Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao
|
|
- Bertram York
- 5 years ago
- Views:
Transcription
1 New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao Article acceptance date: 22 November 2015 Fig. S1 Protein sequence alignment between MtTT8 with Arabidopsis TT8 protein. Fig. S2 Phenotypes of mttt8 mutant line NF2856 with a Tnt1 insertion in MtTT8 gene. Fig. S3 Expression patterns of MtTT8 in different tissues and materials of various genetic backgrounds. Fig. S4 qrt-pcr validation of microarray data on key flavonoid biosynthetic genes. Fig. S5 Physical interaction between MtTT8, WD40 and MYB transcription factors. Fig. S6 Venn diagram of shared and unique genes differentially down-regulated among mttt8, mtpar, and mtwd40-1 mutants. Fig. S7 Subcellular localization of MtWD40-1 in nucleus. Fig. S8 Expression patterns of MtGL2 and MtEGL3 in different tissue and materials of genetic background. Fig. S9 Expression patterns of MtMYB2 in different tissues and materials of various genetic backgrounds. 1
2 Fig. S1 The amino acid sequence comparison between MtTT8 with Arabidopsis TT8 protein. The conserved DNA binding and domain in C-terminal end was highlighted with a box. 2
3 Fig. S2 Phenotypes of homozygous mttt8 mutant line NF2856 with a Tnt1 insertion in MtTT8 gene 3
4 Fig. S3 The expression patterns of MtTT8 in different tissues and materials of various genetic backgrounds. Data are extracted from Medicago Gene Expression Atlas (see MtGEA, 4
5 Fig. S4 qrt-pcr validation of microarray data on key flavonoid biosynthetic gene expression. (a) Expression of structural genes in developing seeds (12 DAP) of mttt8 mutant (MtTT8) and its segregation wild-type control (WT). (b) Expression of structural genes in leaf (2 wk old) of mttt8 mutant (MtTT8) and its segregation wild-type control (WT). (c) Expression of transcription factor genes in developing seeds (12 DAP) of mttt8 mutant (MtTT8) and its segregation wild-type control (WT). (d) Expression of transcription factor genes in leaf (2 wk old) of mttt8 mutant (MtTT8) and its segregation wild-type control (WT). 5
6 Fig. S5 Physical interaction between MtTT8, WD40 and MYB transcription factors. GAL activity determination by filter paper assay. MtPAR, MtWD40-1, MtLAP1, and MtTT8 in Yeast Two-Hybrid vectors pgbkt7 and pgadt7 with reading frame in fusion with the GAL4 BD and AD were tested in different combinations for their interaction on SC-Trp-Leu His. Grown yeasts were transferred to filter paper for frozen-thaw treatment and GAL activity assay with Z-buffer. Images are representatives from at least three repeat experiments. 6
7 Fig. S6 Venn diagram with the number of shared and unique genes differentially down-regulated among mttt8, mtpar, and mtwd40-1 mutants. Venn diagram was made with microarray data of mtpar, mttt8, and mtwd40-1 mutant seeds by using the program ( cnb.csic.es/tools/ venny/ index.html) (Oliveros, 2007). Microarray analytic data of seeds of mtpar and mtwd40-1 mutants were obtained from other sources (Pang et al., 2009; Verdier et al., 2012). 7
8 Fig. S7 Subcellular localization of MtWD40-1 in nucleus. The full-length EGFP (GFP) fused with MtWD40-1 (MtWD40-1-GFP) at C-terminus. MtWD40-1-GFP construct DNA was transformed into EHA105 Agrobacterium tumefaciens strains for infiltration into three-week-old Nicotiana benthamiana leaves for observation under fluorescence microscope. MtWD40-1-GFP fluorescence signal (left photo) was observed at 3-4 d after infiltration in most infected epidermal cells of tobacco leaves. The bright field photo (middle) and fluorescence field photo were merged to give right penal photo. Bar, 30 µm. 8
9 Fig. S8 The expression patterns of MtGL2 and MtEGL3 in different tissue and materials of genetic background. Data are extracted from Medicago Gene Expression Atlas (see MtGEA, 9
10 Fig. S9 The expression patterns of R2R3-type MYB transcription factor MtMYB2 in different tissues and materials of various genetic backgrounds. Data are extracted from Medicago GeneAtlas (see MtGEA, MtMYB2 expression patterns References Oliveros JC VENNY. An interactive tool for comparing lists with Venn Diagrams. Available: Accessed 7 May Pang Y, Wenger JP, Saathoff K, Peel GJ, Wen J, Huhman D, Allen SN, Tang Y, Cheng X, Tadege M et al A WD40 repeat protein from Medicago truncatula is necessary for tissue-specific anthocyanin and proanthocyanidin biosynthesis but not for trichome development. Plant Physiology 151:
11 Verdier J, Zhao J, Torres-Jerez I, Ge S, Liu C, He X, Mysore KS, Dixon RA, Udvardi MK MtPAR MYB transcription factor acts as an on switch for proanthocyanidin biosynthesis in Medicago truncatula. Proceedings of the National Academy of Sciences, USA 109:
Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells
Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells By: Patrick Rutledge 1 Dr. Jennifer Lorang 2,3, Dr. Marc Curtis 2,3, Dr. Thomas Wolpert 2,3 BioResource Research 1, Botany and
More informationGENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL
GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,
More information23-. Shoot and root development depend on ratio of IAA/CK
Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1121356/dc1 Supporting Online Material for Polar PIN Localization Directs Auxin Flow in Plants Justyna Wiśniewska, Jian Xu, Daniela Seifertová, Philip B. Brewer, Kamil
More informationGFP GAL bp 3964 bp
Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive
More informationSupplemental Data. Perrella et al. (2013). Plant Cell /tpc
Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization
More informationSupplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day
Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day conditions. Photo was taken when the wild type plant started to bolt. Scale bar represents 1 cm. Supplemental Figure 2. Flowering
More informationNature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
More informationSupplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.
Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny
More informationSupplemental Data. Chen and Thelen (2010). Plant Cell /tpc
Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector
More information** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.
Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *
More informationSupplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation
More informationNature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.
Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on
More informationDevelopment 143: doi: /dev : Supplementary information
Supplementary Materials and Methods Plant materials The mutants and transgenic plants used in the present study were as follows: E361 (from Alex Webb s laboratory); tmm-1, ptmm::tmm-gfp and flp-1 (from
More informationEXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA
EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital
More informationSupplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary
More informationSupplementary Figure 1. Phenotype of the HI strain.
Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants
More informationLast time: Obtaining information from a cloned gene
Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?
More information7.06 Problem Set #4, Spring 2005
7.06 Problem Set #4, Spring 2005 1. You re doing a mutant hunt in S. cerevisiae (budding yeast), looking for temperaturesensitive mutants that are defective in the cell cycle. You discover a mutant strain
More information2. Yeast two-hybrid system
2. Yeast two-hybrid system I. Process workflow a. Mating of haploid two-hybrid strains on YPD plates b. Replica-plating of diploids on selective plates c. Two-hydrid experiment plating on selective plates
More informationSupplemental Data. Gao et al. (2012). Plant Cell /tpc
Supplemental Figure 1. Plant EMP Proteins. (A) The Accession numbers of the 12 EMP members from Arabidopsis. (B) Phylogenetic analysis of EMP proteins from Arabidopsis, human and yeast using the Mac Vector
More informationArabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development
Arabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development Danhua Jiang 1,2, Nicholas C. Kong 1,2, Xiaofeng Gu 2, Zicong Li 1, Yuehui
More informationTable S1 List of primers used for genotyping and qrt-pcr.
Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY
More informationSUPPLEMENTARY INFORMATION
In the format provided by the authors and unedited. ARTICLE NUMBER: 68 DI:.38/NPLANTS.6.8 A role for leucoanthocyanidin reductase in the extension of proanthocyanidins Chenggang Liu,, Xiaoqiang Wang,,
More informationCharacterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach
Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach ABSTRACT SUBMITTED TO JAMIA MILLIA ISLAMIA NEW DELHI IN PARTIAL FULFILMENT OF
More informationSUPPLEMENTARY INFORMATION
Supplemental Methods Isolation and mapping of SPCH An EMS-mutagenized population of tmm-1 (Col);E1728 (an enhancer trap GFP marking guard cells) was created. M2 seeds were collected from M1 s planted in
More informationActions of auxin. Hormones: communicating with chemicals History: Discovery of a growth substance (hormone- auxin)
Hormones: communicating with chemicals History- discovery of plant hormone. Auxin Concepts of hormones Auxin levels are regulated by synthesis/degradation, transport, compartmentation, conjugation. Polar
More informationPlant mitochondrial dynamics
Plant mitochondrial dynamics Peroxisome Chloroplast Nucleus Mitochondria from Alberts et al. 1994 Living Arabidopsis leaf 10 µm Logan & Leaver (2000) Journal of Experimental Botany, 51: 865-871 5 µm S.
More informationFigure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin
More informationTransitivity-dependent and transitivity-independent cell-to-cell movement of RNA
Himber et al. Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA silencing SUPPLEMENTAL MATERIAL Supplemental material 1. Short-range movement of GFP silencing affects a nearly
More informationA small multigene hydroxyproline-ogalactosyltransferase. arabinogalactan-protein glycosylation, growth and development in Arabidopsis
Basu et al. BMC Plant Biology (215) 15:295 DOI 1.1186/s1287-15-67-7 RESEARCH ARTICLE Open Access A small multigene hydroxyproline-ogalactosyltransferase family functions in arabinogalactan-protein glycosylation,
More informationHeterosis and inbreeding depression of epigenetic Arabidopsis hybrids
Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined
More informationThe sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively as positive regulators of salt stress tolerance in rice
Lou et al. BMC Plant Biology (2018) 18:203 https://doi.org/10.1186/s12870-018-1408-0 RESEARCH ARTICLE Open Access The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively
More informationThe geneticist s questions
The geneticist s questions a) What is consequence of reduced gene function? 1) gene knockout (deletion, RNAi) b) What is the consequence of increased gene function? 2) gene overexpression c) What does
More informationCharacterization, expression patterns and functional analysis of the MAPK and MAPKK genes in watermelon (Citrullus lanatus)
Song et al. BMC Plant Biology (2015) 15:298 DOI 10.1186/s12870-015-0681-4 RESEARCH ARTICLE Characterization, expression patterns and functional analysis of the MAPK and MAPKK genes in watermelon (Citrullus
More informationLipid transfer proteins confer resistance to trichothecenes
Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance
More informationPlant transformation
Plant transformation Objectives: 1. What is plant transformation? 2. What is Agrobacterium? How and why does it transform plant cells? 3. How is Agrobacterium used as a tool in molecular genetics? References:
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/452/ra106/dc1 Supplementary Materials for Stem-piped light activates phytochrome B to trigger light responses in Arabidopsis thaliana roots Hyo-Jun Lee, Jun-Ho
More informationMeasuring TF-DNA interactions
Measuring TF-DNA interactions How is Biological Complexity Achieved? Mediated by Transcription Factors (TFs) 2 Regulation of Gene Expression by Transcription Factors TF trans-acting factors TF TF TF TF
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
More informationSupplemental material
Supplemental material Table 1- Segregation analysis of sgt1a sgt1b double mutant plants Parental genotype No. of lines Normal seeds Phenotype Abnormal seeds Ratio of abnormal seeds (%) WT 3 171 2 1.16
More informationFigure 18.1 Blue-light stimulated phototropism Blue light Inhibits seedling hypocotyl elongation
Blue Light and Photomorphogenesis Q: Figure 18.3 Blue light responses - phototropsim of growing Corn Coleoptile 1. How do we know plants respond to blue light? 2. What are the functions of multiple BL
More informationSupplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type
A B 2 3 3 2 1 1 Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type (A) and d27 (B) seedlings at the four
More informationSupplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and
More informationSupplemental Data. Tameling et al. (2010). Plant Cell 10.1105/tpc.110.077461 Supplemental Table 1. Primers used in plasmid construction Primer Code Sequence eo1 5 -GCCATGGCTCATGCAAGTGTGGCTTCTC-3 eo2 5
More informationRegulation of Phosphate Homeostasis by microrna in Plants
Regulation of Phosphate Homeostasis by microrna in Plants Tzyy-Jen Chiou 1 *, Kyaw Aung 1,2, Shu-I Lin 1,3, Chia-Chune Wu 1, Su-Fen Chiang 1, and Chun-Lin Su 1 Abstract Upon phosphate (Pi) starvation,
More informationCytokinin. Fig Cytokinin needed for growth of shoot apical meristem. F Cytokinin stimulates chloroplast development in the dark
Cytokinin Abundant in young, dividing cells Shoot apical meristem Root apical meristem Synthesized in root tip, developing embryos, young leaves, fruits Transported passively via xylem into shoots from
More informationJMJ14-HA. Col. Col. jmj14-1. jmj14-1 JMJ14ΔFYR-HA. Methylene Blue. Methylene Blue
Fig. S1 JMJ14 JMJ14 JMJ14ΔFYR Methylene Blue Col jmj14-1 JMJ14-HA Methylene Blue Col jmj14-1 JMJ14ΔFYR-HA Fig. S1. The expression level of JMJ14 and truncated JMJ14 with FYR (FYRN + FYRC) domain deletion
More informationSMALL AUXIN UP RNA (SAUR) genes are the largest class of primary auxin (growth
Abstract SMALL AUXIN UP RNA (SAUR) genes are the largest class of primary auxin (growth hormone) responsive genes in all land plants, many of which are expressed in actively growing plant tissues. This
More informationA complementation test would be done by crossing the haploid strains and scoring the phenotype in the diploids.
Problem set H answers 1. To study DNA repair mechanisms, geneticists isolated yeast mutants that were sensitive to various types of radiation; for example, mutants that were more sensitive to UV light.
More informationGenetic Characterization and Functional Analysis of the GID1 Gibberellin Receptors in Arabidopsis W
The Plant Cell, Vol. 18, 3399 3414, December 2006, www.plantcell.org ª 2006 American Society of Plant Biologists Genetic Characterization and Functional Analysis of the GID1 Gibberellin Receptors in Arabidopsis
More informationRegulation of mycotoxin production and kinome analysis in Fusarium graminearum
Regulation of mycotoxin production and kinome analysis in Fusarium graminearum Chenfang Wang Northwest Agricultural & Forestry University Regulation of mycotoxin production and kinome analysis in Fusarium
More information** LCA LCN PCA
% of wild type value % of wild type value a 12 1 8 2 b 12 1 8 2 LCA LCN PCA Col- sod3-1 Supplementary Figure 1 sod3-1 influences cell proliferation. (a) Fifth leaf cell area (LCA) and leaf cell number
More informationTHE NOPALINE SYNTHASE PROMOTER AS A MODEL SYSTEM FOR STUDYING PLANT RESPONSE TO UV-B
International Journal of Environmentally Conscious Design & Manufacturing, Vol. 10, No. 3, 2001-2002 THE NOPALINE SYNTHASE PROMOTER AS A MODEL SYSTEM FOR STUDYING PLANT RESPONSE TO UV-B GYUNG-HEE YU AND
More informationChapter 1 Introduction
Chapter 1 Introduction 1. INTRODUCTION Plants being sessile are exposed to environmental stresses mainly abiotic, caused by non-living effects of environment (temperature extremes, drought, and salinity)
More informationBiological Roles of Cytokinins
Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators
More informationNewly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
More informationcote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work
SUPPLEMENTARY INFORMATION Table S1. List of strains Strains Genotype Source B. subtilis PY79 Prototrophic derivative of B. subtilis 168 (60) RL1070 spovid::kan (12) HS176 cotz phs2 (cotz-gfp spc) (22)
More informationSUPPLEMENTARY INFORMATION
reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative
More informationSupplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed
Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the
More informationallosteric cis-acting DNA element coding strand dominant constitutive mutation coordinate regulation of genes denatured
A B C D E F G H I J K L M N O P Q R S T U V W X Y Z AA BB CC DD EE FF GG HH II JJ KK LL MM NN OO PP QQ RR SS TT UU VV allosteric cis-acting DNA element coding strand codominant constitutive mutation coordinate
More informationdownstream (0.8 kb) homologous sequences to the genomic locus of DIC. A DIC mutant strain (ro- 6
A B C D ts Figure S1 Generation of DIC- mcherry expressing N.crassa strain. A. N. crassa colony morphology. When a cot1 (top, left panel) strain is grown at permissive temperature (25 C), it exhibits straight
More informationAgrobacterium-derived cytokinin influences plastid morphology and starch accumulation in Nicotiana benthamiana during transient assays
Erickson et al. BMC Plant Biology 2014, 14:127 RESEARCH ARTICLE Open Access Agrobacterium-derived cytokinin influences plastid morphology and starch accumulation in Nicotiana benthamiana during transient
More informationQ2 (4.6) Put the following in order from biggest to smallest: Gene DNA Cell Chromosome Nucleus. Q8 (Biology) (4.6)
Q1 (4.6) What is variation? Q2 (4.6) Put the following in order from biggest to smallest: Gene DNA Cell Chromosome Nucleus Q3 (4.6) What are genes? Q4 (4.6) What sort of reproduction produces genetically
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3267 Supplementary Figure 1 A group of genes required for formation or orientation of annular F-actin bundles and aecm ridges: RNAi phenotypes and their validation by standard mutations.
More informationMiR171h restricts root symbioses and shows like its target NSP2 a complex transcriptional regulation in Medicago truncatula
Hofferek et al. BMC Plant Biology 2014, 14:199 RESEARCH ARTICLE Open Access MiR171h restricts root symbioses and shows like its target NSP2 a complex transcriptional regulation in Medicago truncatula Vinzenz
More informationWelcome to BIOL 572: Recombinant DNA techniques
Lecture 1: 1 Welcome to BIOL 572: Recombinant DNA techniques Agenda 1: Introduce yourselves Agenda 2: Course introduction Agenda 3: Some logistics for BIOL 572 Agenda 4: Q&A section Agenda 1: Introduce
More informationLiu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham.
Liu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham. Access from the University of Nottingham repository: http://eprints.nottingham.ac.uk/12529/3/thesis_part_2_final.pdf
More informationAn R2R3 MYB transcription factor determines red petal colour in an Actinidia (kiwifruit) hybrid population. Fraser et al.
An R2R3 MYB transcription factor determines red petal colour in an Actinidia (kiwifruit) hybrid population Fraser et al. Fraser et al. BMC Genomics 2013, 14:28 16 Fraser et al. BMC Genomics 2013, 14:28
More information7.06 Cell Biology EXAM #3 April 21, 2005
7.06 Cell Biology EXAM #3 April 21, 2005 This is an open book exam, and you are allowed access to books, a calculator, and notes but not computers or any other types of electronic devices. Please write
More informationArabidopsis TERMINAL FLOWER1 Is Involved in the Regulation of Flowering Time and Inflorescence Development through Transcriptional Repression C W OA
The Plant Cell, Vol. 23: 3172 3184, September 2011, www.plantcell.org ã 2011 American Society of Plant Biologists. All rights reserved. Arabidopsis TERMINAL FLOWER1 Is Involved in the Regulation of Flowering
More informationGenetic evidence suggests that GIS functions downstream of TCL1 to regulate trichome formation in Arabidopsis
Zhang et al. BMC Plant Biology (2018) 18:63 https://doi.org/10.1186/s12870-018-1271-z RESEARCH ARTICLE Genetic evidence suggests that GIS functions downstream of TCL1 to regulate trichome formation in
More informationThis is an author-deposited version published in : Eprints ID : 19433
Open Archive TOULOUSE Archive Ouverte (OATAO) OATAO is an open access repository that collects the work of Toulouse researchers and makes it freely available over the web where possible. This is an author-deposited
More informationGenome-wide analysis of the MYB transcription factor superfamily in soybean
Du et al. BMC Plant Biology 2012, 12:106 RESEARCH ARTICLE Open Access Genome-wide analysis of the MYB transcription factor superfamily in soybean Hai Du 1,2,3, Si-Si Yang 1,2, Zhe Liang 4, Bo-Run Feng
More information3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.
3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of
More informationThree different fusions led to three basic ideas: 1) If one fuses a cell in mitosis with a cell in any other stage of the cell cycle, the chromosomes
Section Notes The cell division cycle presents an interesting system to study because growth and division must be carefully coordinated. For many cells it is important that it reaches the correct size
More informationSOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent Seed Germination Downstream of PIL5 W
The Plant Cell, Vol. 20: 1260 1277, May 2008, www.plantcell.org ª 2008 American Society of Plant Biologists SOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent
More informationSupporting Information
Supporting Information Cao et al. 10.1073/pnas.1306220110 Gram - bacteria Hemolymph Cytoplasm PGRP-LC TAK1 signalosome Imd dfadd Dredd Dnr1 Ikk signalosome P Relish Nucleus AMP and effector genes Fig.
More informationNuclear trapping by GL3 controls intercellular transport and redistribution of TTG1 protein in Arabidopsis
RESEARCH ARTICLE 5039 Development 138, 5039-5048 (2011) doi:10.1242/dev.072454 2011. Published by The Company of Biologists Ltd Nuclear trapping by GL3 controls intercellular transport and redistribution
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Breker et al., http://www.jcb.org/cgi/content/full/jcb.201301120/dc1 Figure S1. Single-cell proteomics of stress responses. (a) Using
More informationSupplemental Data. Yamamoto et al. (2016). Plant Cell /tpc WT + HCO 3. slac1-4/δnc #5 + HCO 3 WT + ABA. slac1-4/δnc #5 + ABA
I (pa) I (pa) A WT + HCO 3 B 2 V (mv) 15 1 5 5 2 slac14/δnc #5 + HCO 3 4 6 WT (n = 6) 8 WT + HCO 3 (n = 7) slac14/δnc #5 (n = 6) slac14/δnc #5 + HCO 3 (n = 1) C WT + ABA D 2 V (mv) 15 1 5 5 2 slac14/δnc
More informationStochastic simulations
Stochastic simulations Application to molecular networks Literature overview Noise in genetic networks Origins How to measure and distinguish between the two types of noise (intrinsic vs extrinsic)? What
More informationEthylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis
Ethylene is critical to the maintenance of primary root growth and Fe homeostasis under Fe stress in Arabidopsis Guangjie Li, Weifeng Xu, Herbert J. Kronzucker, Weiming Shi * Supplementary Data Supplementary
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1 Sns and Duf co-localise in embryonic nephrocytes a-c, Wild-type stage 11 (a),14 (b) and 16 (c) embryos stained with anti-duf (green) and anti-sns (red). Higher magnification images
More informationGenetic analysis of seed coat development in Arabidopsis
Review TRENDS in Plant Science Vol.0 No.0 October 00 Genetic analysis of seed coat development in Arabidopsis George Haughn and Abed Chaudhury Department of Botany, University of British Columbia, 670
More informationLife Science Journal 2014;11(9) Cryptochrome 2 negatively regulates ABA-dependent seed germination in Arabidopsis
Cryptochrome 2 negatively regulates ABA-dependent seed germination in Arabidopsis Sung-Il Kim 1, Sang Ik Song 3, Hak Soo Seo 1, 2, 4 * 1 Department of Plant Science and Research Institute of Agriculture
More informationThe geneticist s questions. Deleting yeast genes. Functional genomics. From Wikipedia, the free encyclopedia
From Wikipedia, the free encyclopedia Functional genomics..is a field of molecular biology that attempts to make use of the vast wealth of data produced by genomic projects (such as genome sequencing projects)
More informationThe bhlh genes GL3 and EGL3 participate in an intercellular regulatory circuit that controls cell patterning in the Arabidopsis root epidermis
Research article 291 The bhlh genes GL3 and EGL3 participate in an intercellular regulatory circuit that controls cell patterning in the Arabidopsis root epidermis Christine Bernhardt 1, Mingzhe Zhao 2,
More information3% three branches, n 661) compared to the corresponding wild-type WS (0% unbranched, 10% two branches, Correspondence: M. Hülskamp
Brief Communication 1891 CPR5 is involved in cell proliferation and cell death control and encodes a novel transmembrane protein V. Kirik*, D. Bouyer*, U. Schöbinger*, N. Bechtold, M. Herzog, J.-M. Bonneville
More informationName: TF: Section Time: LS1a ICE 5. Practice ICE Version B
Name: TF: Section Time: LS1a ICE 5 Practice ICE Version B 1. (8 points) In addition to ion channels, certain small molecules can modulate membrane potential. a. (4 points) DNP ( 2,4-dinitrophenol ), as
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Overexpression of YFP::GPR-1 in the germline.
Supplementary Figure 1 Overexpression of YFP::GPR-1 in the germline. The pie-1 promoter and 3 utr were used to express yfp::gpr-1 in the germline. Expression levels from the yfp::gpr-1(cai 1.0)-expressing
More informationInstitute for Molecular and Cellular Biology, Vrije Universiteit, 1081 HV Amsterdam, The Netherlands
The Plant Cell, Vol. 18, 1274 1291, May 2006, www.plantcell.org ª 2006 American Society of Plant Biologists PH4 of Petunia Is an R2R3 MYB Protein That Activates Vacuolar Acidification through Interactions
More informationCell Division and Genetics
Name Date Cell Division and Genetics 1. Black fur is dominant over brown fur in a particular population of guinea pig. The genetic information that gives a guinea pig brown fur is described as having A.
More informationEukaryotic Gene Expression
Eukaryotic Gene Expression Lectures 22-23 Several Features Distinguish Eukaryotic Processes From Mechanisms in Bacteria 123 Eukaryotic Gene Expression Several Features Distinguish Eukaryotic Processes
More informationSupplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2
Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2 IRT1, FRO2 and FIT expression levels in roots of the wild-type, nas4x- 1 and nas4x-2, showing that in both nas mutants
More informationAMADEPA Association Martiniquaise pour le Developpement des Plantes Alimentaires
AMADEPA Association Martiniquaise pour le Developpement des Plantes Alimentaires 29eme CONGRES ANNUEL ANNUAL MEETING REUNION ANNUAL Agriculture Intensive dans les Iles de la Caraibe : enjeux, contraintes
More informationChapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype.
Chapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype. please read pages 38-47; 49-55;57-63. Slide 1 of Chapter 2 1 Extension sot Mendelian Behavior of Genes Single gene inheritance
More informationAuthors: Dibosh Bordoloi, Utpal Roy, Nabarun Roy, Amrit Tamully
Genetic improvement of flower colour Authors: Dibosh Bordoloi 1, Utpal Roy 1, Nabarun Roy 2, Amrit Tamully 1 1 Dept. of Plant Breeding and Genetics, Assam Agricultural University, Jorhat, Assam, India-785013
More information