Size: px
Start display at page:

Download ""

Transcription

1 DOI: /ncb2819 Gαi3 / Actin / Acetylated Tubulin Gαi3 / Actin / Acetylated Tubulin a a Gαi3 a Actin Gαi3 WT Gαi3 WT Gαi3 WT b b Gαi3 b Actin Gαi3 KO Gαi3 KO Gαi3 KO # # Figure S1 Loss of protein expression in Gα i3 knockout. Surface views of cochleae from Gnα i3 wild-type (Gα i3 WT) (a a ) and Gnα i3 knockout mice (Gα i3 KO) (b b ). The strong acetylated tubulin between IHCs and OHC1 rows (b) is due to labeling of the inner pillar cell heads. Labeling of (green) is absent from the cochlear epithelium of the knockouts. IHC (#) and OHC (,,). Scale bar: 10 mm (a-b). 1

2 Figure S2 Acetylated tubulin and pericentrin labeling correlates after G- protein signaling disruption. (a-b ) Representative surface views of HCs from mpins Ctrl (a) and mpins KO mice (b) labeled with pericentrin (green), acetylated tubulin (red) and phalloidin (blue), and the corresponding diagram on the right. Kinocilium and pericentrin coordinates were determined according to a grid applied to each HC as depicted on the HC schemes. The Y axis on the histograms correspond to the pericentrin position (x or y coordinates), the X axis correspond to the kinocilium position (x and y coordinates). Scale bar: 2 mm (a-b). (c,d ) Plots illustrating the correlation between the x and y coordinates from the base of the kinocilium and the pericentrin labeling in (c, c ) Gα i3 WT (n = 102 OHCs, n = 42 IHCs) and (d, d ) Gα i3 KO (n = 108 OHCs, n = 35 IHCs) mice. (e,f ) Plots illustrating the correlation between the x and y coordinates in (e, e ) mpins Ctrl (n=77 OHCs, n=34 IHCs) and (f, f ) mpins KO (n=77 OHCs, n=33 IHCs) mice. (g,h ) Plots illustrating the correlation between the x and y coordinates in (g,g ) PTX-untreated (n=101 OHCs, n=30 IHCs) and (h, h ) PTX-treated (n=110 OHCs, n=47 IHCs) cochlear explants. 2

3 Figure S3 Generation of mpins conditional mutant and localisation of apical asymmetrical complexes in the organ of Corti. (a) Schematic representation of the mouse mpins gene targeting strategy. Exons 5, 6, and 7 of the gene were excised following Cre and Flpe-mediated recombination. Regions of homologous recombination are indicated by light gray shading. AseI (A) and SacI (S) and the locations of the probes (5, 3 ) used for Southern blotting analysis are indicated. (b) Southern blot of recombinant ES cells showing homologous integration. (c) PCR genotyping to detect wild-type (170 bp) and targeted (250 bp) alleles. Cre-mediated excision was confirmed in cochlea by the presence of a 300 bp product. (d) Western blotting analysis of the mpins protein (75 kda) in control and mpins cko inner ear. In the cko, the protein levels are strongly reduced. (e-f ) Surface views of cochleae from mpins controls (Ctrl, e-e ) and mpins conditional knockouts (mpins cko, f-f ) from P0/P1 mice processed for immunocytochemistry. Labeling of mpins (green) is absent from the cochlear epithelium of the conditional knockouts.(g,g ) Surface view (g) and Z-stack (g ) confocal cross-section showing the apical localization of Par-6b (green) compared to β-catenin (red). (g ) Lateral view of (g) at the level indicated by the dashed line. (h, h ) Gα i3 (green) is located on the distal-abneural side of the HCs, opposite Vangl2 (red). (h ) High magnification of the inset in h. (i, i ) Gα o (green) labeling reveals weak cytosolic staining in HCs and in the non-sensory region, but no asymmetrical accumulation. Hair bundles and cell junctions were labeled with phalloidin (blue). (j) Representative immunoblot of brain (expressing Gα o ) and liver (not expressing Gα o ) membranes using Gα o antibody. Purified Gα o1 protein served as a positive control. IHC (#) and OHC (,,). Scale bar: 10 mm (e-i). 3

4 Figure S4 Gα i inhibition leads to loss-of-cilium-like morphological defects in the hair bundle. (a) In cultures treated with 5 pg/ml PTX for 48 hours (T3) the distributions of the orientations follow a gradient of severity from OHC1 to OHC3. HCs numbers, out of 2 cochleae per condition, are as follows: PTX T3 (n = 65,68,64 respectively for OHC1, OHC2, OHC3) (b, b ) Vangl2 asymmetry (green) is maintained in mpins cko. (c-d ) In cultures treated with 5 pg/ml PTX for 24 hours (T1), we observe hair bundles exhibiting round (c, c ) or flat shapes (d, d ). (e-f ) The apkc expression domain is more extended at the membrane of HCs in cultures treated with high doses (1 ng/ml) of PTX (f f ) compared to untreated (Unt) cultures (e e ). Note the long cilium in PTX-treated cultures. (g-i) High magnifications of a representative HC from (e) and (f). (h, j) Circular histograms of the distribution of apkc staining in Unt and PTX-treated condition. Each histogram represent data from 30 HCs. Statistical analysis via a two-tailed t test (P< ). Error bars show s.e.m. Scale bars: 10 µm (in b, e-f), 2 µm (in b -d, g -i ). 4

5 Figure S5 Gα i3 is recruited asymmetrically prior to kinocilium migration. (a c ) Luminal surface views of a cochlear epithelium at E15.5 at different locations along the duct. In the apical region of the sensory epithelium, only a few scattered HCs (future IHCs) have started to undergo differentiation, as indicated by MyoVI expression (a, arrowheads) and an apical actin ring (a, arrowheads). (b-b4) In a more basal region of the cochlea, and in the distal-abneural OHC region, Gα i3 starts to accumulate centrally in a few differentiating cells (b, white arrow). In the absence of asymmetrical Gα i3 localization, the kinocilium does not migrate in these cells (b, b1, b2, white arrowhead). By comparison, a line of differentiated IHCs is present, expressing Gα i3 asymmetrically and showing a distal kinocilium (b, b3-b4, yellow arrow and arrowhead). The white lines indicate the relative midline of every HC. (c c ) Luminal surface views of the basal region of cochlear epithelia at E15.5. Gα i3 is asymmetrically localized at the distal-abneural side of IHCs but absent from the prospective OHC region. Insets: higher magnification view of IHCs (yellow arrow) and future OHCs (white arrow) from (c) revealing that the kinocilium is always localized distally in IHCs (yellow arrowhead) but not in future OHCs (white arrowhead). (d-e ) Luminal surface views of the mid-basal to apical region of cochlear epithelia at E16.5 labeled with apkc (d-d ) and Par-6b (e,e ). The proteins are not asymmetrically distributed. (fg) HC differentiation is completed by P0, with every HC expressing MyoVI (f, green), and Gα i3 is asymmetrically localized to the distal-abneural side along with the kinocilium (g and g1-g4, green). Scale bars: 10 µm (in a-f). (h-i ) The asymmetric distribution of mpins (h-h, green) and Par-6B (i, i ) are inverted across the striola in the P0 utricular epithelium (dashed line). β2- spectrin immunostaining labels the cuticular plate (red). Arrows indicate HC polarity with respect to the lateral (Lat) or medial (Med) side of the utricle. (j) Scatter plots of the localization of the kinocilium relative to the center of the Gα i3 expression domain reveals a strong association between Gα i3 and the kinocilium position in wild type (n = 218 OHCs and 68 IHCs), Vangl2 Lp/ Lp (n = 237 OHCs and 73 IHCs) and PTK7 mutants (n = 124 OHCs and 33 IHCs). The dashed line indicates a perfect correlation (r = 1). (k, k ) Ectopic HCs induced by Atoh1-IRES-GFP expression (green) in the non-sensory epithelium display asymmetric cortical apkc (red) localization opposite to the kinocilium side. The dashed line indicates the boundary between the sensory and nonsensory epithelium. (l) Schematic representation of (k). 5

6 Figure S6 Full scans 6

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3267 Supplementary Figure 1 A group of genes required for formation or orientation of annular F-actin bundles and aecm ridges: RNAi phenotypes and their validation by standard mutations.

More information

Fig. S1. Proliferation and cell cycle exit are affected by the med mutation. (A,B) M-phase nuclei are visualized by a-ph3 labeling in wild-type (A)

Fig. S1. Proliferation and cell cycle exit are affected by the med mutation. (A,B) M-phase nuclei are visualized by a-ph3 labeling in wild-type (A) Fig. S1. Proliferation and cell cycle exit are affected by the med mutation. (A,B) M-phase nuclei are visualized by a-ph3 labeling in wild-type (A) and mutant (B) 4 dpf retinae. The central retina of the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION GP2 Type I-piliated bacteria FAE M cell M cell pocket idc T cell mdc Generation of antigenspecific T cells Induction of antigen-specific mucosal immune response Supplementary Figure 1 Schematic diagram

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11419 Supplementary Figure 1 Schematic representation of innate immune signaling pathways induced by intracellular Salmonella in cultured macrophages. a, During the infection Salmonella

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/301/ra98/dc1 Supplementary Materials for Regulation of Epithelial Morphogenesis by the G Protein Coupled Receptor Mist and Its Ligand Fog Alyssa J. Manning,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb97 P ( μm, hours) 1 2 4 P DMSO Figure S1 unningham et al. E 97 65 27 MFN1 GFP-Parkin Opa1 ctin GPDH HEK293 GFP-Parkin 19 115 97 65 27 Mitochondrial Fraction SH-SY5Y GFP-Parkin Mito DMSO Mito

More information

Supplementary Figure 1. Real time in vivo imaging of SG secretion. (a) SGs from Drosophila third instar larvae that express Sgs3-GFP (green) and

Supplementary Figure 1. Real time in vivo imaging of SG secretion. (a) SGs from Drosophila third instar larvae that express Sgs3-GFP (green) and Supplementary Figure 1. Real time in vivo imaging of SG secretion. (a) SGs from Drosophila third instar larvae that express Sgs3-GFP (green) and Lifeact-Ruby (red) were imaged in vivo to visualize secretion

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2215 Figure S1 Number of egfp-vps4a bursts versus cellular expression levels. The total number of egfp-vps4a bursts, counted at the end of each movie (frame 2000, after 1h 28 min) are plotted

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2647 Figure S1 Other Rab GTPases do not co-localize with the ER. a, Cos-7 cells cotransfected with an ER luminal marker (either KDEL-venus or mch-kdel) and mch-tagged human Rab5 (mch-rab5,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. NAD + -related genes expression in mouse tissues and in cells overexpressing NRK1. mrna (a) and protein (b) levels of NRK1, NRK2 and other enzymes involved

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2362 Figure S1 CYLD and CASPASE 8 genes are co-regulated. Analysis of gene expression across 79 tissues was carried out as described previously [Ref: PMID: 18636086]. Briefly, microarray

More information

Nature Neuroscience: doi: /nn.2662

Nature Neuroscience: doi: /nn.2662 Supplementary Figure 1 Atlastin phylogeny and homology. (a) Maximum likelihood phylogenetic tree based on 18 Atlastin-1 sequences using the program Quicktree. Numbers at internal nodes correspond to bootstrap

More information

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization

More information

Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1

Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1 Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1 F/F ;mir-17~92 F/F (Pkd1-miR-17~92KO) mice. (A) Q-PCR

More information

downstream (0.8 kb) homologous sequences to the genomic locus of DIC. A DIC mutant strain (ro- 6

downstream (0.8 kb) homologous sequences to the genomic locus of DIC. A DIC mutant strain (ro- 6 A B C D ts Figure S1 Generation of DIC- mcherry expressing N.crassa strain. A. N. crassa colony morphology. When a cot1 (top, left panel) strain is grown at permissive temperature (25 C), it exhibits straight

More information

Hair Cells: The Sensory Transducers of the Inner Ear

Hair Cells: The Sensory Transducers of the Inner Ear Chapter 1 Hair Cells: The Sensory Transducers of the Inner Ear Hair cells are specialized cells that transform a mechanical motion into changes in membrane potential. Such changes, whereby one form of

More information

Supplemental Data. Wang et al. (2014). Plant Cell /tpc

Supplemental Data. Wang et al. (2014). Plant Cell /tpc Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11589 Supplementary Figure 1 Ciona intestinalis and Petromyzon marinus neural crest expression domain comparison. Cartoon shows dorsal views of Ciona mid gastrula (left) and Petromyzon

More information

Role of Mitochondrial Remodeling in Programmed Cell Death in

Role of Mitochondrial Remodeling in Programmed Cell Death in Developmental Cell, Vol. 12 Supplementary Data Role of Mitochondrial Remodeling in Programmed Cell Death in Drosophila melanogaster Gaurav Goyal, Brennan Fell, Apurva Sarin, Richard J. Youle, V. Sriram.

More information

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN

More information

Auditory Hair Cell Centrioles Undergo Confined Brownian Motion Throughout the Developmental Migration of the Kinocilium

Auditory Hair Cell Centrioles Undergo Confined Brownian Motion Throughout the Developmental Migration of the Kinocilium 48 Biophysical Journal Volume 105 July 2013 48 58 Auditory Hair Cell Centrioles Undergo Confined Brownian Motion Throughout the Developmental Migration of the Kinocilium Léa Lepelletier, k ** 6 Jacques

More information

Supplemental Information. The Mitochondrial Fission Receptor MiD51. Requires ADP as a Cofactor

Supplemental Information. The Mitochondrial Fission Receptor MiD51. Requires ADP as a Cofactor Structure, Volume 22 Supplemental Information The Mitochondrial Fission Receptor MiD51 Requires ADP as a Cofactor Oliver C. Losón, Raymond Liu, Michael E. Rome, Shuxia Meng, Jens T. Kaiser, Shu-ou Shan,

More information

Dishevelled genes mediate a conserved mammalian PCP pathway to regulate convergent extension during neurulation

Dishevelled genes mediate a conserved mammalian PCP pathway to regulate convergent extension during neurulation RESEARCH ARTICLE 1767 Development 133, 1767-1778 (2006) doi:10.1242/dev.02347 Dishevelled genes mediate a conserved mammalian PCP pathway to regulate convergent extension during neurulation Jianbo Wang

More information

Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2.

Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2. Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice. Percentage of marginal zone B cells in the spleen of wild-type mice (+/+), mice homozygous for cpm or pri

More information

Article. PTK7 Regulates Myosin II Activity to Orient Planar Polarity in the Mammalian Auditory Epithelium

Article. PTK7 Regulates Myosin II Activity to Orient Planar Polarity in the Mammalian Auditory Epithelium Current Biology 22, 956 966, June 5, 2012 ª2012 Elsevier Ltd All rights reserved DOI 10.1016/j.cub.2012.03.068 PTK7 Regulates Myosin II Activity to Orient Planar Polarity in the Mammalian Auditory Epithelium

More information

FSC-W FSC-H CD4 CD62-L

FSC-W FSC-H CD4 CD62-L Supplementary Fig. 1 a SSC-A FSC-A FSC-W FSC-H SSC-W SSC-H CD4 CD62-L b SSC-A FSC-A FSC-W FSC-A FSC-A 7-AAD FSC-A CD4 IL-9 CD4 c SSC-A FSC-A FSC-W FSC-H SSC-W SSC-H 7-AAD KI67 Annexin-V 7-AAD d I L -5

More information

Heather Currinn, Benjamin Guscott, Zita Balklava, Alice Rothnie and Thomas Wassmer*

Heather Currinn, Benjamin Guscott, Zita Balklava, Alice Rothnie and Thomas Wassmer* Online Resources APP controls the formation of PI(3,5)P 2 vesicles through its binding of the PIKfyve complex. Cellular and Molecular Life Sciences Heather Currinn, Benjamin Guscott, Zita Balklava, Alice

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1 Sns and Duf co-localise in embryonic nephrocytes a-c, Wild-type stage 11 (a),14 (b) and 16 (c) embryos stained with anti-duf (green) and anti-sns (red). Higher magnification images

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Modeling of magnetic field In this study, the magnetic field was generated with N52 grade nickel-plated neodymium block magnets (K&J Magnetics). The residual flux density of the magnets

More information

Supplemental material

Supplemental material Supplemental material THE JOURNAL OF CELL BIOLOGY Mourier et al., http://www.jcb.org/cgi/content/full/jcb.201411100/dc1 Figure S1. Size and mitochondrial content in Mfn1 and Mfn2 knockout hearts. (A) Body

More information

Mitochondrial Dynamics Is a Distinguishing Feature of Skeletal Muscle Fiber Types and Regulates Organellar Compartmentalization

Mitochondrial Dynamics Is a Distinguishing Feature of Skeletal Muscle Fiber Types and Regulates Organellar Compartmentalization Cell Metabolism Supplemental Information Mitochondrial Dynamics Is a Distinguishing Feature of Skeletal Muscle Fiber Types and Regulates Organellar Compartmentalization Prashant Mishra, Grigor Varuzhanyan,

More information

Fluid Flow and Interlinked Feedback Loops Establish Left-Right Asymmetric Decay of Cerl2 mrna in the Mouse Embryo

Fluid Flow and Interlinked Feedback Loops Establish Left-Right Asymmetric Decay of Cerl2 mrna in the Mouse Embryo Fluid Flow and Interlinked Feedback Loops Establish Left-Right Asymmetric Decay of Cerl2 mrna in the Mouse Embryo Tetsuya Nakamura, 1 Daisuke Saito, 2 Aiko Kawasumi, 1 Kyosuke Shinohara, 1 Yasuko Asai,

More information

Supporting Information

Supporting Information Supporting Information Cao et al. 10.1073/pnas.1306220110 Gram - bacteria Hemolymph Cytoplasm PGRP-LC TAK1 signalosome Imd dfadd Dredd Dnr1 Ikk signalosome P Relish Nucleus AMP and effector genes Fig.

More information

Intravital Imaging Reveals Ghost Fibers as Architectural Units Guiding Myogenic Progenitors during Regeneration

Intravital Imaging Reveals Ghost Fibers as Architectural Units Guiding Myogenic Progenitors during Regeneration Cell Stem Cell Supplemental Information Intravital Imaging Reveals Ghost Fibers as Architectural Units Guiding Myogenic Progenitors during Regeneration Micah T. Webster, Uri Manor, Jennifer Lippincott-Schwartz,

More information

Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc

Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector

More information

Actions of auxin. Hormones: communicating with chemicals History: Discovery of a growth substance (hormone- auxin)

Actions of auxin. Hormones: communicating with chemicals History: Discovery of a growth substance (hormone- auxin) Hormones: communicating with chemicals History- discovery of plant hormone. Auxin Concepts of hormones Auxin levels are regulated by synthesis/degradation, transport, compartmentation, conjugation. Polar

More information

TNFα 18hr. Control. CHX 18hr. TNFα+ CHX 18hr. TNFα: 18 18hr (KDa) PARP. Cleaved. Cleaved. Cleaved. Caspase3. Pellino3 shrna. Control shrna.

TNFα 18hr. Control. CHX 18hr. TNFα+ CHX 18hr. TNFα: 18 18hr (KDa) PARP. Cleaved. Cleaved. Cleaved. Caspase3. Pellino3 shrna. Control shrna. Survival ( %) a. TNFα 18hr b. Control sirna Pellino3 sirna TNFα: 18 18hr c. Control shrna Pellino3 shrna Caspase3 Actin Control d. Control shrna Pellino3 shrna *** 100 80 60 CHX 18hr 40 TNFα+ CHX 18hr

More information

Super-resolution microscopy reveals a LINC complex recruitment at nuclear indentation sites

Super-resolution microscopy reveals a LINC complex recruitment at nuclear indentation sites Supplementary Information Super-resolution microscopy reveals a LINC complex recruitment at nuclear indentation sites Marie Versaevel 1, Jean-Baptiste Braquenier 2, Maryam Riaz 1, Thomas Grevesse 1, Joséphine

More information

Lipid transfer proteins confer resistance to trichothecenes

Lipid transfer proteins confer resistance to trichothecenes Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance

More information

Supplementary Figure 1. AnnexinV FITC and Sytox orange staining in wild type, Nlrp3 /, ASC / and casp1/11 / TEC treated with TNF /CHX.

Supplementary Figure 1. AnnexinV FITC and Sytox orange staining in wild type, Nlrp3 /, ASC / and casp1/11 / TEC treated with TNF /CHX. Supplementary Figure 1. AnnexinV FITC and Sytox orange staining in wild type, Nlrp3 /, ASC / and casp1/11 / TEC treated with TNF /CHX. Phase contrast and widefield fluorescence microscopy (20x magnification).

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. In vitro screening of recombinant R-CaMP2 variants.

Nature Methods: doi: /nmeth Supplementary Figure 1. In vitro screening of recombinant R-CaMP2 variants. Supplementary Figure 1 In vitro screening of recombinant R-CaMP2 variants. Baseline fluorescence compared to R-CaMP1.07 at nominally zero calcium plotted versus dynamic range ( F/F) for 150 recombinant

More information

Functional interactions between Fat family cadherins in tissue morphogenesis and planar polarity

Functional interactions between Fat family cadherins in tissue morphogenesis and planar polarity 1806 RESEARCH ARTICLE Development 139, 1806-1820 (2012) doi:10.1242/dev.077461 2012. Published by The Company of Biologists Ltd Functional interactions between Fat family cadherins in tissue morphogenesis

More information

Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA

Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA Himber et al. Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA silencing SUPPLEMENTAL MATERIAL Supplemental material 1. Short-range movement of GFP silencing affects a nearly

More information

Neurite formation & neuronal polarization

Neurite formation & neuronal polarization Neurite formation & neuronal polarization Paul Letourneau letou001@umn.edu Chapter 16; The Cytoskeleton; Molecular Biology of the Cell, Alberts et al. 1 An immature neuron in cell culture first sprouts

More information

Turing at 100: Legacy of a universal mind

Turing at 100: Legacy of a universal mind Turing at 100: Legacy a universal mind Nature 23 february 2012 Turing instability u t = au+ bv+ D u xxu u 3 dv dt = cu+ dv+ D v xxv Above threshold Below threshold Turing instability : a simple non linear

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10923 Supplementary Figure 1 Ten-a and Ten-m antibody and cell type specificities. a c, Representative single confocal sections of a Drosophila NMJ stained with antibodies to Ten-a (red),

More information

Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring

Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring Current Biology Supplemental Information Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring Caroline Laplante, Julien Berro, Erdem Karatekin,

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Characterisation of IHG-1 overexpressing and knockdown cell lines. (A) Total cellular RNA was prepared from HeLa cells stably overexpressing IHG-1 or mts-ihg-1. IHG-1 mrna was quantified

More information

Fig. S1. Expression pattern of moody-gal4 in third instar. Maximum projection illustrating a dissected moody-gal4>ngfp L3 larva stained for Repo

Fig. S1. Expression pattern of moody-gal4 in third instar. Maximum projection illustrating a dissected moody-gal4>ngfp L3 larva stained for Repo Fig. S1. Expression pattern of moody-gal4 in third instar. Maximum projection illustrating a dissected moody-gal4>ngfp L3 larva stained for Repo (magenta), Fas2 (blue) and GFP (green) in overview (A) and

More information

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions. Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods

More information

7.06 Problem Set #4, Spring 2005

7.06 Problem Set #4, Spring 2005 7.06 Problem Set #4, Spring 2005 1. You re doing a mutant hunt in S. cerevisiae (budding yeast), looking for temperaturesensitive mutants that are defective in the cell cycle. You discover a mutant strain

More information

Supplementary Figure 1. CoMIC in 293T, HeLa, and HepG2 cells. (a) Mitochondrial morphology in 293T, HeLa and HepG2 cells. Cells were transfected with

Supplementary Figure 1. CoMIC in 293T, HeLa, and HepG2 cells. (a) Mitochondrial morphology in 293T, HeLa and HepG2 cells. Cells were transfected with Supplementary Figure 1. CoMIC in 293T, HeLa, and HepG2 cells. (a) Mitochondrial morphology in 293T, HeLa and HepG2 cells. Cells were transfected with DsRed-mito. Right panels are time-course enlarged images

More information

Table S1 List of primers used for genotyping and qrt-pcr.

Table S1 List of primers used for genotyping and qrt-pcr. Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!

More information

Supplemental Materials Molecular Biology of the Cell

Supplemental Materials Molecular Biology of the Cell Supplemental Materials Molecular iology of the Cell Figure S1 Krüger et al. Arabidopsis Plasmodium H. sapiens* 1) Xenopus* 1) Drosophila C.elegans S.cerevisae S.pombe L.major T.cruzi T.brucei DCP5 CITH

More information

Supplementary Figure 1 Analysis of beige fat and cells and characteristics of exosome release, related to Figure 1

Supplementary Figure 1 Analysis of beige fat and cells and characteristics of exosome release, related to Figure 1 Supplementary Figure 1 Analysis of beige fat and cells and characteristics of exosome release, related to Figure 1 (a) Fold-change in UCP-1 mrna abundance in white adipocytes upon β-adrenergic stimulation

More information

Actinobacteria Relative abundance (%) Co-housed CD300f WT. CD300f KO. Colon length (cm) Day 9. Microscopic inflammation score

Actinobacteria Relative abundance (%) Co-housed CD300f WT. CD300f KO. Colon length (cm) Day 9. Microscopic inflammation score y groups y individuals 9 Actinobacteria Relative abundance (%) acteroidetes Cyanobacteria Deferribacteres Firmicutes Proteobacteria TM Tenericutes Unclassified CDf CDf Co-housed CDf Co-housed CDf CDf CDf

More information

Neurite formation & neuronal polarization. The cytoskeletal components of neurons have characteristic distributions and associations

Neurite formation & neuronal polarization. The cytoskeletal components of neurons have characteristic distributions and associations Mechanisms of neuronal migration & Neurite formation & neuronal polarization Paul Letourneau letou001@umn.edu Chapter 16; The Cytoskeleton; Molecular Biology of the Cell, Alberts et al. 1 The cytoskeletal

More information

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL SUPPLEMENTAL MATERIAL Figure S1. Mitochondrial morphology in Fis1-null, Mff-null and Fis1/Mff-null MEF cells. (A) Western blotting of lysates from Fis1-null, Mff-null and Fis1/Mff-null cells. Lysates were

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/281/ra51/dc1 Supplementary Materials for Rapgef2 Connects GPCR-Mediated camp Signals to ERK Activation in Neuronal and Endocrine Cells Andrew C. Emery, Maribeth

More information

Biological Roles of Cytokinins

Biological Roles of Cytokinins Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,

More information

Isoform-specific functions of Mud/NuMA mediate binucleation of Drosophila male accessory gland cells

Isoform-specific functions of Mud/NuMA mediate binucleation of Drosophila male accessory gland cells Taniguchi et al. BMC Developmental Biology (2014) 14:46 DOI 10.1186/s12861-014-0046-5 RESEARCH ARTICLE Open Access Isoform-specific functions of Mud/NuMA mediate binucleation of Drosophila male accessory

More information

Distinct capacity for differentiation to inner ear cell types by progenitor cells of the cochlea and vestibular organs

Distinct capacity for differentiation to inner ear cell types by progenitor cells of the cochlea and vestibular organs First posted online on 27 October 2016 as 10.1242/dev.139840 Access the most recent version at http://dev.biologists.org/lookup/doi/10.1242/dev.139840 Distinct capacity for differentiation to inner ear

More information

Tissue/planar cell polarity in vertebrates: new insights and new questions

Tissue/planar cell polarity in vertebrates: new insights and new questions REVIEW 647 Development 134, 647-658 (2007) doi:10.1242/dev.02772 Tissue/planar cell polarity in vertebrates: new insights and new questions Yanshu Wang 1 and Jeremy Nathans 1,2 This review focuses on the

More information

Hair Cell Generation by Notch Inhibition in the Adult Mammalian Cristae

Hair Cell Generation by Notch Inhibition in the Adult Mammalian Cristae JARO 14: 813 828 (2013) DOI: 10.1007/s10162-013-0414-z D 2013 Association for Research in Otolaryngology Research Article JARO Journal of the Association for Research in Otolaryngology Hair Cell Generation

More information

Retinoic acid signalling regulates the development of tonotopically patterned hair cells in the chicken cochlea

Retinoic acid signalling regulates the development of tonotopically patterned hair cells in the chicken cochlea Received 23 Sep 2013 Accepted 8 Apr 2014 Published 20 May 2014 DOI: 10.1038/ncomms4840 Retinoic acid signalling regulates the development of tonotopically patterned hair cells in the chicken cochlea Benjamin

More information

Baz, Par-6 and apkc are not required for axon or dendrite specification in Drosophila

Baz, Par-6 and apkc are not required for axon or dendrite specification in Drosophila Baz, Par-6 and apkc are not required for axon or dendrite specification in Drosophila Melissa M. Rolls and Chris Q. Doe, Inst. Neurosci and Inst. Mol. Biol., HHMI, Univ. Oregon, Eugene, Oregon 97403 Correspondence

More information

Supplementary Figure 1. Confirmation of REF52-hE2F1p::4NLS-d4Venus reporter cells and characterization of E2F dynamics. (a) Alignment of E2F dynamics

Supplementary Figure 1. Confirmation of REF52-hE2F1p::4NLS-d4Venus reporter cells and characterization of E2F dynamics. (a) Alignment of E2F dynamics Supplementary Figure 1. Confirmation of REF52-hE2F1p::4NLS-d4Venus reporter cells and characterization of E2F dynamics. (a) Alignment of E2F dynamics trajectories to endogenous E2F1 mrna expression. Gray

More information

Frequency (Hz) Amplitude (pa) D1 WT D1 KO D2 WT D2 KO D1 WT D1 KO D2 WT D2 KO

Frequency (Hz) Amplitude (pa) D1 WT D1 KO D2 WT D2 KO D1 WT D1 KO D2 WT D2 KO A D1 MSNs B D2 MSNs C Frequency (Hz) 4 3 2 1 D Amplitude (pa) 5 4 3 2 1 D1 D1 D2 D2 D1 D1 D2 D2 Supplemental Figure 1. B deletion did not alter GABA-mIPSCs in D1 or D2 MSNs. (A,B) Representative recording

More information

The retinoblastoma gene pathway regulates the postmitotic state of hair cells of the mouse inner ear

The retinoblastoma gene pathway regulates the postmitotic state of hair cells of the mouse inner ear Research article 2377 The retinoblastoma gene pathway regulates the postmitotic state of hair cells of the mouse inner ear Johanna Mantela 1, Zhe Jiang 2, Jukka Ylikoski 1, Bernd Fritzsch 3, Eldad Zacksenhaus

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Single-cell RNA sequencing reveals unique sets of neuropeptides, transcription factors and receptors in specific types of sympathetic neurons (a) Dissection of paravertebral SGs

More information

targets. clustering show that different complex pathway

targets. clustering show that different complex pathway Supplementary Figure 1. CLICR allows clustering and activation of cytoplasmic protein targets. (a, b) Upon light activation, the Cry2 (red) and LRP6c (green) components co-cluster due to the heterodimeric

More information

SUPPLEMENTARY FIGURES AND TABLES AND THEIR LEGENDS. Transient infection of the zebrafish notochord triggers chronic inflammation

SUPPLEMENTARY FIGURES AND TABLES AND THEIR LEGENDS. Transient infection of the zebrafish notochord triggers chronic inflammation SUPPLEMENTARY FIGURES AND TABLES AND THEIR LEGENDS Transient infection of the zebrafish notochord triggers chronic inflammation Mai Nguyen-Chi 1,2,5, Quang Tien Phan 1,2,5, Catherine Gonzalez 1,2, Jean-François

More information

Hes5. Hes Relative mrna levels

Hes5. Hes Relative mrna levels A a Absolute mrna levels 6 5 4 3 2 1 hjag1 EP cdl1 EP Jag1 E2+1 b d m Hey1 c e EP Hey1 Dl1 E2+1 f h m Hey1 g i EP Hey1 1 a Hes5 Hes5 a Hes5 Hes5 B a b EP e 1.4 1.2 EP GFP GFP E2+1 c m Hey1 d Hey1 Relative

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION med!1,2 Wild-type (N2) end!3 elt!2 5 1 15 Time (minutes) 5 1 15 Time (minutes) med!1,2 end!3 5 1 15 Time (minutes) elt!2 5 1 15 Time (minutes) Supplementary Figure 1: Number of med-1,2, end-3, end-1 and

More information

Anisotropy of Crumbs and apkc Drives Myosin Cable Assembly during Tube Formation

Anisotropy of Crumbs and apkc Drives Myosin Cable Assembly during Tube Formation Article Anisotropy of Crumbs and apkc Drives Myosin Cable Assembly during Tube Formation Katja Röper 1, * 1 MRC-Laboratory of Molecular Biology, Cambridge CB2 0QH, UK *Correspondence: kroeper@mrc-lmb.cam.ac.uk

More information

The Role of GRASP65 in Golgi Cisternal Stacking and Cell Cycle Progression

The Role of GRASP65 in Golgi Cisternal Stacking and Cell Cycle Progression Traffic 2010; 11: 827 842 2010 John Wiley & Sons A/S doi:10.1111/j.1600-0854.2010.01055.x The Role of GRASP65 in Golgi Cisternal Stacking and Cell Cycle Progression Danming Tang, Hebao Yuan and Yanzhuang

More information

CILIA are multifunctional organelles that form on the. Unexpected Roles for Ciliary Kinesins and Intraflagellar Transport Proteins

CILIA are multifunctional organelles that form on the. Unexpected Roles for Ciliary Kinesins and Intraflagellar Transport Proteins HIGHLIGHTED ARTICLE INVESTIGATION Unexpected Roles for Ciliary Kinesins and Intraflagellar Transport Proteins Niedharsan Pooranachandran and Jarema J. Malicki 1 Bateson Centre and the Department of Biomedical

More information

NOVA regulates Dcc alternative splicing during neuronal migration and axon guidance in the spinal cord.

NOVA regulates Dcc alternative splicing during neuronal migration and axon guidance in the spinal cord. University of Colorado, Boulder CU Scholar Molecular, Cellular, and Developmental Biology Faculty Contributions Molecular, Cellular, and Developmental Biology 5-25-2016 NOVA regulates Dcc alternative splicing

More information

Developmental Biology

Developmental Biology Developmental Biology 334 (2009) 161 173 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/developmentalbiology Wingless signaling and the control of cell

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Kasprowicz et al., http://www.jcb.org/cgi/content/full/jcb.201310090/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. NMJ morphology of shi 12-12B ; shi-4c not treated

More information

Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.

Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background. Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on

More information

Ordered patterns of cell shape and orientational correlation during spontaneous cell migration. Supplementary information

Ordered patterns of cell shape and orientational correlation during spontaneous cell migration. Supplementary information Ordered patterns of cell shape and orientational correlation during spontaneous cell migration Supplementary information Yusuke T. Maeda*, Junya Inose, Miki Y. Matsuo, Suguru Iwaya and Masaki Sano Department

More information

Supplementary information

Supplementary information Supplementary information Statistical organelle dissection of Arabidopsis guard cells using image database LIPS Takumi Higaki *, Natsumaro Kutsuna, Yoichiroh Hosokawa, Kae Akita, Kazuo Ebine, Takashi Ueda,

More information

Supplementary Figure 1. Biochemical and sequence alignment analyses the

Supplementary Figure 1. Biochemical and sequence alignment analyses the Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).

More information

4) Please cite Dagda et al J Biol Chem 284: , for any publications or presentations resulting from use or modification of the macro.

4) Please cite Dagda et al J Biol Chem 284: , for any publications or presentations resulting from use or modification of the macro. Supplement Figure S1. Algorithmic quantification of mitochondrial morphology in SH- SY5Y cells treated with known fission/fusion mediators. Parental SH-SY5Y cells were transiently transfected with an empty

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/3/11/eaao4709/dc1 Supplementary Materials for Pushing the limits of photoreception in twilight conditions: The rod-like cone retina of the deep-sea pearlsides Fanny

More information

Gipc1 has a dual role in Vangl2 trafficking and hair bundle integrity in the inner ear

Gipc1 has a dual role in Vangl2 trafficking and hair bundle integrity in the inner ear RESEARCH ARTICLE 3775 Development 139, 3775-3785 (2012) doi:10.1242/dev.074229 2012. Published by The Company of Biologists Ltd Gipc1 has a dual role in Vangl2 trafficking and hair bundle integrity in

More information

23-. Shoot and root development depend on ratio of IAA/CK

23-. Shoot and root development depend on ratio of IAA/CK Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal

More information

Supplementary Information

Supplementary Information Supplementary Information MAP2/Hoechst Hyp.-AP ph 6.5 Hyp.-SD ph 7.2 Norm.-SD ph 7.2 Supplementary Figure 1. Mitochondrial elongation in cortical neurons by acidosis. Representative images of neuronal

More information

The Role of Inorganic Carbon Transport and Accumulation in the CO 2 -Concentrating Mechanism and CO 2 Assimilation in Chlamydomonas

The Role of Inorganic Carbon Transport and Accumulation in the CO 2 -Concentrating Mechanism and CO 2 Assimilation in Chlamydomonas The Role of Inorganic Carbon Transport and Accumulation in the CO 2 -Concentrating Mechanism and CO 2 Assimilation in Chlamydomonas Is there a Role for the CCM in Increasing Biological CO 2 Capture? Generalized

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/1/9/e1500511/dc1 Supplementary Materials for Contractility parameters of human -cardiac myosin with the hypertrophic cardiomyopathy mutation R403Q show loss of

More information

Supporting Information

Supporting Information Supporting Information Fleissner et al. 10.1073/pnas.0907039106 Fig. S1. (A) MAK-2-GFP localized to CATs tips is not bound by membrane. his-3::pccg1 mak-2-gfp; mak-2 strain labeled with membrane dye FM4

More information

Micro-Flow in a bundle of micro-pillars. A. Keißner, Ch. Brücker

Micro-Flow in a bundle of micro-pillars. A. Keißner, Ch. Brücker Micro-Flow in a bundle of micro-pillars A. Keißner, Ch. Brücker Institute of Mechanics and Fluid Dynamics, University of Freiberg, TU Freiberg, Germany, Email: armin.keissner@imfd.tu-freiberg.de Abstract

More information

Chapter 4 Evaluating a potential interaction between deltex and git in Drosophila: genetic interaction, gene overexpression and cell biology assays.

Chapter 4 Evaluating a potential interaction between deltex and git in Drosophila: genetic interaction, gene overexpression and cell biology assays. Evaluating a potential interaction between deltex and git in Drosophila: genetic interaction, gene overexpression and cell biology assays. The data described in chapter 3 presented evidence that endogenous

More information

Genetically Modified Human Renal Proximal Tubule Epithelial Cells (RPTEC/TERT1) A New Model for Drug Toxicity Studies

Genetically Modified Human Renal Proximal Tubule Epithelial Cells (RPTEC/TERT1) A New Model for Drug Toxicity Studies Genetically Modified Human Renal Proximal Tubule Epithelial Cells (RPTEC/TERT1) A New Model for Drug Toxicity Studies Chaozhong Zou, Ph.D. Senior Scientist, ATCC About ATCC Founded in 1925, ATCC is a non-profit

More information

Supplementary Figure 1-10 with Figure legends

Supplementary Figure 1-10 with Figure legends 332 coordinates mechanotransduction and growth cone bifurcation in sensory neurons Li Yang Chiang 1, Kate Poole, Beatriz E. Oliveira, Neuza Duarte,Yinth Andrea Bernal Sierra, Leena Bruckner Tuderman, Manuel

More information

Supplementary Information. In colloidal drop drying processes, multi-ring depositions are formed due to the stick-slip

Supplementary Information. In colloidal drop drying processes, multi-ring depositions are formed due to the stick-slip Electronic Supplementary Material (ESI for Soft Matter. This journal is The Royal Society of Chemistry 14 Supplementary Information A1. Contact line receding velocity of an evaporating drop In colloidal

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Different crystal forms obtained for Sky

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Different crystal forms obtained for Sky Supplementary Figure 1 Different crystal forms obtained for Sky 1 353. (a) Crystal form 1 obtained in the presence of 20% PEG 3350 and 0.2 M ammonium citrate tribasic ph 7.0. (b) Crystal form 1 of the

More information