene expression in rice. However, SA and JA did not affect the expression of Arabidopsis PIF genes (Zimmermann et al, 2004; Castillon et al, 2007). Recently, the relation between ABA pathway and PIF1 were comprehensively dissected. In Arabidopsis, PIF1 activates ABA anabolic genes and represses ABA catabolic genes, resulting in the increase of ABA level. However, light signals perceived by phytochromes (mainly phyb) induce the PIF1 degradation to decrease ABA biosynthesis (Kim et al, 2008; Shen et al, 2008). Based on the role of PIF1 in ABA pathway, we hypothesize that deficiency of phytochromes probably causes ABA accumulation by up-regulating OsPIL11. However, it is necessary to test this hypothesis by analyzing the transgenic rice plants either with over-expressed OsPIL11 or with reduced OsPIL11. In addition, we observed that phya- and phyb-mediated light signals regulate JA and SA pathways (Xie et al, 2011). In the future, we will further analyze whether OsPIL11 is involved in the phytochrome-regulated JA and SA pathways. Light signals initiate a variety of de-etiolation responses to promote photoautotrophic survival in Arabidopsis, which include inhibition of hypocotyl elongation and expansion of cotyledons. To analyze the roles of OsPIL11 in light transduction, we produced the transgenic tobacco with over-expressed OsPIL11. Hypocotyl length and cotyledon size were analyzed in transgenic tobacco seedlings grown under red and far-red light. Under continuous red light, transgenic tobacco seedlings exhibited shortened hypocotyl length and enlarged cotyledon and the first leaves, compared with non-transgenic tobacco seedlings (Fig. 3). These results suggested that OsPIL11 positively regulate the red light-induced de-etiolation responses in transgenic tobacco. However, these phenotypes are inconsistent with the report by Nakamura et al (2007), who transformed Arabidopsis plants (ecotype Col) with OsPIL11 gene under the control of the strong cauliflower mosaic virus (CaMV) 35S promoter. Transgenic Arabidopsis seedlings were grown under 8 h light/16 h dark cycle conditions for 5 d and exhibited longer hypocotyl than wild-type Arabidopsis, suggesting the negative regulation of OsPIL11 in Arabidopsis. This inconsistence is probably due to the different growth conditions and light fluence. The continuous monochromatic lights with strong light fluence rate [(150 mol/(m 2 s) when reaching plants] were used in our study. In contrast, the day-night photoperiodic conditions in white light of relative low fluence rate was used in the study (Nakamura et al, 2007) in which authors referred to light resources as 15 to 40 mol/(m 2 s) from the top, 50 to 90 mol/(m 2 s) from the side, and did not point out the fluence rate of light reaching plants. Therefore, we will examine the phenotypes in transgenic tobacco grown under red light with different light intensities in the future. In addition, it has also been reported that some of Arabidopsis PIFs negatively regulate seedling deetiolation response, but positively regulate chloroplast development and accumulation of anthocyanin (Kim et al, 2003). For example, pif3 and pif4 mutants showed shortened hypocotyl and expanded cotyledon (Huq and Quail, 2002; Kim et al, 2003; Monte et al, 2004), but less chlorophyll content (Kim et al, 2003). Noticeably, transgenic tobacco and non-transgenic tobacco seedlings had similar phenotypes when grown under continuous far-red light (Fig. 2-C), suggesting that OsPIL11 is not probably involved in far-red light regulated photomorphogenesis. Thus, it is worth doubting whether OsPIL11 physically interact with phya. Moreover, how does OsPIL11 act in photomorphogenesis in rice? Therefore, the physical interaction between phytochromes and OsPIL11 and the photomorphogenic characters of transgenic rice should be analyzed in the future experiments. ACKNOWLEDGEMENTS This work was partly supported by grants from the Chinese National Natural Science Foundation (Grant No. 30971744), the Chinese Ministry of Agriculture (Grant No. 2009ZX08001-029B), and the Shandong Natural Science Funds for Distinguished Young Scholar, China (Grant No. JQ200911). REFERENCES Castillon A, Shen H, Huq E. 2007. Phytochrome interacting factors: Central players in phytochrome-mediated light signaling networks. Trends Plant Sci, 12: 514 521. Franklin K A, Quail P H. 2010. Phytochrome functions in Arabidopsis development. J Exp Bot, 61: 11 24. Hood E E, Gelvin S B, Melchers L S, Hoekema A. 1993. New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res, 2: 208 218. Horsch R B, Fry J E, Hoffmann N L, Eichholtz D, Rogers S G, Fraley R T. 1985. A simple and general method for transferring genes into plants. Science, 227: 1229 1231.

268 Rice Science, Vol. 19, No. 4, 2012 Huq E, Al-Sady B, Hudson M, Kim C, Apel K, Quail P H. 2004. PHYTOCHROME-INTERACTING FACTOR 1 is a critical bhlh regulator of chlorophyll biosynthesis. Science, 305: 1937 1941. Huq E, Quail P H. 2002. PIF4, a phytochrome-interacting bhlh factor, functions as a negative regulator of phytochrome B signaling in Arabidopsis. EMBO J, 21: 2441 2450. Kevei E, Schafer E, Nagy F. 2007. Light-regulated nucleocytoplasmic partitioning of phytochromes. J Exp Bot, 58: 3113 3124. Khanna R, Huq E, Kikis E A, Al-Sady B, Lanzatella C, Quail P H. 2004. A novel molecular recognition motif necessary for targeting photoactivated phytochrome signaling to specific basic helix-loop-helix transcription factors. Plant Cell, 16: 3033 3044. Kim D H, Yamaguchi S, Lim S, Oh E, Park J, Hanada A, Kamiya Y, Choi G. 2008. SOMNUS, a CCCH-type zinc finger protein in Arabidopsis, negatively regulates light-dependent seed germination downstream of PIL5. Plant Cell, 20: 1260 1277. Kim J, Yi H, Choi G, Shin B, Song P S, Choi G. 2003. Functional characterization of phytochrome interacting factor 3 in phytochrome-mediated light signal transduction. Plant Cell, 15: 2399 2407. Leivar P, Quail P H. 2011. PIFs: Pivotal components in a cellular signaling hub. Trends Plant Sci, 16: 19 28. Martinez-Garcia J F, Huq E, Quail P H. 2000. Direct targeting of light signals to a promoter element-bound transcription factor. Science, 288: 859 863. Monte E, Tepperman J M, Al-Sady B, Kaczorowski K A. Alonso J M, Ecker J R, Li X, Zhang Y L, Quail P H. 2004. The phytochrome-interacting transcription factor, PIF3, acts early, selectively, and positively in light-induced chloroplast development. Proc Natl Acad Sci USA, 101: 16091 16098. Nakamura Y, Kato Y, Yamashino Y, Murakami M, Mizuno T. 2007. Characterization of a set of phytochrome-interactingfacor-like bhlh proteins in Oryza sativa. Biosci Biotechnol Biochem, 71: 1183 1191. Ni M, Tepperman J M, Quail P H. 1998. PIF3, a phytochrome- interacting factor necessary for normal photoinduced signal transduction, is a novel basic helix-loop-helix protein. Cell, 95: 657 667. Ni M, Tepperman J M, Quail P H. 1999. Binding of phytochrome B to its nuclear signaling partner PIF3 is reversibly induced by light. Nature, 400: 781 784. Rockwell N C, Su Y S, Lagarias J C. 2006. Phytochrome structure and signaling mechanisms. Ann Rev Plant Biol, 57: 837 858. Shen H, Zhu L, Castillon A, Majee M, Downie B, Huq E. 2008. Light-induced phosphorylation and degradation of the negative regulator PHYTOCHROME-INTERACTING FACTOR1 from Arabidopsis depend upon its direct physical interactions with photoactivated phytochromes. Plant Cell, 20: 1586 1602. Takano M, Inagaki N, Xie X Z, Yuzurihara N, Hihara F, Ishizuka T, Yano M, Nishimura M, Miyao A, Hirochika H, Shinomura T. 2005. Distinct and cooperative functions of phytochromes A, B, and C in the control of deetiolation and flowering in rice. Plant Cell, 17: 3311 3325. Takano M, Inagaki N, Xie X Z, Kiyota S, Baba-Kasai A, Tanabata T, Shinomura T. 2009. Phytochromes are the sole photoreceptors for perceiving red/far-red light in rice. Proc Nat Acad Sci USA, 106: 14705 14710. Xie X Z, Xue Y J, Zhou J J, Zhang B, Chang H, Takano M. 2011. Phytochromes regulate SA and JA signaling pathways in rice and are required for developmentally controlled resistance to Magnaporthe grisea. Mol Plant, 4: 688 696. Zhao X L. 2009. Phytochrome-interacting factors (PIFs) in plant. Plant Physiol Comm, 45: 531 536. (in Chinese) Zhu Y X, Tepperman J M, Fairchild C D, Quail P H. 2000. Phytochrome B binds with greater apparent affinity than phytochrome A to the basic helix-loop-helix factor PIF3 in a reaction requiring the PAS domain of PIF3. Proc Natl Acad Sci USA, 97: 13419 13424. Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W. 2004. GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiol, 136: 2621 2632.