Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc
|
|
- Audrey Leonard
- 5 years ago
- Views:
Transcription
1 Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector pdtpi-gfp Supplemental Figure 1. pdtpi protein localizes to the chloroplast. () lignment of pdtpi amino acid sequence with proteins from rabidopsis (t cytotpi), Petunia (gi602589), Solanum chacoense (gi ), Coptis japonica (gi340520), Oryza sativa (gi169820; gi ), Triticum aestivum (gi ), Glycine max (gi ), Phaseolus vulgaris (gi ), Secale cereale (gi407524), Hordeum, vulgare (gi ), Pteris vittata (gi ). () Subcellular localization of the pdtpi:gfp fusion protein in leaf cells. Transgenic rabidopsis leaf protein expressing pdtpi- GFP was fractionated and detected by immunoblotting. Plastid PDH α-subunit was used to determine plastid enrichment; antibody to the mitochondrial PDH α-subunit was used to assay mitochondria enrichment. (C) Leaves from the transgenic pdtpi-gfp lines were observed by confocal microscopy. Transgenic lines transformed with vector only were used as a control.
2 Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc t2g Root Stem Leaf Flower Silique 28 cycles t2g t2g cycles t2g UQ 33 cycles Supplemental Figure 2. Expression of alternatively spliced pdtpi transcripts. Tissues were harvested from wild-type. RT-PCR was applied to detect transcript abundance. Primers S21170F and S21170R were used to amplify 122 bp and 95 bp fragments from splice variant 1 and splice variant 2, respectively. UQ was used as loading control.
3 Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc Salk Salk TG cytotpi Salk Salk cytotpi T UQ C Salk Salk Supplemental Figure 3. CytoTPI mutant identification. () Schematic representation of T-DN insertion positions in t3g55440 gene., T-DN left border. () cytotpi gene expression was not affected in Salk and Salk T-DN insertion lines. (C) Salk and Salk appeared similar to wild type when grown for 7 weeks under long-day conditions.
4 Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc Salk (pdtpi) Salk CS P1 TG P2 P3 TG Salk P1/P3 C Salk CS Salk pdtpi a1/p3 UQ Supplemental Figure 4. Characterization of pdtpi mutant. () Schematic representation of T-DN insertion positions in t2g21170 gene., T-DN left border. The primer locations and directions were indicated here. () T-DN insertion in Salk was verified by PCR by combining T-DN primer and plant gene-specific primers. (C) RT-PCR results indicated that T-DN insertion in Salk line reduced gene expression. pdtpi gene expression in Salk and CS829061, however, was not affected. UQ was used as a control.
5 Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc MS sucrose glucose F1,6-P DHP GP PG WT pdtpi WT pdtpi WT pdtpi WT pdtpi WT pdtpi WT pdtpi WT pdtpi MS MS sucrose glucose F1,6-P DHP GP PG WT pdtpi Dark WT pdtpi WT pdtpi WT pdtpi WT pdtpi WT pdtpi WT pdtpi WT pdtpi Dark to light Supplemental Figure 5. Metabolite augmentation does not rescue the pdtpi mutant phenotype. () Plants germinated on MS agar plates with the addition of 1 mm of sucrose, glucose, fructose-1, 6- bisphosphate (F-1,6-P), dihydrohyacetone phosphate (DHP), DL-glyceraldehyde 3-phosphate (GP) and D(-)3-phosphoglyceric acid (PG) for 5 d. () Plants were first germinated on regular MS plates under darkness for 5 d, and then were transferred onto MS plates enriched with glycolytic intermediates and grown for an additional 2 d under continuous white light.
6 Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc M bp 250 bp P2/P3 500 bp 250 bp a1/p3 WT Line 3 Line 4 Line 6 Supplemental Figure 6. Complementation of pdtpi mutant by transgenic expression of pdtpi cdn. () PCR genotyping of individual transgenic T1 lines. () Wild type and complementation lines grew under long-day condition for 20 days; the T2 generation of rescued lines 3, line 4 and line 6 are shown here.
7 Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc Control 25uM 25mM 125mM pdtpi Supplemental Figure 7. pdtpi mutant can not be rescued by the application of myo-inositiol. Wild type and pdtpi mutant were germinated on myo-inositol enriched MS plates for 5 d under continuous white light.
8 Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc KDa pdtpi L S ng 10 ng 1 ng 500 pg 250 pg 125 pg 62.5 pg 100 ng 10 ng 1 ng 500 pg 250 pg 125 pg 62.5 pg cytotpi ΔpdTPI Supplemental Figure 8. Rubisco large subunit is down-regulated in the pdtpi mutant. () Total protein from 5-d old seedlings was isolated and separated by SDS-PGE. L: Rubisco large subunit, S: Rubisco small subunit. nti-cytotpi polyclonal antibody cross-reacts with pdtpi protein. () Different amounts of purified, recombinant cytotpi and ΔpdTPI protein were separated by SDS-PGE, transferred to nitrocellulose membrane and probed with anti-cytotpi antibody.
Supplemental Data. Perrella et al. (2013). Plant Cell /tpc
Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1121356/dc1 Supporting Online Material for Polar PIN Localization Directs Auxin Flow in Plants Justyna Wiśniewska, Jian Xu, Daniela Seifertová, Philip B. Brewer, Kamil
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/452/ra106/dc1 Supplementary Materials for Stem-piped light activates phytochrome B to trigger light responses in Arabidopsis thaliana roots Hyo-Jun Lee, Jun-Ho
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
More information** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.
Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *
More informationFigure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin
More informationNature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
More informationSupplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and
More informationSupplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.
Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny
More informationEXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA
EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital
More informationSUPPLEMENTARY INFORMATION
reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative
More informationGFP GAL bp 3964 bp
Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive
More informationPhotoreceptor Regulation of Constans Protein in Photoperiodic Flowering
Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering by Valverde et. Al Published in Science 2004 Presented by Boyana Grigorova CBMG 688R Feb. 12, 2007 Circadian Rhythms: The Clock Within
More informationSupplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and
More informationArabidopsis PPR40 connects abiotic stress responses to mitochondrial electron transport
Ph.D. thesis Arabidopsis PPR40 connects abiotic stress responses to mitochondrial electron transport Zsigmond Laura Supervisor: Dr. Szabados László Arabidopsis Molecular Genetic Group Institute of Plant
More informationTable S1 List of primers used for genotyping and qrt-pcr.
Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!
More informationSupp- Figure 2 Confocal micrograph of N. benthamiana tissues transiently expressing 35S:YFP-PDCB1. PDCB1 was targeted to plasmodesmata (twin punctate
Supplemental Data. Simpson et al. (009). n rabidopsis GPI-anchor plasmodesmal neck protein with callosebinding activity and potential to regulate cell-to-cell trafficking. 5 0 stack Supp- Figure Confocal
More informationSupplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed
Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the
More informationThe sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively as positive regulators of salt stress tolerance in rice
Lou et al. BMC Plant Biology (2018) 18:203 https://doi.org/10.1186/s12870-018-1408-0 RESEARCH ARTICLE Open Access The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively
More informationLipid transfer proteins confer resistance to trichothecenes
Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance
More informationrespect to the wild type in the later stages of growth. Photograph showing representative plants after 5 and 10 weeks growth.
A Supplemental Data. Araújo et al. (211). Plant Cell 1.115/tpc.11.81224 C B.5 Supplemental Figure 1. Characterization and expression of tomato SDH2-2. (A) Dendogram of iron sulphur subunit of SDH. SDH2
More information23-. Shoot and root development depend on ratio of IAA/CK
Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal
More informationSupplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2
Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2 IRT1, FRO2 and FIT expression levels in roots of the wild-type, nas4x- 1 and nas4x-2, showing that in both nas mutants
More informationJMJ14-HA. Col. Col. jmj14-1. jmj14-1 JMJ14ΔFYR-HA. Methylene Blue. Methylene Blue
Fig. S1 JMJ14 JMJ14 JMJ14ΔFYR Methylene Blue Col jmj14-1 JMJ14-HA Methylene Blue Col jmj14-1 JMJ14ΔFYR-HA Fig. S1. The expression level of JMJ14 and truncated JMJ14 with FYR (FYRN + FYRC) domain deletion
More informationLecture 13: PROTEIN SYNTHESIS II- TRANSLATION
http://smtom.lecture.ub.ac.id/ Password: https://syukur16tom.wordpress.com/ Password: Lecture 13: PROTEIN SYNTHESIS II- TRANSLATION http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/translation2.gif
More informationSupplemental Data. Yamamoto et al. (2016). Plant Cell /tpc WT + HCO 3. slac1-4/δnc #5 + HCO 3 WT + ABA. slac1-4/δnc #5 + ABA
I (pa) I (pa) A WT + HCO 3 B 2 V (mv) 15 1 5 5 2 slac14/δnc #5 + HCO 3 4 6 WT (n = 6) 8 WT + HCO 3 (n = 7) slac14/δnc #5 (n = 6) slac14/δnc #5 + HCO 3 (n = 1) C WT + ABA D 2 V (mv) 15 1 5 5 2 slac14/δnc
More informationPenghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao
New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang
More informationSupplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Mourier et al., http://www.jcb.org/cgi/content/full/jcb.201411100/dc1 Figure S1. Size and mitochondrial content in Mfn1 and Mfn2 knockout hearts. (A) Body
More informationSupplemental Figures. Supplemental Data. Sugliani et al. Plant Cell (2016) /tpc Clades RSH1. Rsh1[HS] RSH2 RSH3. Rsh4[HS] HYD TGS ACT
Supplemental Figures Clades RSH1 TP - HYD TGS ACT Rsh1[HS] RSH2 TP HYD SYN TGS Rsh2[HS] RSH3 TP HYD SYN TGS CRSH TP - SYN EFh Rsh4[HS] Supplemental Figure 1. Arabidopsis RSH domain structure. Schematic
More informationSupplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day
Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day conditions. Photo was taken when the wild type plant started to bolt. Scale bar represents 1 cm. Supplemental Figure 2. Flowering
More informationSupplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation
More informationCh. 10 Photosynthesis: The Calvin Cycle Life from Air
Ch. 10 Photosynthesis: The Calvin Cycle Life from Air 2007-2008 Whoops! Wrong Calvin The Calvin Cycle 1950s 1961 Remember what it means to be a plant Need to produce all organic molecules necessary for
More informationSUPPLEMENTARY INFORMATION
Supplemental Methods Isolation and mapping of SPCH An EMS-mutagenized population of tmm-1 (Col);E1728 (an enhancer trap GFP marking guard cells) was created. M2 seeds were collected from M1 s planted in
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY
More informationSupplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type
A B 2 3 3 2 1 1 Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type (A) and d27 (B) seedlings at the four
More informationVital metabolism for survival of life in the earth. Prof Adinpunya Mitra Agricultural & Food Engineering Department
Vital metabolism for survival of life in the earth Prof Adinpunya Mitra Agricultural & Food Engineering Department THE SUN: MAIN SOURCE OF ENERGY FOR LIFE ON EARTH THE BASICS OF PHOTOSYNTHESIS Almost all
More informationImportance of Protein sorting. A clue from plastid development
Importance of Protein sorting Cell organization depend on sorting proteins to their right destination. Cell functions depend on sorting proteins to their right destination. Examples: A. Energy production
More information4) Please cite Dagda et al J Biol Chem 284: , for any publications or presentations resulting from use or modification of the macro.
Supplement Figure S1. Algorithmic quantification of mitochondrial morphology in SH- SY5Y cells treated with known fission/fusion mediators. Parental SH-SY5Y cells were transiently transfected with an empty
More informationEthylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis
Ethylene is critical to the maintenance of primary root growth and Fe homeostasis under Fe stress in Arabidopsis Guangjie Li, Weifeng Xu, Herbert J. Kronzucker, Weiming Shi * Supplementary Data Supplementary
More informationPhotosynthesis: Life from Light and Air
Photosynthesis: Life from Light and Air 2007-2008 Energy needs of life All life needs a constant input of energy consumers producers Heterotrophs (Animals) get their energy from eating others eat food
More informationOxidative Phosphorylation versus. Photophosphorylation
Photosynthesis Oxidative Phosphorylation versus Photophosphorylation Oxidative Phosphorylation Electrons from the reduced cofactors NADH and FADH 2 are passed to proteins in the respiratory chain. In eukaryotes,
More informationSupplemental Data. Hou et al. (2016). Plant Cell /tpc
Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc.16.295 A Distance to 1 st nt of start codon Distance to 1 st nt of stop codon B Normalized PARE abundance 8 14 nt 17 nt Frame1 Arabidopsis inflorescence
More informationBiological Roles of Cytokinins
Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators
More informationPhotosynthesis: The Calvin Cycle
Whoops! Wrong Calvin 1950s 1961 Photosynthesis: The Calvin Cycle Remember what it means to be a plant Need to produce all organic molecules necessary for growth carbohydrates, lipids, proteins, nucleic
More informationSupplementary Table 1. Primers used in this study.
Supplementary Tale 1. Primers used in this study. Name Primer sequence (5'-3') Primers of PCR-ased molecular markers developed in this study M1 F M1 R M2 F M2 R M3 F M3 R M4 F M4 R M5 F M5 R M6 F M6 R
More informationSupplemental Table 1. Primers used for cloning and PCR amplification in this study
Supplemental Table 1. Primers used for cloning and PCR amplification in this study Target Gene Primer sequence NATA1 (At2g393) forward GGG GAC AAG TTT GTA CAA AAA AGC AGG CTT CAT GGC GCC TCC AAC CGC AGC
More information** LCA LCN PCA
% of wild type value % of wild type value a 12 1 8 2 b 12 1 8 2 LCA LCN PCA Col- sod3-1 Supplementary Figure 1 sod3-1 influences cell proliferation. (a) Fifth leaf cell area (LCA) and leaf cell number
More informationLast time: Obtaining information from a cloned gene
Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?
More informationCharacterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach
Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach ABSTRACT SUBMITTED TO JAMIA MILLIA ISLAMIA NEW DELHI IN PARTIAL FULFILMENT OF
More informationMechanism of CO 2 Fixation: Rubisco Step 1
dark means light-indendent! The Dark Reaction: Carbon Fixation Requires Rubisco: Ribulose-1,5-bisphosphate carboxylase RuBPi + C 6 x 3PG MW = 550, 000 g/mol Subunits eight small (14,000 g/mol) eight large
More informationEST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7.
hest1a / SMG6 EST1 Homology Domain 100 aa 853 695 761 780 1206 hest1 / SMG5 -like? -like 109 145 214 237 497 165 239 1016 114 207 212 381 583 hest1c / SMG7 a helical 1091 Sc 57 185 267 284 699 Figure S1:
More informationBCH Graduate Survey of Biochemistry
BCH 5045 Graduate Survey of Biochemistry Instructor: Charles Guy Producer: Ron Thomas Director: Marsha Durosier Lecture 55 Slide sets available at: http://hort.ifas.ufl.edu/teach/guyweb/bch5045/index.html
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary
More informationLECTURE 4: PHOTOTROPISM
http://smtom.lecture.ub.ac.id/ Password: https://syukur16tom.wordpress.com/ LECTURE 4: PHOTOTROPISM LECTURE FLOW 1. 2. 3. 4. 5. INTRODUCTION DEFINITION INITIAL STUDY PHOTROPISM MECHANISM PHOTORECEPTORS
More informationC-4 PATHWAY USMAN SUMO FRIEND TAMBUNAN ARLI ADITYA PARIKESIT EVI KRISTIN WULANDARI
C-4 PATHWAY USMAN SUMO FRIEND TAMBUNAN ARLI ADITYA PARIKESIT EVI KRISTIN WULANDARI BIOINFORMATICS GROUP DEPARTMENT OF CHEMISTRY FACULTY OF MATHEMATICS AND SCIENCE UNIVERSITY OF INDONESIA C-4 Plants The
More informationPlant mitochondrial dynamics
Plant mitochondrial dynamics Peroxisome Chloroplast Nucleus Mitochondria from Alberts et al. 1994 Living Arabidopsis leaf 10 µm Logan & Leaver (2000) Journal of Experimental Botany, 51: 865-871 5 µm S.
More information37 Modelling and experimental evidence for two separate steady states in the photosynthetic Calvin cycle
37 Modelling and experimental evidence for two separate steady states in the photosynthetic Calvin cycle M.G. Poolman and D.A. Fell School of Biology and Molecular Science, Oxford Brookes University, Headington,
More informationBy Jonathan I. Watkinson. Virginia Polytechnic Institute and State University. Doctor of Philosophy Horticulture
Characterization of two genes, trehalose-6-phosphate synthase/phosphatase and nucleotide binding protein, shown to be differentially regulated in roots of Cypripedium parviflorum var. pubescens grown with
More informationThe Role of Inorganic Carbon Transport and Accumulation in the CO 2 -Concentrating Mechanism and CO 2 Assimilation in Chlamydomonas
The Role of Inorganic Carbon Transport and Accumulation in the CO 2 -Concentrating Mechanism and CO 2 Assimilation in Chlamydomonas Is there a Role for the CCM in Increasing Biological CO 2 Capture? Generalized
More informationGENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL
GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,
More informationDevelopment 143: doi: /dev : Supplementary information
Supplementary Materials and Methods Plant materials The mutants and transgenic plants used in the present study were as follows: E361 (from Alex Webb s laboratory); tmm-1, ptmm::tmm-gfp and flp-1 (from
More informationDegradation of Rubulose-1, 5-Bisphosphate Carboxylase/Oxygenase in Wheat Leaves During Dark-induced Senescence
Acta Botanica Sinica 2004, 46 (2): 137 141 Rapid Communication http://www.chineseplantscience.com Degradation of Rubulose-1, 5-Bisphosphate Carboxylase/Oxygenase in Wheat Leaves During Dark-induced Senescence
More informationGenetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity
Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity Shih-Heng Su, Maria Cristina Suarez-Rodriguez, Patrick Krysan
More informationEffect of Acetosyringone on Agrobacterium-mediated Transformation of Eustoma grandiflorum Leaf Disks
JARQ 51 (4), 351-355 (2017) https://www.jircas.go.jp Improvement in Agrobacterium-mediated Transformation of Eustoma grandiflorum by Acetosyringone Effect of Acetosyringone on Agrobacterium-mediated Transformation
More informationGenome-wide multilevel spatial interactome model of rice
Sino-German Workshop on Multiscale Spatial Computational Systems Biology, Beijing, Oct 8-12, 2015 Genome-wide multilevel spatial interactome model of rice Ming CHEN ( 陈铭 ) mchen@zju.edu.cn College of Life
More informationHeterosis and inbreeding depression of epigenetic Arabidopsis hybrids
Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined
More informationSupplemental material
Supplemental material Table 1- Segregation analysis of sgt1a sgt1b double mutant plants Parental genotype No. of lines Normal seeds Phenotype Abnormal seeds Ratio of abnormal seeds (%) WT 3 171 2 1.16
More information(A) Calvin cycle (B) Cyclic electron transfer (C) Non-cyclic electron transfer (D) Photorespiration (E) Cellular respiration
AP Biology - Problem Drill 08: Photosynthesis No. 1 of 10 #01 1. What term does the statement below refer to? In a photosynthesis process, an electron is excited from P700 and delivered to its receptor,
More informationPHOTOSYNTHESIS: A BRIEF STORY!!!!!
PHOTOSYNTHESIS: A BRIEF STORY!!!!! This is one of the most important biochemical processes in plants and is amongst the most expensive biochemical processes in plant in terms of investment. Photosynthesis
More informationIllegitimate translation causes unexpected gene expression from on-target out-of-frame alleles
Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN
More information2015 AP Biology PRETEST Unit 3: Cellular Energetics Week of October
Name: Class: _ Date: _ 2015 AP Biology PRETEST Unit 3: Cellular Energetics Week of 19-23 October Multiple Choice Identify the choice that best completes the statement or answers the question. 1) Which
More informationCharacters related to higher starch accumulation in cassava storage roots
Characters related to higher starch accumulation in cassava storage roots You-Zhi Li **1, Jian-Yu Zhao *1, San-Min Wu 1, Xian-Wei Fan 1, Xing-Lu Luo 1 & Bao-Shan Chen **1 1 State Key Laboratory for Conservation
More information1 (a) Fig. 1.1 is a diagram representing a three-dimensional view of a chloroplast. space B. Fig (i) Name parts A to C in Fig A... B...
1 (a) Fig. 1.1 is a diagram representing a three-dimensional view of a chloroplast. A space B C Fig. 1.1 (i) Name parts A to C in Fig. 1.1. A... B... C... [3] (ii) Describe two ways in which the structure
More informationLiu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham.
Liu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham. Access from the University of Nottingham repository: http://eprints.nottingham.ac.uk/12529/3/thesis_part_2_final.pdf
More informationMaria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner
ABA represses the transcription of chloroplast genes Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner Supplementary data Supplementary tables Table
More informationLIGHT DEPENDENT & INDEPENDENT REACTIONS
LIGHT DEPENDENT & INDEPENDENT REACTIONS Photosynthesis is a two stage process Light dependent reactions o requires DIRECT light energy omakes energy carrier molecules that are used in the dark reaction
More informationSignificance. 1 To whom correspondence should be addressed.
REDUCED CHLOROPLAST COVERAGE genes from Arabidopsis thaliana help to establish the size of the chloroplast compartment Robert M. Larkin a,b,c,1, Giovanni Stefano b, Michael E. Ruckle b,c,2, Andrea K. Stavoe
More informationSOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent Seed Germination Downstream of PIL5 W
The Plant Cell, Vol. 20: 1260 1277, May 2008, www.plantcell.org ª 2008 American Society of Plant Biologists SOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent
More informationPhotosynthesis Definition and Superficial Overview
Photosynthesis Photosynthesis Definition and Superficial Overview Photosynthesis is the process used by plants to convert light energy from the sun into chemical energy that can be later released to fuel
More informationChapter 10: PHOTOSYNTHESIS
Chapter 10: PHOTOSYNTHESIS 1. Overview of Photosynthesis 2. Light Absorption 3. The Light Reactions 4. The Calvin Cycle 1. Overview of Photosynthesis Chapter Reading pp. 185-190, 206-207 What is Photosynthesis?
More informationLocated in the thylakoid membranes. Chlorophyll have Mg + in the center. Chlorophyll pigments harvest energy (photons) by absorbing certain
a review Located in the thylakoid membranes. Chlorophyll have Mg + in the center. Chlorophyll pigments harvest energy (photons) by absorbing certain wavelengths (blue-420 nm and red-660 nm are most important).
More informationPhotosynthesis. I. Photosynthesis overview A. Purpose B. Location. The light vs. the dark reaction Chloroplasts pigments A. Light absorption B.
Photosynthesis I. Photosynthesis overview A. Purpose B. Location II. III. The light vs. the dark reaction Chloroplasts pigments A. Light absorption B. Types IV. Light reactions A. Photosystems B. Photophosphorylation
More informationNOTES: CH 10, part 3 Calvin Cycle (10.3) & Alternative Mechanisms of C-Fixation (10.4)
NOTES: CH 10, part 3 Calvin Cycle (10.3) & Alternative Mechanisms of C-Fixation (10.4) 10.3 - The Calvin cycle uses ATP and NADPH to convert CO 2 to sugar The Calvin cycle, like the citric acid cycle,
More informationChapter 8 PHOTOSYNTHESIS Chapter # Chapter Title PowerPoint Image Slideshow
COLLEGE BIOLOGY PHYSICS Chapter 8 PHOTOSYNTHESIS Chapter # Chapter Title PowerPoint Image Slideshow Figure 8.0 Photosynthesis Figure 8.1 Earth s distribution of photosynthesis as seen via chlorophyll a
More informationQuestions for Biology IIB (SS 2006) Wilhelm Gruissem
Questions for Biology IIB (SS 2006) Plant biology Wilhelm Gruissem The questions for my part of Biology IIB, Plant Biology, are provided for self-study and as material for the exam. Please note that the
More informationDOI: 10.1038/ncb2819 Gαi3 / Actin / Acetylated Tubulin Gαi3 / Actin / Acetylated Tubulin a a Gαi3 a Actin Gαi3 WT Gαi3 WT Gαi3 WT b b Gαi3 b Actin Gαi3 KO Gαi3 KO Gαi3 KO # # Figure S1 Loss of protein
More informationSupplementary Methods
Supplementary Methods Microarray analysis Grains of 7 DAP of the wild-type and gif1 were harvested for RNA preparation. Microarray analysis was performed with the Affymetrix (Santa Clara, CA) GeneChip
More informationSupplemental Data. Yang et al. (2012). Plant Cell /tpc
Supplemental Figure 1. Mature flowers of P. heterotricha. (A) An inflorescence of P. heterotricha showing the front view of a zygomorphic flower characterized by two small dorsal petals and only two fertile
More informationLooking for LOV: Location of LOV1 function in Nicotiana benthamiana cells
Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells By: Patrick Rutledge 1 Dr. Jennifer Lorang 2,3, Dr. Marc Curtis 2,3, Dr. Thomas Wolpert 2,3 BioResource Research 1, Botany and
More informationCHAPTER XI PHOTOSYNTHESIS. DMA: Chapter 11 Hartmann's 1
CHAPTER XI PHOTOSYNTHESIS DMA: Chapter 11 Hartmann's 1 The nature of light The sun's energy travels through space to the earth as electromagnetic radiation waves at the speed of light, about 300,000 Km/s.
More informationydci GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC
Table S1. DNA primers used in this study. Name ydci P1ydcIkd3 Sequence GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC Kd3ydcIp2 lacz fusion YdcIendP1 YdcItrgP2 GAC AGC
More informationGenetics 275 Notes Week 7
Cytoplasmic Inheritance Genetics 275 Notes Week 7 Criteriafor recognition of cytoplasmic inheritance: 1. Reciprocal crosses give different results -mainly due to the fact that the female parent contributes
More informationGFP WxTP-GFP WxTP-GFP. stromules. DsRed WxTP-DsRed WxTP-DsRed. stromules
Supplemental Data. Kitajima et al. (2009). The rice -amylase glycoprotein is targeted from the Golgi apparatus through the secretory pathway to the plastids. A GFP WxTP-GFP WxTP-GFP stromules stromules
More informationCell Respiration: Energy for Plant Metabolism
Cell Respiration: Energy for Plant Metabolism Glucose is the originating molecule for respiration Production and consumption of ATP Coupled reactions: Endergonic reactions are coupled to exergonic ones
More informationPhotosynthesis: Carbon Reactions. Dr. Obaidur Rahman
Photosynthesis: Carbon Reactions Dr. Obaidur Rahman Topics: Part I THE CALVIN CYCLE The Calvin Cycle Has Three Stages: Carboxylation, Reduction, and Regeneration The Carboxylation of Ribulose Bisphosphate
More informationGenetic Characterization and Functional Analysis of the GID1 Gibberellin Receptors in Arabidopsis W
The Plant Cell, Vol. 18, 3399 3414, December 2006, www.plantcell.org ª 2006 American Society of Plant Biologists Genetic Characterization and Functional Analysis of the GID1 Gibberellin Receptors in Arabidopsis
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature13082 Supplementary Table 1. Examination of nectar production in wild-type and atsweet9 flowers. No. of flowers with detectable nectar out of the total observed
More information1. Photosynthesis is the process of making a simple organic molecule from inorganic compounds (molecules) utilizing light energy.
PHOTOSYNTHESIS A. INTRODUCTION 1. Photosynthesis is the process of making a simple organic molecule from inorganic compounds (molecules) utilizing light energy. a. It takes energy input for synthesis.
More informationfor pollen viability in Arabidopsis thaliana
The Plant Journal (2006) 48, 193 205 doi: 10.1111/j.1365-313X.2006.02863.x The protein kinase genes MAP3Ke1 and MAP3Ke2 are required for pollen viability in Arabidopsis thaliana Suraphon Chaiwongsar 1,
More informationm1 m2 m3 m4 m5 m6 m7 m8 wt m m m m m m m m8 - + wt +
otherwise, you couldn't grow them!) You perform pairwise infections with each of your mutant bacteriophage strains and get the following results: (+) = pair of phages lysed host cells, (-) = pair of phages
More information