Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.
|
|
- Eileen Caldwell
- 6 years ago
- Views:
Transcription
1 Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny days (A) followed by about two weeks of cloudy/rainy conditions (B). They were transplanted to pots prior to be photographed. Phenotype of the abci8 mutant at tillering (C) and heading stage (D) after grown continuous rainy days for more than one month in the paddy field. E, Phenotype of WT and abci8 mutant at seed filling stage. F, Characterization of plant height, and tiller number in WT and abci8 mutant. Values shown were means±sd (n=30). Statistically significant differences were indicated by double asterisks (**P<0.01). Bar = 10 cm.
2 Supplementary Figure 2 Characterization of wild type (WT) and abci8 under different intensities of white light. A, Seedling phenotypes of WT and abci8 mutant under different intensities light conditions. NL, Normal white light (~100 μmol m -2 s -1 ); ML, Middle white light (14 μmol m -2 s -1 ); LL, Low white light (1.5μmol m -2 s -1 ); VL, Very low white light (0.2 μmol m -2 s -1 ). Photos were taken after treatment of different intensities light for 12 days. Bar=2 cm. B, Analysis of different pigments of WT and abci8 mutant seedlings grown under different intensities light conditions. Values were means±sd of three biological replicates. Chla, chlorophyll a; Chlb, chlorophyll b; Car, carotenoid.
3 Supplementary Figure 3 Identification of T-DNA insertion mutation in the OsABCI8 gene. A, Diagrammatic illustration of the rice ABCI8 gene showing the site of the T-DNA insertion. B, PCR-based analysis on the genomic DNAs of the wild-type control, the T-DNA insertion heterozygous (H) and homozygous (M) mutant. C, RT-PCR analysis of gene expression of ABCI8 in the wild-type plants (WT) and the T-DNA insertion mutant. ACTIN was used as a control. To perform RT-PCR analysis, leaves from WT and albino plants were collected from 35-day-old seedlings that were grown in a paddy field under 12 sunny days followed by 23 days of cloudy/rainy conditions. D, Thirty-five-old wild-type and mutant (M) seedlings are shown.
4 Supplementary Figure 4 Elemental analysis of Fe in the wild-type (WT) and mutant (M) plants with a T-DNA insertion mutation in the OsABCI8 gene at the albino stage. The plants were grown in a paddy field for 12 sunny days followed by 23 day of cloudy/rainy conditions. Data are means ± SD of three biological replicates. Significant difference from the corresponding wild-type value, based on the Student s t-test, are marked by ** (P < 0.01).
5 Supplementary Figure 5 Fe content of 4-week old WT and abci8 seedlings grown under white light conditions. The plants were grown in soil from a rice paddy with a 13/11h light/darkness photoperiod at a photon flux density of 150 µmol m 2 s 1 and constant temperature of 28 C in a growth chamber, after incubating seeds in darkness for 48 h at 26 C to ensure synchronized germination. Data are means ± SD of three biological replicates.
6 Supplementary Table 1 List of primers used in this study Primers Sequence (5 3 ) Experiments ID8-11F GCTTTGCTGTCTCCTTGGTC Map-based cloning ID8-11R TCGTGTGTGTAGCAGGATCA Map-based cloning RM26730F AATTCCTCCGGGTTCCCAATGC Map-based cloning RM26730R TGATCCCACTAACGACCAAGGTAAGG Map-based cloning RM26739F AAACAGTAGTTGGGTTGACTGG Map-based cloning RM26739R GGACGAGAGGAGTGTTAATTCG Map-based cloning IDM-2F AATGGCAAAGATGAACACTGG Map-based cloning IDM-2R TCCAAGACATTTGCTTTTACCA Map-based cloning IDM-4F TATCGAGGGTGCACCATTTT Map-based cloning IDM-4R CACTAGATCAAAGAGGCAGCG Map-based cloning ID7-22F TCCATTAAATTTCCAACCTCCT Map-based cloning ID7-22R AAAAACTACTCCCTCCGTTTCAT Map-based cloning ABC-gF GGTACCTGGCCTTACATTGCAGATCA Functional complement assay ABC-gR GGATCCGACCACAAGGTGTACCTATTTC Functional complement assay ABC-MF CCTGCGGAAATCTAGGGTCCT RT-PCR ABC-MR CACGATACCAACTCTTTGAGCAG RT-PCR I8RT80F TGCGGAAATCTAGGGTCCTC qrt-pcr I8RT351R GGTTCCTGGAGGTCGATAGC qrt-pcr I8RTR TCAGTGTTGTTTTGCTCTGC qrt-pcr I8AF GAAGCTTTATCTGTGAGCA qrt-pcr I8BF AGAAGCTTTATCTGTGTAAG qrt-pcr I8BR CTGAAATTCTCAAACTGCAC qrt-pcr ABC-EGFPF ACTAGTTCTAGAATGCAGGTGGTGGGGACGGC Subcellular localization ABC-EGFPR CCATGGGGATCCCACAGATAAAGCTTCTTCCT Subcellular localization ABC-GEXANF GGATCCCACTAGTATGCAGGTGGTGGGGACGGC Subcellular localization ABC-GEXANR GAATTCTCATCTAGAATTATCTCTCCATTGAAG Subcellular localization ABC-TL GCACTTCTTTGTGGGCATCG Identification of T-DNA insertion ABC-TR CTACCTGGCAGACAGGCATC Identification of T-DNA insertion NTLB5 AATCCAGATCCCCCGAATTA Identification of T-DNA insertion ACTINF AGCAACTGGGATGATATGGA RT-PCR endogenous control ACTINR CAGGGCGATGTAGGAAAGC RT-PCR endogenous control
7 Supplementary Table 2 Elemental analysis (mg. kg -1 ) Elements WT/abci8 Value 1 Value 2 Value 3 Average SD Mn WT abci Ca WT abci Mg WT abci Zn WT abci Fe WT abci Ni WT abci
GFP GAL bp 3964 bp
Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive
More informationTable S1 List of primers used for genotyping and qrt-pcr.
Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!
More informationNature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
More information** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.
Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *
More informationSupplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed
Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the
More informationFigure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin
More informationSupplemental Data. Chen and Thelen (2010). Plant Cell /tpc
Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector
More informationEXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA
EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
More informationGrowth and development of Arabidopsis thaliana under single-wavelength red
1 Supplementary Information 2 3 4 Growth and development of Arabidopsis thaliana under single-wavelength red and blue laser light 5 6 7 8 Authors Amanda Ooi 1 *, Aloysius Wong 1 *, Tien Khee Ng 2, Claudius
More informationEthylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis
Ethylene is critical to the maintenance of primary root growth and Fe homeostasis under Fe stress in Arabidopsis Guangjie Li, Weifeng Xu, Herbert J. Kronzucker, Weiming Shi * Supplementary Data Supplementary
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary
More informationHeterosis and inbreeding depression of epigenetic Arabidopsis hybrids
Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined
More informationSupplemental Data. Perrella et al. (2013). Plant Cell /tpc
Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization
More informationTable S1. Shimakawa et al.
Supplemental Table S1. Effects of ᴅ-glucose on photosynthesis in secondary algae Control 10 min in ᴅ-glucose Control 10 min in ᴅ-glucose E. gracilis O 2 evolution rate / µmol O 2 (mg Chl) 1 h 1 Relative
More informationNature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.
Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on
More informationPenghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao
New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang
More informationGENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL
GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1121356/dc1 Supporting Online Material for Polar PIN Localization Directs Auxin Flow in Plants Justyna Wiśniewska, Jian Xu, Daniela Seifertová, Philip B. Brewer, Kamil
More informationSupplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation
More informationSupplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and
More informationSupplementary Table 1. Primers used in this study.
Supplementary Tale 1. Primers used in this study. Name Primer sequence (5'-3') Primers of PCR-ased molecular markers developed in this study M1 F M1 R M2 F M2 R M3 F M3 R M4 F M4 R M5 F M5 R M6 F M6 R
More informationSUPPLEMENTARY INFORMATION
reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative
More informationSupplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and
More informationThe phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.
Series 2: Cross Diagrams - Complementation There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:
More informationSupplementary Methods
Supplementary Methods Microarray analysis Grains of 7 DAP of the wild-type and gif1 were harvested for RNA preparation. Microarray analysis was performed with the Affymetrix (Santa Clara, CA) GeneChip
More informationSupplementary Figure 1. Nature Genetics: doi: /ng.3848
Supplementary Figure 1 Phenotypes and epigenetic properties of Fab2L flies. A- Phenotypic classification based on eye pigment levels in Fab2L male (orange bars) and female (yellow bars) flies (n>150).
More informationCharacterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach
Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach ABSTRACT SUBMITTED TO JAMIA MILLIA ISLAMIA NEW DELHI IN PARTIAL FULFILMENT OF
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/452/ra106/dc1 Supplementary Materials for Stem-piped light activates phytochrome B to trigger light responses in Arabidopsis thaliana roots Hyo-Jun Lee, Jun-Ho
More informationBiological Roles of Cytokinins
Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators
More informationSupplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2
Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2 IRT1, FRO2 and FIT expression levels in roots of the wild-type, nas4x- 1 and nas4x-2, showing that in both nas mutants
More information. Supplementary Information
. Supplementary Information Supplementary Figure S1. Mature embryo sac observations. Supplementary Figure S2. STT observations. Supplementary Figure S3. Comparison of the PTB1 cdna with that of the mutant.
More informationChapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype.
Chapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype. please read pages 38-47; 49-55;57-63. Slide 1 of Chapter 2 1 Extension sot Mendelian Behavior of Genes Single gene inheritance
More informationPhotoreceptor Regulation of Constans Protein in Photoperiodic Flowering
Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering by Valverde et. Al Published in Science 2004 Presented by Boyana Grigorova CBMG 688R Feb. 12, 2007 Circadian Rhythms: The Clock Within
More informationSupplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day
Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day conditions. Photo was taken when the wild type plant started to bolt. Scale bar represents 1 cm. Supplemental Figure 2. Flowering
More informationThe diversity of plant communities mediates mycorrhizal fungal diversity
The diversity of plant communities mediates mycorrhizal fungal diversity Or, How graduate school is going to be way harder than I thought Marlene Tyner, University of Michigan R. Michael Miller, Argonne
More informationA naturally occurring conditional albino mutant in rice caused by defects in the plastid-localized OsABCI8 transporter
DOI 10.1007/s11103-017-0598-4 A naturally occurring conditional albino mutant in rice caused by defects in the plastid-localized OsABCI8 transporter Xiuyu Zeng 1 Ran Tang 1 Herong Guo 1 Shanwen Ke 1 Bin
More informationTHE ROLE OF THE PHYTOCHROME B PHOTORECEPTOR IN THE REGULATION OF PHOTOPERIODIC FLOWERING. AnitaHajdu. Thesis of the Ph.D.
THE ROLE OF THE PHYTOCHROME B PHOTORECEPTOR IN THE REGULATION OF PHOTOPERIODIC FLOWERING AnitaHajdu Thesis of the Ph.D. dissertation Supervisor: Dr. LászlóKozma-Bognár - senior research associate Doctoral
More informationThe sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively as positive regulators of salt stress tolerance in rice
Lou et al. BMC Plant Biology (2018) 18:203 https://doi.org/10.1186/s12870-018-1408-0 RESEARCH ARTICLE Open Access The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively
More informationSupplementary Figure 1. Phenotype of the HI strain.
Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants
More informationRegulation of Phosphate Homeostasis by microrna in Plants
Regulation of Phosphate Homeostasis by microrna in Plants Tzyy-Jen Chiou 1 *, Kyaw Aung 1,2, Shu-I Lin 1,3, Chia-Chune Wu 1, Su-Fen Chiang 1, and Chun-Lin Su 1 Abstract Upon phosphate (Pi) starvation,
More informationModel plants and their Role in genetic manipulation. Mitesh Shrestha
Model plants and their Role in genetic manipulation Mitesh Shrestha Definition of Model Organism Specific species or organism Extensively studied in research laboratories Advance our understanding of Cellular
More informationThe scientists recorded the carbon dioxide uptake by grape leaves with three different treatments:
Q1.Scientists studied the rate of carbon dioxide uptake by grape plant leaves. Grape leaves have stomata on the lower surface but no stomata on the upper surface. The scientists recorded the carbon dioxide
More informationSupplementary Information
Supplementary Information Supplementary figures % Occupancy 90 80 70 60 50 40 30 20 Wt tol-1(nr2033) Figure S1. Avoidance behavior to S. enterica was not observed in wild-type or tol-1(nr2033) mutant nematodes.
More informationRadicle emergence (%)
A MDCA (µm) Radicle emergence (%) 99.65 5 99.32 75 98.96 1 99.39 125 97.3 15 98.2 175 97.78 2 98.1 B 5 µm 75 µm 1 µm 125 µm 15 µm 175 µm 2 µm Figure S1. Effect of MDCA on germination of Arabidopsis. (A)
More informationTitle. Authors. Characterization of a major QTL for manganese accumulation in rice grain
Title Characterization of a major QTL for manganese accumulation in rice grain Authors Chaolei Liu, Guang Chen, Yuanyuan Li, Youlin Peng, Anpeng Zhang, Kai Hong, Hongzhen Jiang, Banpu Ruan, Bin Zhang,
More informationSupplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2.
Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice. Percentage of marginal zone B cells in the spleen of wild-type mice (+/+), mice homozygous for cpm or pri
More informationDevelopment 143: doi: /dev : Supplementary information
Supplementary Materials and Methods Plant materials The mutants and transgenic plants used in the present study were as follows: E361 (from Alex Webb s laboratory); tmm-1, ptmm::tmm-gfp and flp-1 (from
More informationThe Role of Inorganic Carbon Transport and Accumulation in the CO 2 -Concentrating Mechanism and CO 2 Assimilation in Chlamydomonas
The Role of Inorganic Carbon Transport and Accumulation in the CO 2 -Concentrating Mechanism and CO 2 Assimilation in Chlamydomonas Is there a Role for the CCM in Increasing Biological CO 2 Capture? Generalized
More informationGenetic and physiological approach to elucidation of Cd absorption mechanism by rice plants
Genetic and physiological approach to elucidation of Cd absorption mechanism by rice plants Satoru Ishikawa National Institute for Agro-Environmental Sciences, 3-1-3, Kannondai, Tsukuba, Ibaraki, 305-8604,
More information7.06 Problem Set #4, Spring 2005
7.06 Problem Set #4, Spring 2005 1. You re doing a mutant hunt in S. cerevisiae (budding yeast), looking for temperaturesensitive mutants that are defective in the cell cycle. You discover a mutant strain
More informationIllegitimate translation causes unexpected gene expression from on-target out-of-frame alleles
Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN
More informationSupplemental Data. Yamamoto et al. (2016). Plant Cell /tpc WT + HCO 3. slac1-4/δnc #5 + HCO 3 WT + ABA. slac1-4/δnc #5 + ABA
I (pa) I (pa) A WT + HCO 3 B 2 V (mv) 15 1 5 5 2 slac14/δnc #5 + HCO 3 4 6 WT (n = 6) 8 WT + HCO 3 (n = 7) slac14/δnc #5 (n = 6) slac14/δnc #5 + HCO 3 (n = 1) C WT + ABA D 2 V (mv) 15 1 5 5 2 slac14/δnc
More informationm1 m2 m3 m4 m5 m6 m7 m8 wt m m m m m m m m8 - + wt +
otherwise, you couldn't grow them!) You perform pairwise infections with each of your mutant bacteriophage strains and get the following results: (+) = pair of phages lysed host cells, (-) = pair of phages
More informationLife Science Journal 2014;11(9) Cryptochrome 2 negatively regulates ABA-dependent seed germination in Arabidopsis
Cryptochrome 2 negatively regulates ABA-dependent seed germination in Arabidopsis Sung-Il Kim 1, Sang Ik Song 3, Hak Soo Seo 1, 2, 4 * 1 Department of Plant Science and Research Institute of Agriculture
More informationSUPPLEMENTARY INFORMATION
Supplemental Methods Isolation and mapping of SPCH An EMS-mutagenized population of tmm-1 (Col);E1728 (an enhancer trap GFP marking guard cells) was created. M2 seeds were collected from M1 s planted in
More informationSUPPLEMENTARY INFORMATION
Supplementary information for Large tundra methane burst during onset of freezing by Mastepanov et al. Supplementary Figures and Legends 8.86 (71%) 3.10 (41%) 3.36 (53%) 3.43 (55%) 1.68 (32%) 2.64 (46%)
More informationSupporting Online Material
1 Stomatal Patterning and Differentiation by Synergistic Interactions of Receptor Kinases Elena D. Shpak, Jessica Messmer McAbee, Lynn Jo Pillitteri, and Keiko U. Torii Supporting Online Material Material
More information(a) The area of forest lost each year in Madagascar increased between 2009 and 2012.
Q1.The graph below shows the area of forest lost in Madagascar from 2009 to 2012. (a) The area of forest lost each year in Madagascar increased between 2009 and 2012. Determine the total area of forest
More informationTitle Allantoin by Inosine in Nutrient So. Author(s) Toshihiro; Yokoi, Daisuke; Osaki, M
Title Rice Root Growth with Increasing in Allantoin by Inosine in Nutrient So Author(s) Tokuhisa, Dai; Okazaki, Keiki; Shin Toshihiro; Yokoi, Daisuke; Osaki, M Citation The Proceedings of the Internationa
More informationSupplemental Figures. Supplemental Data. Sugliani et al. Plant Cell (2016) /tpc Clades RSH1. Rsh1[HS] RSH2 RSH3. Rsh4[HS] HYD TGS ACT
Supplemental Figures Clades RSH1 TP - HYD TGS ACT Rsh1[HS] RSH2 TP HYD SYN TGS Rsh2[HS] RSH3 TP HYD SYN TGS CRSH TP - SYN EFh Rsh4[HS] Supplemental Figure 1. Arabidopsis RSH domain structure. Schematic
More informationAnalysis of regulatory function of circadian clock. on photoreceptor gene expression
Thesis of Ph.D. dissertation Analysis of regulatory function of circadian clock on photoreceptor gene expression Tóth Réka Supervisor: Dr. Ferenc Nagy Biological Research Center of the Hungarian Academy
More informationDEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA
DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA CHASE BALLARD LINDA EAN HECTOR LOPEZ DR. JOANNA WERNER-FRACZEK IN COLLABORATION WITH DR. PATRICIA SPRINGER S LAB AT UCR AND ROBERT KOBLE PURPOSE OF RESEARCH
More informationElectromagenetic spectrum
Light Controls of Plant Development 1 Electromagenetic spectrum 2 Light It is vital for photosynthesis and is also necessary to direct plant growth and development. It acts as a signal to initiate and
More informationJeopardy. Evolution Q $100 Q $100 Q $100 Q $100 Q $100 Q $200 Q $200 Q $200 Q $200 Q $200 Q $300 Q $300 Q $300 Q $300 Q $300
Jeopardy Mutations Crosses & Punnett Sqs. Meiosis & Variability Evolution Photo, Cell Resp, Energy, Matter Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $100 Q $100 Q $100 Q $200 Q $200 Q $200 Q $200 Q $300
More informationLipid transfer proteins confer resistance to trichothecenes
Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance
More informationInvestigation 7: Cell Division Part B: Meiosis and Crossing Over
Background Investigation 7: Cell Division Part B: Meiosis and Crossing Over Ascomycota are a diverse group of fungi including the familiar single-celled baker s yeast, the complex morel mushroom, and the
More informationCell Division and Genetics
Name Date Cell Division and Genetics 1. Black fur is dominant over brown fur in a particular population of guinea pig. The genetic information that gives a guinea pig brown fur is described as having A.
More informationMaria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner
ABA represses the transcription of chloroplast genes Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner Supplementary data Supplementary tables Table
More informationElectro Transformación Industrial, S.A. José Ignacio Garreta José Leandro Leandro Boyano
Electro Transformación Industrial, S.A. José Ignacio Garreta José Leandro Leandro Boyano BACKGROUND LED in Public Lighting The key to savings and the improvement of efficiency, with regards to traditional
More informationSupplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type
A B 2 3 3 2 1 1 Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type (A) and d27 (B) seedlings at the four
More informationQuestion: All large trees start as little seeds. What provided most of the mass that allow trees to grow so large?
Question: All large trees start as little seeds. What provided most of the mass that allow trees to grow so large? I think most it came from the nutrients in the soil that are taken up by the roots. I
More information3/4/2015. Review. Phenotype
Review Phenotype 1 Genes Crossing Over Frequency cn cinnabar eyes Cy curly wings L lobe eyes pr purple eyes sm smooth abdomen pr - L 9% Cy - L 33% sm - pr 19% cn - pr 2% Cy - sm 43% cn - sm 17% Polygenic
More informationSupplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1
Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1 F/F ;mir-17~92 F/F (Pkd1-miR-17~92KO) mice. (A) Q-PCR
More informationMapping connections between the genome, ionome and the physical landscape. Photo by Bruce Bohm. David E Salt Purdue University, USA
Mapping connections between the genome, ionome and the physical landscape Photo by Bruce Bohm David E Salt Purdue University, USA What is the Ionome Environment Transcriptome Proteome Ionome The elemental
More informationDuplication of an upstream silencer of FZP increases grain yield in rice
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41477-017-0042-4 In the format provided by the authors and unedited. Duplication of an upstream silencer of FZP increases grain yield in rice
More informationNature Genetics: doi: /ng Supplementary Figure 1. The FIN and FAB genes act separately from the meristem maturation pathway.
Supplementary Figure 1 The FIN and FAB genes act separately from the meristem maturation pathway. (a) Representative inflorescence from the compound inflorescence (s, defective in the homolog of Arabidopsis
More informationLiu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham.
Liu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham. Access from the University of Nottingham repository: http://eprints.nottingham.ac.uk/12529/3/thesis_part_2_final.pdf
More informationSupp- Figure 2 Confocal micrograph of N. benthamiana tissues transiently expressing 35S:YFP-PDCB1. PDCB1 was targeted to plasmodesmata (twin punctate
Supplemental Data. Simpson et al. (009). n rabidopsis GPI-anchor plasmodesmal neck protein with callosebinding activity and potential to regulate cell-to-cell trafficking. 5 0 stack Supp- Figure Confocal
More informationCurriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
More informationAdd Up and Cross Over Sordaria Genetics Simulation
Introduction Add Up and Cross Over Sordaria Genetics Simulation Publication No. Crossing over occurs during metaphase I of meiosis. During crossing over, homologous pairs of chromosomes exchange sections
More informationEffect of light and the cer10 mutation on the growth rate of Arabidopsis thaliana
Effect of light and the cer10 mutation on the growth rate of Arabidopsis thaliana Jenna K. Bains, Selam Joseph, Shayan Shokoohi, Ian A. Villamin Abstract The presence of light and the presence of a mutation
More informationGenetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity
Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity Shih-Heng Su, Maria Cristina Suarez-Rodriguez, Patrick Krysan
More informationBrachypodium distachyon,, a new model plant. Richard Sibout
Brachypodium distachyon,, a new model plant Richard Sibout ALICE: Brachypodium seed stocks Leaf DNA M2 Phenotyping (visual and chemical) (Versailles) 6 seeds (plants) Mutagenesis M1 M2 seeds production
More informationPlant transformation
Plant transformation Objectives: 1. What is plant transformation? 2. What is Agrobacterium? How and why does it transform plant cells? 3. How is Agrobacterium used as a tool in molecular genetics? References:
More informationGenetic dissection of the Arabidopsis thaliana ionome
Genetic dissection of the Arabidopsis thaliana ionome Genome Ionome Landscape distribution David E Salt Purdue University, USA What is the Ionome Environment Transcriptome Proteome Ionome The elemental
More informationBiol. 303 EXAM I 9/22/08 Name
Biol. 303 EXAM I 9/22/08 Name -------------------------------------------------------------------------------------------------------------- This exam consists of 40 multiple choice questions worth 2.5
More informationMetagenomic analysis of spoiled potato and tomato and the use of the dominant bacterial species in plant growth studies
Metagenomic analysis of spoiled potato and tomato and the use of the dominant bacterial species in plant growth studies Khaya Ntushelo Department of Agriculture and Animal Health, University of South Africa,
More informationQ2 (4.6) Put the following in order from biggest to smallest: Gene DNA Cell Chromosome Nucleus. Q8 (Biology) (4.6)
Q1 (4.6) What is variation? Q2 (4.6) Put the following in order from biggest to smallest: Gene DNA Cell Chromosome Nucleus Q3 (4.6) What are genes? Q4 (4.6) What sort of reproduction produces genetically
More information学位規則第 9 条第 2 項により要約公開 ; 許諾条件により本文は に公開
Title An active transposon mping facilita flowering time mutant genes in rice Author(s) Xu, Quan Citation Kyoto University ( 京都大学 ) Issue Date 2014-03-24 URL http://dx.doi.org/10.14989/doctor.k Right 学位規則第
More informationGenetics 275 Notes Week 7
Cytoplasmic Inheritance Genetics 275 Notes Week 7 Criteriafor recognition of cytoplasmic inheritance: 1. Reciprocal crosses give different results -mainly due to the fact that the female parent contributes
More informationArabidopsis PPR40 connects abiotic stress responses to mitochondrial electron transport
Ph.D. thesis Arabidopsis PPR40 connects abiotic stress responses to mitochondrial electron transport Zsigmond Laura Supervisor: Dr. Szabados László Arabidopsis Molecular Genetic Group Institute of Plant
More informationSupplementary Information. Drought response transcriptomics are altered in poplar with reduced tonoplast sucrose transporter expression
Supplementary Information Drought response transcriptomics are altered in poplar with reduced tonoplast sucrose transporter expression Liang Jiao Xue, Christopher J. Frost, Chung Jui Tsai, Scott A. Harding
More informationOB50 Investigate the growth response of plants to gravity (geotropism) and light (phototropism)
Biology: 12. Photosynthesis and Plant Responses Please remember to photocopy 4 pages onto one sheet by going A3 A4 and using back to back on the photocopier Syllabus OB48 Describe, using a word equation,
More informationSupplemental material
Supplemental material Table 1- Segregation analysis of sgt1a sgt1b double mutant plants Parental genotype No. of lines Normal seeds Phenotype Abnormal seeds Ratio of abnormal seeds (%) WT 3 171 2 1.16
More informationDNA Structure and Function
DNA Structure and Function Nucleotide Structure 1. 5-C sugar RNA ribose DNA deoxyribose 2. Nitrogenous Base N attaches to 1 C of sugar Double or single ring Four Bases Adenine, Guanine, Thymine, Cytosine
More informationUnit 3 - Molecular Biology & Genetics - Review Packet
Name Date Hour Unit 3 - Molecular Biology & Genetics - Review Packet True / False Questions - Indicate True or False for the following statements. 1. Eye color, hair color and the shape of your ears can
More informationPrinciples of Genetics
Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics
More informationEST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7.
hest1a / SMG6 EST1 Homology Domain 100 aa 853 695 761 780 1206 hest1 / SMG5 -like? -like 109 145 214 237 497 165 239 1016 114 207 212 381 583 hest1c / SMG7 a helical 1091 Sc 57 185 267 284 699 Figure S1:
More information23-. Shoot and root development depend on ratio of IAA/CK
Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal
More information