Positive Regulation of Phytochrome B on Chlorophyll Biosynthesis and Chloroplast Development in Rice

Transcription

1 Rice Science, 2013, 20(4): Copyright 2013, China National Rice Research Institute Published by Elsevier BV. All rights reserved DOI: /S (13)60133-X Positive Regulation of Phytochrome B on Chlorophyll Biosynthesis and Chloroplast Development in Rice ZHAO Jie 1, 2, ZHOU Jin-jun 1, WANG Ying-ying 1, GU Jian-wei 1, XIE Xian-zhi 1, 2 ( 1 Shandong Rice Research Institute, Jinan , China; 2 College of Life Sciences, Shandong Normal University, Jinan , China) Abstract: Phytochromes in rice are encoded by a gene family composed of three members, PHYA, PHYB, and PHYC. Through characterizing the phytochrome mutants and wild type (WT) in terms of photomorphogenesis, roles of individual phytochromes have been preliminarily explored in regulating rice de-etiolation, flowering time and fertility. However, little information has been reported about whether or how phytochromes affect chlorophyll biosynthesis and chloroplast development in rice. In this study, we compared the chlorophyll contents of wild type and the phya, phyb and phyaphyb mutants grown under either white light (WL) or red light (R). The results suggest that phyb perceives R to positively regulate chlorophyll biosynthesis, while the role of phya can be detected only in the phyb-deficient mutant. Analyses of the expression levels of genes involved in chlorophyll biosynthesis revealed that phytochromes affected the chlorophyll biosynthesis by regulating protochlorophyll oxidoreductase A (PORA) expression. The role of phyb in chloroplast development was also analyzed, and the results suggest that phyb perceives R to regulate chloroplast development by affecting the numbers of chloroplasts and grana, as well as the chloroplast membrane system. Key words: rice; phytochrome; chlorophyll biosynthesis; protochlorophyll oxidoreductase A; chloroplast development For higher plants, light is not only an energy source for photosynthesis, but also a key environmental factor that influences plant growth and development. Plants use an array of light receptors including phytochrome (phy), cryptochrome and phototropin, to sense external light conditions such as the duration, wavelength and intensity of incident light, and to make adjustments to adapt the changing environment (Suetsugu and Wada, 2007; Bae and Choi, 2008; Franklin and Quail, 2010). Among them, the phy family mainly perceives red light (R) and far-red light (FR), and participates in regulating many important processes in the plant life cycle (Franklin and Quail, 2010; Gu et al, 2011). Plant phytochromes are soluble chromoproteins existing in two photoconversible forms in the cells, inactive R-absorbing form (Pr) and active FR-absorbing (Pfr). Following conversion to the Pfr form, phytochromes translocate to the nucleus. In the nucleus, phytochromes interact with other proteins and trigger a wealth of gene expression to regulate the photomorphogenesis (Takano et al, 2005, 2009; Liu et al, 2006; Franklin and Quail, Received: 25 January 2013; Accepted: 28 March 2013 Corresponding author: XIE Xian-zhi (xzhxie2010@163.com) 2010; Chen and Chory, 2011). De-etiolation is one of the important photomorphogenic characteristics in plants. Dark-grown rice seedlings display a skotomorphogenic phenotype, which is characterized by the absence of chlorophyll. Light signals induce chlorophyll biosynthesis and plant greening. In Arabidopsis, phytochromes are involved in the regulation of chlorophyll biosynthesis as demonstrated by the observation that phyb mutant had lower chlorophyll content under white or red light compared to wild type (Reed et al, 1993). By comparing photomorphogenic characteristics between phyb and phyaphyb mutants in Arabidopsis, phya and cryptochromes were also shown to play roles in regulating the chlorophyll biosynthesis (Reed et al, 1994; Casal and Mazella, 1998; McCormac and Terry, 2002). Chlorophyll biosynthesis is a complicated process that involves many enzymes (Wu et al, 2008; Shi et al, 2009). Analysis of the complete genome of Arabidopsis thaliana showed that there were at least 27 genes encoding 15 enzymes involved in chlorophyll biosynthesis from glutamyl-trna to chlorophyll b (Wu et al, 2007). In recent years, extensive studies have revealed that phytochromes play important roles in regulating chlorophyll biosynthesis. McCormac et al (2001)

2 244 observed that phya, phyb, cry1 and cry2 regulated the expression of glutamyl-trna reductase gene (HEMA1), thus affecting chlorophyll biosynthesis. In Arabidopsis, phytochrome-interacting factor 1 (PIF1) directly or indirectly regulates the expression of the key genes controlling the chlorophyll biosynthetic pathway, including protochlorophyllide oxidoreductase (POR), ferrochelatase (FeChII) and heme oxygenase (HO3) (Moon et al, 2008). Except for chlorophyll biosynthesis, PIF1 and PIF3 were proposed to be negative regulators that integrate light and circadian control in the regulation of chloroplast development (Stephenson et al, 2009). Rice phytochrome gene family is composed of three members known as PHYA, PHYB and PHYC (Kay et al, 1989; Dehesh et al, 1991; Basu et al, 2000). It has been preliminary elucidated that individual phytochromes display both unique and overlapping roles in rice photomorphogenesis by characterization of all rice phytochrome mutants (Takano et al, 2005, 2009; Xie et al, 2007, 2011; Liu et al, 2012). Although leaf blade exhibits pale green in the phyb mutant, we still have no experimental evidence about whether and how phytochromes influence the content of chlorophyll in rice. Moreover, the effect of rice phytochromes on chloroplast development has not been reported. In this study, we examined chlorophyll content and analyzed the expression of genes involved in the chlorophyll biosynthetic pathway in the wild type (WT) and the phya, phyb and phyaphyb mutants. In addition, we also analyzed the influence of R on the development of chloroplast as well as the role of phyb in R signaling. It is verified that phyb-mediated R signal plays an important role in both chlorophyll biosynthesis and chloroplast membrane development. Rice materials MATERIALS AND METHODS The genetic background of phya, phyb and phyaphyb mutants and WT used in this study is Oryza sativa L., cv Nipponbare. The phya and phyb mutants are phya4 and phyb1, respectively (Takano et al, 2001, 2005). Methods Determination of chlorophyll content After being dehusked and surface-sterilized, seeds of WT and phytochrome mutants were grown in 0.4% agar and incubated overnight at 4 C. Then the seeds were transferred to white light (WL; 28 C, lx) Rice Science, Vol. 20, No. 4, 2013 or R [28 C, 15 mol/(m 2 s)] and grown for 7 d. The above-ground parts were used for measuring the chlorophyll content based on the methods described by Zhang (1985) with a slight modification. The fresh sample (0.2 g) was cut into pieces in a motor with a small amount of quartz sand and calcium carbonate powder, and then ground well in 10 ml 95% ethanol. After filtered into a brown volumetric flask, the extracts were brought to a total volume of 25 ml with 95% ethanol. Absorbance values were measured at the wavelengths of 665 nm and 649 nm, recorded as A 665 and A 649, respectively. The concentrations (mg/l) of chlorophyll a (C a ) and chlorophyll b (C b ) were calculated as follows: C a = A A 649 ; C b = A A 665. The content of chlorophyll (mg/g) = (C a + C b ) the volume of extracts / sample fresh weight. Gene expression analysis Seedlings of WT and phytochrome mutants were grown under R at 28 C for 7 d, the above-ground parts were harvested for gene expression analysis. The fluence intensity of R was 15 mol/(m 2 s). Total RNA was isolated from above-ground parts using the RNAiso reagent (TaKaRa, Dalian, China). First-strand cdnas were synthesized from DNase I- treated total RNA using PrimeScript RT Enzyme Mix I (TaKaRa), according to the manufacturer s instructions. Real-time PCR was performed on the ABI 7900HT Real-time PCR System (Applied Biosystems) using SYBR Premix Ex Taq (TaKaRa). Each reaction contained 10 L of 2 SYBR Premix Ex Taq TM, 2.0 L of cdna samples, and 0.2 L gene-specific primer pairs (Table 1) in a final volume of 20 L. As an internal control, the rice ubiquitin gene OsUBQ2 (accession number AK059011) was used to quantify the relative transcript level of each target gene. Three replicate biological experiments were performed. Transmission electron microscopy analysis of chloroplast ultrastructure Seeds of the WT and phytochrome mutants were surface-sterilized and incubated at 28 C for 3 d to induce seed germination. The most uniformly germinated seeds were sown in a 96-well plate with the bottom removed. The plate was floated in Yoshida culture solution in a growth chamber (13 h light of lx, 25 C/11 h dark, 23 C) to the 3-leaf stage of rice seedlings. Then, a set of seedlings was transferred to the continuous R [28 C, 15 mol/(m 2 s)], while the other set was transferred to the continuous WL (28 C,

3 ZHAO Jie, et al. Phytochrome B Positively Regulates Chlorophyll Biosynthesis and Chloroplast Development in Rice 245 Table 1. Real time RT-PCR primers used in the study. Gene name Accession number Gene product Primer pairs (5-3 ) GluTR AK Glutamyl trna reductase CCACACGCCATCTGTTTGAG TTCCCAAGCCTCCACTGTTT GSA AK Glutamate-1-semialdehyde aminotransferase TGATGGAGCCTGGAACCTAC GGTGAAGAAGAACCCGAACA CPO AK Coproporphyrinogen III oxidase GCATAAACCCAAAGGAATGG AGGCTACAGAGTGCGAGGAA PPOX-1 AK Protoporphyrinogen oxidase GCCACAAGCCATACCACAGTT CGAGGAACAATCCATCATAACC CS AK Chlorophyll synthetase CAGGTGGTCTTTCAGTTCCAA GATTGCTGCTTTCATCAGTGG PORA AK NADPH-protochlorophyllide oxidoreductase GTTCTTGGGCGTTCGTCTC CAAACAGAGCATCAGCACAGA OsUBQ2 AK Ubiquitin AACCAGCTGAGGCCCAAGA ACGATTGATTTAACCAGTCCATGA lx). When plants were cultured to the 4-leaf stage, the leaf section of 0.5 cm 0.5 cm were cut from the middle of the 4th leaf and quickly fixed in 2.5% glutaraldehyde and further fixed in 1% OsO 4, then the chloroplast ultrastructure was observed. RESULTS phyb-mediated red signal positively regulates chlorophyll biosynthesis Although several reports revealed that phytochromes affected chlorophyll biosynthesis in Arabidopsis, little information about that has been reported in rice. We compared chlorophyll contents of the WT, phya, phyb and phyaphyb mutants grown in either WL or R. The chlorophyll contents exhibited similar tendency in the materials grown under both light conditions. The chlorophyll content in the phya mutant was basically the same as that in WT, whereas the chlorophyll content was decreased in the phyb mutant compared to that in WT. The decrease was more obvious in the phyaphyb double mutants (Fig. 1). These results suggest that phyb plays an important role in chlorophyll biosynthesis. Although the deficiency of phya has little effect on the chlorophyll content, phya makes a big contribution to chlorophyll accumulation under the phyb-deficiency background. As shown in Fig. 1, the chlorophyll contents were obviously lower in all materials grown under R relative to those under WL, suggesting that lights with wavelengths other than R also regulate the metabolism of chlorophyll. The chlorophyll content in phyb mutant grown in R was significantly lower than that of the WT (Fig. 1), suggesting that phyb-mediated R signaling plays an important role in the chlorophyll biosynthesis. The chlorophyll content in the phyaphyb double mutant grown under R was almost under the measurable limit, which supports the conclusion by Takano et al (2009) that phytochromes are the sole photoreceptors for perceiving red/far-red light in rice. We further analyzed the expression of important genes involved in the chlorophyll biosynthetic pathway in the WT and phytochrome mutants grown under R (Table 1). The transcript levels of GSA and PPOX-1 were higher in the phya mutant, but lower in the phyb mutant, compared to those in the WT (Fig. 2). The transcript levels of CPO were lower in the phya and phyb mutants than in the WT. CS gene was similarly expressed in the WT, phya and phyb mutants. However, the transcript levels of GSA, CPO, PPOX-1 and CS were significantly decreased in the phyaphyb double mutant compared to those in the WT, phya and phyb mutants (Fig. 2). These results suggest that phya and phyb perceive R to positively regulate the expression of these genes in a highly redundant way. Fig. 1. Chlorophyll content in seedlings of wild type (WT), phya, phyb and phyaphyb mutants grown under continuous white light or red light. Seedlings of WT and phytochrome mutants were grown under continuous white light (7 900 lx) or continuous red light [15 mol/(m 2 s)] for 7 d. The above-ground parts were used to measure chlorophyll content. The error bars represent the standard error.

4 246 Rice Science, Vol. 20, No. 4, 2013 Effects of phyb-mediated light signals on chloroplast development Fig. 2. Expression levels of genes involved in chlorophyll biosynthesis in wild type (WT) and phytochrome mutants. Seedlings of WT and phytochrome mutants were grown under continuous red light [15 mol/(m 2 s)] for 7 d. The above-ground parts were used to analyze the gene expression. The error bars represent the standard error. The expression of PORA was slightly higher in the phya mutant, but lower in the phyb mutant relative to that in the WT (Fig. 2). By comparison, PORA mrna was greatly reduced in the phyaphyb double mutant (Fig. 2). These results suggest that phyb-mediated R signaling plays an important role in regulating PORA gene expression; phya also influences the PORA gene expression in the phyb-deficiency mutant. Strangely, the transcript levels of GluTR gene were higher in the phya and phyb mutants than in the WT, and were significantly decreased in the phyaphyb double mutant (Fig. 2). Taken together, the expression pattern of PORA gene under R is consistent with the chlorophyll content in the study, suggesting that phyb affects the chlorophyll biosynthesis probably via regulating PORA gene expression. Since phyb-mediated red signal regulates chlorophyll biosynthesis, it is interesting to analyze whether phyb-mediated red light signal also has a role in chloroplast development. To this end, we compared the development and ultrastructure of chloroplast in the WT and phyb mutant grown under either WL or R. The chloroplast numbers per mesophyll cell in the WT and phyb mutant grown under R were less than those under WL (Fig. 3-A). There were no significant differences in the chloroplast number per mesophyll cell in the WT and the phyb mutant grown under WL, whereas the chloroplast number per mesophyll cell in the phyb mutant was significantly reduced relative to that of the WT grown under R (Fig. 3-A). When plants were grown under WL, the number of grana per chloroplast was essentially the same in the WT as in the phyb mutant. By comparison, the number of grana per chloroplast in the phyb mutant was significantly less than that in the WT when grown under R (Fig. 3-B). These results suggest that phyb-mediated R signaling has an important role in chloroplast development and the formation of grana in rice. In addition, WT and phyb mutant have fewer number of chloroplasts and grana when grown under R than under WL (Fig. 3-A and -B). Thus, lights at wavelengths other than R also affect the development of chloroplasts and grana. Analysis of chloroplast ultrastructure revealed the obvious difference in the WT and the phyb mutant (Fig. 3-C). In plants grown under WL, the membrane Fig. 3. Comparison of chloroplast development in wild type (WT) and phyb mutant grown under either white light (WL) or red light (R). A, The number of chloroplasts per mesophyll cell in the leaves of the WT and phyb mutant under either continuous WL or continuous R. The means ± SE were obtained from, at least, 40 mesophyll cells plotted. B, The number of grana per chloroplast in the leaves of the WT and phyb mutant grown under either continuous WL or continuous R. The means ± SE were obtained from, at least, 30 chloroplast cells plotted. C, Ultrastructure of chloroplasts in the leaves of the WT and phyb mutant under either continuous WL or continuous R. * and ** denote significant differences at P 0.05 and P 0.01, respectively, according to t-test.

5 ZHAO Jie, et al. Phytochrome B Positively Regulates Chlorophyll Biosynthesis and Chloroplast Development in Rice 247 structure was relatively complete, and the granal stack obviously appeared (Fig. 3-C). Under R, however, the membrane structures in the chloroplast of the WT and the phyb mutant were not as complete as under WL (Fig. 3-C). Gaps appeared between grana lamellae in the wild-type chloroplasts, whereas membrane structures seemed seriously damaged in the phyb mutants grown under R, as indicated by less granal stack and obscure outer membrane of chloroplasts (Fig. 3-C). These results indicate that the phyb-mediated red signaling is necessary for the development of chloroplast membrane. DISCUSSION Our results showed that the chlorophyll content in the phyb mutant was less than half of that in the WT under R (Fig. 1), suggesting that phyb perceives R to positively regulate the chlorophyll biosynthesis in rice. The chlorophyll content in the phyaphyb double mutant grown under R was at the limit of measurement in the study (Fig. 1), indicating that phya is also involved in the chlorophyll biosynthesis. However, the chlorophyll content of the phya single mutant was the same as that of the WT (Fig. 1). From these results, we deduce that phya and phyb have highly redundant roles in the chlorophyll biosynthesis, and phya makes a big contribution to the chlorophyll biosynthesis under the phyb-deficient background. Such feature of phya functions has also been observed in diverse R- induced photomorphogenic responses in rice (Takano et al, 2005). Under continuous R, phyb mutants exhibited longer coleoptiles than the WT, while phya and WT had similar length of coleoptiles. However, the phyaphyb mutants grown under continuous R had coleoptiles as long as that of the etiolated seedlings (Takano et al, 2005). Under long-day conditions, the phya mutants flowered at the same time as the WT, and the flowering of the phyb was about 12 d earlier than the WT, whereas the phyaphyb double mutant flowered dramatically earlier than the phyb single mutant (Takano et al, 2005). The functional redundancy of phya and phyb was also observed in Arabidopsis, such as R-regulated inhibition of hypocotyl growth and expansion of cotyledons (Reed et al, 1994; Neff and Chory, 1998; Franklin and Quail, 2010). These results indicate that phya and phyb regulate R responses in a highly redundant way. In this study, phyb-mediated regulation of R on PORA gene expression was likely to be one of key factors controlling the chlorophyll content (Fig. 2). Similarly, phytochrome-mediated light signal induced the PORA gene expression in barley (Batsuschauer and Apel, 1984; Mösinger et al, 1985). Moreover, the activity of the PORA enzyme also requires the presence of light (Mapleston and Griffiths, 1980; Heyes and Hunter, 2005). In Arabidopsis, phya or phyb regulates chlorophyll biosynthetic pathway by interacting with PIF1 factor (Huq et al, 2004; Moon et al, 2008). To our knowledge, however, little information about light signal transduction pathway in rice has been reported, therefore, the mechanism by which phyb regulates the expression of PORA gene remains unclear. Under R, the phyb mutant had incomplete membrane and less granal stack (Fig. 3-C), which is similar to the phenotype of Arabidopsis pif1pif3 transferred from darkness to light (Stephenson et al, 2009). The chlorophyll biosynthesis happens in the thylakoid membrane (Rüdiger et al, 1980). Thus it is speculated that incomplete membrane structure in the chloroplasts of phyb mutant grown under R probably affects the chlorophyll biosynthesis. Moreover, it has been reported that transcript levels of Lhcb (light-harvesting chlorophyll a/b binding protein) gene in the phyb mutants were significantly lower than those in the WT seedlings grown under R (Takano et al, 2005), suggestive of developmental deficiency of chloroplasts in R-grown phyb mutants. In R-grown WT, the membrane structure of chloroplasts is well developed (Fig. 3-C), suggesting that phya (or phyc) perceives R to regulate chloroplast development. Under WL, there is not much difference in ultrastructures of chloroplasts in the WT and the phyb mutant, indicating the involvement of lights with wavelengths other than R in the chloroplast development. ACKNOWLEDGEMENTS This work was supported by the grants from the National Natural Science Foundations of China (Grant Nos and ), the National Major Science and Technology Project to Create New Crop Varieties Using Gene Transfer Technology, China (Grant No. 2009ZX B), and the Shandong Natural Science Funds for Distinguished Young Scholar, China (Grant No. JQ200911). REFERENCES Bae G, Choi G Decoding of light signals by plant phytochromes and their interacting proteins. Annu Rev Plant Biol, 59: Basu D, Dehesh K, Schneider-Poetsch H J, Harrington S E,

6 248 Rice Science, Vol. 20, No. 4, 2013 McCouch S R, Quail P H Rice PHYC gene: Structure, expression, map position and evolution. Plant Mol Biol, 44: Batsuschauer A, Apel K An inverse control by phytochrome of the expression of two nuclear genes in barley (Hordeum vulgare L.). Eur J Biochem, 143: Casal J J, Mazella M A Conditional synergism between cryptochrome 1 and phytochrome B is shown by the analysis of phya, phyb, and hy4 simple, double, and triple mutants in Arabidopsis. Plant Physiol, 118(1): Chen M, Chory J Phytochrome signaling mechanisms and the control of plant development. Trends Cell Biol, 21(11): Dehesh K, Tepperman J, Christensen A H, Quail P H phyb is evolutionarily conserved and constitutively expressed in rice seedling shoots. Mol Gen Genet, 225: Franklin K A, Quail P H Phytochrome functions in Arabidopsis development. J Exp Bot, 61: Gu J W, Liu J, Xue Y J, Zang X, Xie X Z Functions of phytochrome in rice growth and development. Rice Sci, 18(3): Heyes D J, Hunter C N Making light work of enzyme catalysis: Protochlorophyllide oxidoreductase. Trends Biochem Sci, 30: Huq E, Al-Sady B, Hudson M, Kim C, Apel K, Quail P H Phytochrome-interacting factor 1 is a critical bhlh regulator of chlorophyll biosynthesis. Science, 305: Kay S A, Keith B, Shinozaki K, Chua N H The sequence of the rice phytochrome gene. Nucl Acids Res, 17: Liu H W, Zhou R Y, Xu L Participation of phytochrome in sterility alteration of photoperiod-sensitive female sterile ramie. Acta Agron Sin, 32: (in Chinese with English abstract) Liu J, Zhang F, Zhou J J, Chen F, Wang B S, Xie X Z Phytochrome B control of total leaf area and stomatal density affects drought tolerance in rice. Plant Mol Biol, 78: Mapleston E R, Griffiths W T Light modulation of the activity of the protochlorophyllide oxidoreductase. Biochem J, 189: McCormac A C, Fischer A, Kumar A M, Söll D, Terry M J Regulation of HEMA1 expression by phytochrome and a plastid signal during de-etiolation in Arabidopsis thaliana. Plant J, 25: McCormac A C, Terry M J Loss of nuclear gene expression during the phytochrome A-mediated far-red block of greening response. Plant Physiol, 130: Moon J, Zhu L, Shen H, Huq E PIF1 directly and indirectly regulates chlorophyll biosynthesis to optimize the greening process in Arabidopsis. Proc Natl Acad Sci USA, 105: Mösinger E, Batschauer A, Schäfer E, Apel K Phytochrome control of in vitro transcription of specific genes in isolated nuclei from barley (Hordeum vulgare). Eur J Biochem, 147: Neff M M, Chory J Genetic interactions between phytochrome A, phytochrome B, and cryptochrome 1 during Arabidopsis development. Plant Physiol, 118(1): Reed J W, Nagpal P, Poole D S, Furuya M, Chory J Mutations in the gene for red/far-red light receptor phytochrome B alter cell elongation and physiological responses throughout Arabidopsis development. Plant Cell, 5: Reed J W, Nagatani K, Elich T D, Fagan M, Chory J Phytochrome A and phytochrome B have overlapping but distinct functions in Arabidopsis development. Plant Physiol, 104: Rüdiger W, Benz J, Guthoff C Detection and partial characterization of activity of chlorophyll synthetase in etioplast membranes. Eur J Biochem, 109: Shi D Y, Liu Z X, Jin W W Biosynthesis, catabolism and related signal regulations of plant chlorophyll. Hereditas, 31(7): (in Chinese with English abstract) Stephenson P G, Christian F, Matthew J T PIF3 is repressor of chloroplast development. Proc Natl Acad Sci USA, 106: Suetsugu N, Wada M Chloroplast photorelocation movement mediated by phototropin family proteins in green plants. Biol Chem, 388: Takano M, Kanegae H, Shinomura T, Miyao A, Hirohiko H, Furuya M Isolation and characterization of rice phytochrome A mutants. Plant Cell, 13: Takano M, Inagaki N, Xie X Z, Yuzurihara N, Hihara F, Ishizuka T, Yano M, Nishimura M, Miyao A, Hirochika H, Shinomura T Distinct and cooperative functions of phytochromes A, B and C in the control of deetiolation and flowering in rice. Plant Cell, 17: Takano M, Inagaki N, Xie X Z, Kiyota S, Baba-Kasai A, Tanabata T, Shinomura T Phytochromes are the sole photoreceptors for perceiving red/far-red light in rice. Proc Natl Acad Sci USA, 106: Wu Z M, Zhang X, He B, Diao L P, Sheng S L, Wang J L, Guo X P, Su N, Wang L F, Jiang L, Wang C M, Zhai H Q, Wan J M A chlorophyll-deficient rice mutant with impaired chlorophyllide esterification in chlorophyll biosynthesis. Plant Physiol, 145(1): Wu Z M, Zhang X, Wan J M Molecular regulation of chlorophyll biosynthesis. Plant Physiol Commun, 44(6): (in Chinese) Xie X Z, Shinomura T, Inagaki N, Kiyota S, Takano M Phytochrome-mediated inhibition of coleoptile growth in rice: Age-dependency and action spectra. Photochem Photobiol, 83: Xie X Z, Xue Y J, Zhou J J, Zhang B, Chang H, Takano M Phytochromes regulate SA and JA signaling pathways in rice and are required for developmentally controlled resistance to Magnaporthe grisea. Mol Plant, 4(4): Zhang Q D Methods to measure chlorophyll. Chin Bull Bot, 3: (in Chinese)