Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids

Transcription

1 Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined precisely before sowing by comparing the initial soil weight with the dry soil weight. Two seeds per pot were planted and the pots were distributed in the growth chamber in a randomized design. Seeds were germinated in the dark for 3 days and then exposed to light for 16 h per day (long-day condition). The seedlings were fed for 1 week twice a day by spraying with a modified onetenth strength Hoagland solution (Hoagland and Arnon, 1950). After 1 week, one randomly chosen seedling per pot was kept for further growth. For fully watered conditions, soil water content was automatically adjusted each day to 35% by addition to each pot of an appropriate volume of modified one-tenth strength Hoagland solution. This continued until the end of the experiment (plant harvesting). Water-stressed plants were grown under the same environmental conditions until they formed two true leaves, corresponding to the L2 stage, when soil water content was allowed to decrease to 23%. This was maintained by daily automatic watering with the appropriate volume of modified one-tenth strength Hoagland solution until the end of the experiment. Phenotyping: experimental design, data collection and analyses EpiRIL population initial phenotyping Nine to ten seeds per epiril were sown in one large pot (130-mm diameter). Flowering time was determined as days after germination to the formation of the first flower bud. Rosette growth was assessed visually and recorded for 5-week-old plants. NATURE PLANTS 1

2 Screening for hybrid vigour For first phenotyping of F1 hybrids derived from test crosses of epiril to WT, seven individual plants per F1 line were grown with seven parental epiril and seven WT plants. Experiments were performed in duplicate. Rosette areas were assessed visually on 7-day-old seedlings twice per week until bolting. For combinations for which initial phenotyping revealed possible hybrid vigour relative to parental lines, additional F1 seeds were produced by pollinating three additional epiril plants with WT pollen. Two replicates of seven seeds per epiril x WT F1 hybrid line and parental lines (epiril and WT) were sown in a randomized-block design with a unique encrypted number and subjected to a test in which the most vigorous plants were marked. The corresponding epigenotypes were only revealed at the end of the experiment ("double-blind" experimental setup). Fresh and dry biomass measurements At 18 days after sowing and at the time the rosettes reached their final size (formation of the first silique), the aerial parts of 10 plants per line were harvested; the stem, when present, was detached from the rosette and discarded. The rosette leaves were weighed to determine their fresh biomass. For determination of dry rosette biomass, each individual rosette was allowed to dry at 65 C before reweighing. Phenological measurements Individual pots were automatically photographed on a daily basis during the whole experiment (Granier et al. 2006). Leaf developmental stage L2 (formation of the two first true leaves) and bolting (formation of the first visible flower bud) were scored visually for each individual plant (20 plants per line until day 18, then 10 plants per line until the end of vegetative growth) based on the daily photographs. 2 NATURE PLANTS

3 SUPPLEMENTARY INFORMATION Seed area measurements Between 35 and 55 seeds per line were placed on a sheet of paper and photographed. Individual seed surface was measured using image-analysis software (ImageJ). Fresh biomass measurements of 15-day-old plants Following a 3-day period of stratification, plants were grown for 15 days in Geneva (Switzerland) and whole rosettes were harvested and weighed. Root length measurements Ten seeds per line were sown on MS agar plates and stratified for 4 days. Plates were placed vertically in the growth chamber and 10 roots per line were photographed at day 7 after germination and their length measured using image-processing software (ImageJ). Classification of differentially expressed genes Expression levels of the F1s and the midparent were compared using two-samples with equal variance t-tests; the comparisons of WT, epi31 and the F1s were made using paired t-tests. Genes of the three epigenotypes with average microarray signals lower than 100 units were considered to be non-expressed genes and were not included in the analysis. Genes whose expression levels exhibited a less than 1.2-fold change between any two of the three epigenotypes were considered not differentially expressed and were not characterized further. In total, 1705 genes met the above criteria and were further ranked using previously described t-tests according to their expression levels in the F1s relative to the parents. Dominant gene expression level was defined by a significant difference between the transcript level in the F1 and the midparent value, plus a statistical difference between the F1 and one of the parents (epi31-like and WT-like expression compared with WT and epi31, respectively). Semi-dominant gene expression level was defined as an F1 transcript level statistically different to one of the parents NATURE PLANTS 3

4 (semi epi31-like and semi WT-like expression compared with WT and epi31, respectively) but not statistically different to the midparent value. Transgressive gene expression level relates to the situation in which the F1 transcript level was statistically different to the midparent as well as to both parents. Within this category, underdominant describes the situation in which the F1 transcript level was statistically lower than the parent, and overdominant describes an F1 mrna level higher than the parent. An additive gene expression level is characterized by a non-significant difference between the F1 and the midparent value but a significant difference between the F1 and the two parents. Genes assigned to the various classes were analysed further. A total of 232 genes could not be assigned to any of the defined gene expression categories and were therefore excluded. Epigenetic analysis of DE genes Promoter regions of DE genes were divided into two sub-regions of 1 kb each. The first sub-region corresponded to 1 kb directly upstream of the transcription start and the second 1 kb sub-region preceded the first. Arbitrary thresholds of 0.2 and 2 were used to define the presence of DNA methylation and sirnas, respectively. A promoter was considered to be methylated and/or harbouring sirnas when the levels of DNA methylation and/or sirnas, respectively, were above the thresholds in at least one sub-region. Primer sequences and qrt-pcr conditions Primers used for amplification of ACT2 cdna were as described in Ni et al. (2009); primer sequences for RPP5 amplification were GGGTGCAAGCTCTCACAGATATAG (forward primer) and GCTTCATTAGGCCCGTTCAG (reverse primer).the PCR conditions were 95 C for 5 min followed by 45 cycles alternating between 45 s at 95 C and 45 s at 60 C. Supplementary References 4 NATURE PLANTS

5 SUPPLEMENTARY INFORMATION Granier C, Aguirrezabal L, Chenu K, Cookson SJ, Dauzat M, Hamard P, Thioux J-J, Rolland G, Bouchier- Combaud S, Lebaudy A, et al PHENOPSIS, an automated platform for reproducible phenotyping of plant responses to soil water deficit in Arabidopsis thaliana permitted the identification of an accession with low sensitivity to soil water deficit. New Phytol 169: Hoagland DR and Arnon D The water-culture method for growing plants without soil. Californian Agricultural Experimental Station Circular 347: Lister R, O Malley RC, Tonti-Filippini J, Gregory BD, Berry CC, Millar a H, Ecker JR Highly integrated single-base resolution maps of the epigenome in Arabidopsis. Cell 133: Ni Z, Kim E-D, Ha M, Lackey E, Liu J, Zhang Y, Sun Q, Chen ZJ Altered circadian rhythms regulate growth vigour in hybrids and allopolyploids. Nature 457: Zhang X, Yazaki J, Sundaresan A, Cokus S, Chan SW-L, Chen H, Henderson IR, Shinn P, Pellegrini M, Jacobsen SE, et al Genome-wide high-resolution mapping and functional analysis of DNA methylation in Arabidopsis. Cell 126: NATURE PLANTS 5

6 Supplementary Figures: Supplementary figure 1: Selection of the parental lines and screening for hybrid vigour. A: Classification of epirils according to phenotypes of rosettes and flowering time. Ten plants of each epiril (68 lines) were grown and rosette phenotype and flowering time were scored. EpiRILs exhibiting rosette phenotypes similar to the WT (normal development and growth) and early flowering were pollinated with isogenic WT pollen to generate F1 hybrid lines that were further tested for heterotic potential. B: Results of screening for hybrid vigour. Two replicates of seven plants per line (two parental lines 6 NATURE PLANTS

7 SUPPLEMENTARY INFORMATION and the tested hybrid line) were grown and F1 rosette size compared to the parents twice per week from 7 days after germination until bolting. The epiril parent is indicated in the first lane of the table and the second lane illustrates the results of F1 screening: (-) no increase in rosette size, (+) F1 rosettes were larger than controls at 7 days after germination but attained a surface area similar to the parents shortly after, (++) the F1 were heterotic for rosette area until the first plants bolted. C: Images of WT, epi31 and epi31 x WT F1 hybrids before bolting. The size of the epi31 x WT rosettes was such that both parents were consistently recognizable in a double-blind experiment. NATURE PLANTS 7

8 Supplementary figure 2: Fresh and dry biomass during vegetative growth. Six independent F1 lines: three WT x epi31 (light grey), three epi31 x WT (dark grey), parental controls WT x WT (black), epi31 x epi31 (white) were grown under well-watered conditions. Fresh and dry biomasses were measured on 18-day-old plants (18D) and at the end of vegetative growth (F). Vertical bars represent standard deviations (n=10), and the letters above the results of the statistical tests (P <0.05) for differences between the lines. A: Fresh biomass of 18-day-old plants. B: Final fresh biomass. C: Dry biomass of 18-day-old plants. D: Final dry biomass. 8 NATURE PLANTS

9 A SUPPLEMENTARY INFORMATION B Supplementary figure 3: Leaf development during vegetative growth. Six independent F1 lines (three WT x epi31 with WT as female (light grey) and three epi31 x WT, with epi31 as female (dark grey), and the parental controls WT x WT (black) and epi31 x epi31 (white) were grown under wellwatered conditions and individual leaf surfaces as well as total numbers of leaves were measured at 18 days (18D) and at the end of vegetative growth (F). Vertical bars represent standard deviations (n=10) and the letters above the results of the statistical tests (P <0.05) for differences between the lines. A: Areas of individual rosette leaves at the end of rosette growth. B: Leaf numbers in rosettes at the end of growth. NATURE PLANTS 9

10 Supplementary figure 4: Vegetative development of the F1 lines. Six independent F1 lines: three WT x epi31 (light grey), three epi31 x WT (dark grey), the parental controls WT x WT (black), and epi31 x epi31 (white) were grown under well-watered conditions and the developmental stage of each plant scored with time. Vertical bars represent standard deviation (n=10), and the letters above the results of the statistical tests (P <0.05) for differences between the lines. A: Appearance of the first two true leaves (L2 stage). B: Appearance of the first open flower (bolting stage). 10 NATURE PLANTS

11 SUPPLEMENTARY INFORMATION Supplementary figure 5: Individual seed areas of WT, epi31 and F1 hybrids. Individual seed areas were measured for three WT x epi31 F1 lines (light grey), three epi31 x WT F1 lines (dark grey) and the parental lines (WT x WT (black bar), and epi31 x epi31 (white bar)). Vertical bars represent standard deviation (35<n<53) and the letters above the results of the statistical tests (P <0.05) for differences between the lines. NATURE PLANTS 11

12 A B C D Supplementary figure 6: Genome-wide transcription profiles of the heterotic epi31 x WT hybrids and their parental lines. RNA was extracted from three biological replicates of three rosettes grown for 15 days and hybridized with the Arabidopsis Tiling 1.0R Array. A: Proportion of differentially expressed (DE) genes between WT, epi31 and epi31 x WT heterotic F1s.B: Distribution of DE genes in hybrids according their coding capacity. C: Distribution of DE genes in hybrids according to the expected additive (midparent) expression level. D: Distribution of coding capacities among F1 transcription levels. 12 NATURE PLANTS

13 SUPPLEMENTARY INFORMATION Supplementary figure 7: Gene ontology of DE and non-additively expressed genes. The distribution of gene ontology for differentially expressed (DE) genes (grey) and for non-additively expressed genes (white) was compared to the gene ontology according to TAIR. NATURE PLANTS 13

14 Supplementary figure 8: Distributions of fresh biomass of 15-day-old heterotic hybrids, parental controls, and F2 progenies. Fresh biomass of rosettes of individuals 15 WT (black bars), epi31 (white bars) epi31 x WT F1 (grey bars), and 200 individuals F2 progeny (dotted bars) were measured. 14 NATURE PLANTS

15 SUPPLEMENTARY INFORMATION Supplementary figure 9: Fresh biomass of 15-day-old rosettes of C24 and Col-0-derived hybrids. C24 was used as the pollen donor to pollinate two to three (herein referred as A, B and C) WT Col-0 (dark blue) and epi31 (light blue) plants. Ten plants per line were grown in a randomized plot design and the fresh biomasses of 15-day-old rosettes measured. Vertical bars represent standard deviations and the letters above the results of the statistical tests (P <0.05) for differences between the lines. NATURE PLANTS 15

16 Supplementary figure 10: Root length of 7-day-old seedlings of epi31 x WT and parental lines. Three epi31 plants were crossed to WT generating epi31 x WT F1 A, B, and C lines. Ten seeds per line were sown on vertical MS agar plates and the root lengths of 7-day-old seedlings measured. Vertical bars represent standard deviations (n=10) and the letters above the results of the statistical tests (P <0.05) for differences between the lines. 16 NATURE PLANTS

17 SUPPLEMENTARY INFORMATION Supplementary figure 11: Epigenetically regulated DE genes in heterotic hybrids. A: Distribution of DE genes according to the presence of epigenetic marks (sirnas and/or DNA methylation) in their promoters. Epigenetic information was based on epigenomic datasets from Col-0 WT (Zhang et al. 2006; Lister et al. 2008). Black bars represent the proportion of DE genes without epigenetic marks in their promoter regions and grey bars the proportion of genes with epigenetic marks in their promoter regions. The numbers in the grey bars indicate the number of genes under possible epigenetic regulation. B: Distribution of DE genes with and without epigenetic marks in their promoter regions according to their F1 transcript level types. Black bars represent the proportion of genes without and grey bars the proportion of genes with epigenetic marks in their promoter regions. The numbers in the grey bars indicate the number of genes with epigenetic marks. NATURE PLANTS 17