Supplemental Data. Perrella et al. (2013). Plant Cell /tpc
|
|
- Bruce Campbell
- 5 years ago
- Views:
Transcription
1 Intensity Intensity Intensity Intensity Intensity Intensity C D Distance (μm) E 50 F Distance (μm) Supplemental Figure 1: Co-localization of HDC1 with HD6 and HD19 within nuclei of transiently expressing tobacco epidermis cells. High-magnification images of nuclei in tobacco (N. benthamiana) epidermal leaf cells after transient expression of GFP-HDC1 and RFP-HD6 or RFP-HD19. Each row contains the following images from left to right: bright field, GFP fluorescence, RFP fluorescence, GFP/RFP overlay, quantitative comparison GFP and RFP signals along line scan (arrows in overlay images). HDC1 co-localizes with HD6 (-C) and HD19 (D-F) in the entire nucleus (, D), in distinct speckles (-E) or in the nucleolus (C, F). Scale bar is 10 µm. 1
2 HDC1 mrn /Tub C WT hdc1-1 Pair 1 Pair 2 Pair 3 Pair 4 Tub 9 HDC1-GFP HDC1 Rubisco D hdc1-1 WT GFP-HDC1. thaliana N. tabacum WT 35S Ubi10 HDC1 HDC1 Supplemental Fig. S2 Supplemental Figure 2: Confirmation of hdc1-1 knockout and HDC1 over-expressing lines : Position of T-DN and primer pairs in the genomic DN of hdc1-1 knockout line (GI-Kat 054G03). Numbers indicate position of primer pairs used for genotyping. : HDC1 mrn in wildtype and hdc1-1 as determined by RT-PCR using the primer pairs indicated in. Tubulin 9 (Tub 9) was used as a loading control. C: Western blot with anti-hdc1 detects HDC1 in. thaliana wildtype but not in hdc1-1. Detection of the larger HDC1-GFP fusion protein transiently expressed in tobacco is shown for comparison. Rubisco (loading control) was detected by Ponceau staining. D: HDC1 mrn levels (relative to Tub 9) in two lines overexpressing HDC1 under control of 35-S or Ubiquitin-10 promoters. sterisks indicate significant differences (p < 0.001) to wild type (WT). 2
3 HDC1 mrn /RPII Germination (%) Salk_ Sail_1263_E05 C WT Salk_ Sail_1263_E Primer pair Primer pair WT Salk Sail WT Salk Sail 1263 [] /mm Supplemental Fig. S3 Supplemental Figure 3: Salk and Sail1263E05 are not hdc1 knockouts : Position of T-DN and primer pairs in the genomic DN for Salk_ and Sail_1263_E05 lines. : HDC1 mrn levels in wildtype, Salk_ and Sail_1263_E05 using the primer pairs indicated in. RpII is RN polymeraseii (loading control). sterisks indicate significant differences to the wild type (p<0.05). C: Germination rates of. thaliana wildtype (black), Salk_ (grey stripes) and Sail_1263_E05 (light grey stripes) on agar containing different concentrations of. ars are means +/- SE of at least 3 plates containing at least 50 seeds each. Note that neither of the lines shows hypersensitivity. 3
4 mrn /TU9 Control mm WT KO OX 2 DG 6 DG Supplemental Fig. S4 Supplemental Figure 4: Without HDC1 does not alter germination or progression of seedlings to vegetative stage : ppearance of young seedlings on day 6 after sowing. Wildtype (upper third of plate), hdc1-1 (centre) and OX (lower) seeds were imbibed and allowed to germinate on half strength Murashige Skoog medium without (control) or with 0.3 µm added. Pictures were taken on the same day as germination rate was scored. Note that without, number and size of seedlings is similar for all lines. : Transcript levels for embryogenesis related genes I3, FUS3 and LEC1 in wildtype (WT, black), hdc1-1 knockout (KO, white) and HDC1 over-expressing (OX, grey) seedlings 2-6 days after germination (DG). ars represent means of 4 technical qpcr replicates with mrn pooled from 50 seedlings. sterisk indicates significant difference to wildtype (p < 0.05). 4
5 Plant weight /g [] /mm C FW DW FW DW Supplemental Fig. S5 Supplemental Figure 5: HD6 over-expression does not affect germination or growth. : Germination rates of imbibed wildtype (black), 35S:HDC1 (light grey) and 35S:HD6 (dark grey) seeds. Germination rates in % reflect the number of seedlings that had developed cotyledons on day 6, normalized to the total number of seeds plated out. ars are means ± SE of 3 plates containing 50 seeds each. sterisks indicate significant differences (p < 0.05) to wildtype. : Transcript levels of HD6 in wildtype and 35S::HD6 lines. C: Shoot weights (FW: fresh weight, DW: dry weight of 5-weeks old plants). ars are means of 8 plants. 5
6 HDC1-OX1 HDC1-OX2 Wildtype hdc1-1 Supplemental fig. S6 Supplemental Figure 6: Root and leaf growth phenotypes in young plants. Leaf surface areas and main root length of 2-weeks old wildtype (black), hdc1-1 (white) and HDC1-OX (grey). For leaf surface measurements plants were grown on soil. fter 2 weeks, leaves were removed in order of appearance and analyzed with Image J. For root measurements plants were germinated and grown on vertical agar plates containing half-strength MS medium. ars are means ± SE of 3 plants for leaf surface data and of at least 8 plants for root data. sterisks indicate significant differences (p < 0.05) to wildtype. 6
7 Plant weight /g FW DW FW DW Supplemental Fig. 7 Supplemental Figure 7: HD6 knockdown affects plant growth without delaying leaf development : Fresh and dry weights of 4-weeks old wildtype (Col-DR5, black) and hda6-knockdown (axe1-5, white dotted) plants. : Leaf numbers in wildtype and axe1-5 mutants. ars are means ± SE of 5 plants. sterisk indicates significant difference (p < 0.05) to wildtype. 7
8 [] /%WT+ [] ng/mg DW Control mm NaCl for 24 h Supplemental Figure 8: HDC1 has a small effect on content after salt treatment. : Shoot content of wildtype (WT, black), hdc1-1 knockout (KO, white) and HDC1 over-expressing (OX, grey). Plants were grown for 4 weeks in short day conditions and subjected (+) or not (-) to 150 mm NaCl for 24 h in hydroponics. bsolute results from three independently treated plant batches (5 plants each) are shown. : Relative change of content in hdc1-1 and HDC1-overexpressing plants compared to wildtype. content was normalized to the content of salt-treated wildtype plants in the same batch. ars are means ± SE of 3 independently treated plant batches (same as in ). Differences were significant with P-values of p = 0.3 (OX/WT, ) or p = 0.14 (KO/ WT). 8
9 ChIP DN /CT2 /Input 1 3 OX WT KO OX WT KO Supplemental Figure 9: HDC1 alters H3K9K14 acetylation levels in 1 but not 3 Relative amounts of DN associated with acetylated H3K9/K14 for 1 and 3 determined by ChIPqPCR in wildtype (WT, black), hdc1-1 knockout (KO, white) and HDC1 over-expressing (OX, grey) plants. Leaf tissue was pooled from 4-weeks old plants grown in 3 independent batches 12 plants each. Chromatin extracted and immunoprecipitated with anti-h3k9k14c. qpcr-amplified ChIP-DN was normalized to actin 2 and to input DN (chromatin before immunoprecipitation). ars are means of 4 technical qpcr-replicates ± SE. sterisks indicate significant differences to the wild type (p < 0.05). 9
10 HDC1 Control Gene X No expression Stress induced Low sensitivity hdc1 No expression induced High sensitivity HDC1 Gene Y Low expression repressed High sensitivity hdc1 High expression repressed High sensitivity Supplemental Figure 10: Scenarios for the effects of HDC1 on -dependent gene expression : In the case of -inducible gene X, HDC1 decreases sensitivity without altering transcription in control conditions. No transcription factors are present in control conditions and hence the gene remains inactive independent of its de-acetylation state. Under stress the gene is transcribed through the action of an -induced activator (e.g. transcription factor). How much of the activator is required for gene activity depends on the histone acetylation status of the gene. Thus, to obtain the same effect, more stimulus () is required when HDC1 is overexpressed (hypo-sensitivity) and less stimulus is required when HDC1 is knocked out (hyper-sensitivity). : In the case of -repressed gene Y, HDC1 decreases constitutive transcript levels with or without altering -sensitivity. In this case transcription factors are present in control conditions and have to overcome the repressive effect of deacetylation. HDC1 therefore directly determines constitutive expression levels. Stress induces a repressor that effectively blocks transcription. Whether knockout/overexpression of HDC1 alters stress-sensitivity will depend on the level at which the repressor operates. In the scenario shown here the -induced repressor acts downstream of transcription factor activity and is therefore independent of HDC1 levels. 10
11 % Control % Control Water-limited Shoot Rosette FW DW Salt-stressed Root Shoot HDC1-OX1 HDC1-OX2 Wildtype hdc1-1 FW DW FW DW Supplemental Figure 11: Effects of HDC1 expression on stress-sensitivity during vegetative growth. : Rosette diameter, fresh weight (FW) and dry weight (DW) at the end of the water-limiting experiment (day 40) relative to control (well-watered). For labelling of lines see legend box in figure. : Root and shoot fresh weight (FW) and dry weight (DW) of plants at the end of the salt stress experiment (day 6) relative to control. Due to low root DW, plants had to be pooled for determination of DW. 11
12 Supplemental Table 1: Primers for genotyping gdn
13 Supplemental Table 1 cont.
** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.
Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *
More informationFigure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin
More informationSupplemental Data. Chen and Thelen (2010). Plant Cell /tpc
Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector
More informationEthylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis
Ethylene is critical to the maintenance of primary root growth and Fe homeostasis under Fe stress in Arabidopsis Guangjie Li, Weifeng Xu, Herbert J. Kronzucker, Weiming Shi * Supplementary Data Supplementary
More informationGFP GAL bp 3964 bp
Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive
More informationSupplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed
Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
More informationNature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
More informationSupplementary Figure 1. Phenotype of the HI strain.
Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants
More informationSupplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2
Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2 IRT1, FRO2 and FIT expression levels in roots of the wild-type, nas4x- 1 and nas4x-2, showing that in both nas mutants
More informationSupplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation
More informationGENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL
GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,
More informationTable S1 List of primers used for genotyping and qrt-pcr.
Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!
More informationHeterosis and inbreeding depression of epigenetic Arabidopsis hybrids
Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined
More informationPhotoreceptor Regulation of Constans Protein in Photoperiodic Flowering
Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering by Valverde et. Al Published in Science 2004 Presented by Boyana Grigorova CBMG 688R Feb. 12, 2007 Circadian Rhythms: The Clock Within
More informationSupplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and
More informationArabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development
Arabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development Danhua Jiang 1,2, Nicholas C. Kong 1,2, Xiaofeng Gu 2, Zicong Li 1, Yuehui
More information23-. Shoot and root development depend on ratio of IAA/CK
Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY
More informationGrowth and development of Arabidopsis thaliana under single-wavelength red
1 Supplementary Information 2 3 4 Growth and development of Arabidopsis thaliana under single-wavelength red and blue laser light 5 6 7 8 Authors Amanda Ooi 1 *, Aloysius Wong 1 *, Tien Khee Ng 2, Claudius
More informationSupplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and
More informationEXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA
EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital
More informationThe sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively as positive regulators of salt stress tolerance in rice
Lou et al. BMC Plant Biology (2018) 18:203 https://doi.org/10.1186/s12870-018-1408-0 RESEARCH ARTICLE Open Access The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively
More informationSupplemental material
Supplemental material Table 1- Segregation analysis of sgt1a sgt1b double mutant plants Parental genotype No. of lines Normal seeds Phenotype Abnormal seeds Ratio of abnormal seeds (%) WT 3 171 2 1.16
More informationDevelopment 143: doi: /dev : Supplementary information
Supplementary Materials and Methods Plant materials The mutants and transgenic plants used in the present study were as follows: E361 (from Alex Webb s laboratory); tmm-1, ptmm::tmm-gfp and flp-1 (from
More informationSupplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.
Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny
More informationSupporting Information
Supporting Information Cao et al. 10.1073/pnas.1306220110 Gram - bacteria Hemolymph Cytoplasm PGRP-LC TAK1 signalosome Imd dfadd Dredd Dnr1 Ikk signalosome P Relish Nucleus AMP and effector genes Fig.
More informationPenghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao
New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang
More informationSupp- Figure 2 Confocal micrograph of N. benthamiana tissues transiently expressing 35S:YFP-PDCB1. PDCB1 was targeted to plasmodesmata (twin punctate
Supplemental Data. Simpson et al. (009). n rabidopsis GPI-anchor plasmodesmal neck protein with callosebinding activity and potential to regulate cell-to-cell trafficking. 5 0 stack Supp- Figure Confocal
More informationSupplemental Figures. Supplemental Data. Sugliani et al. Plant Cell (2016) /tpc Clades RSH1. Rsh1[HS] RSH2 RSH3. Rsh4[HS] HYD TGS ACT
Supplemental Figures Clades RSH1 TP - HYD TGS ACT Rsh1[HS] RSH2 TP HYD SYN TGS Rsh2[HS] RSH3 TP HYD SYN TGS CRSH TP - SYN EFh Rsh4[HS] Supplemental Figure 1. Arabidopsis RSH domain structure. Schematic
More informationSUPPLEMENTARY INFORMATION
PRC2 represses dedifferentiation of mature somatic cells in Arabidopsis Momoko Ikeuchi 1 *, Akira Iwase 1 *, Bart Rymen 1, Hirofumi Harashima 1, Michitaro Shibata 1, Mariko Ohnuma 1, Christian Breuer 1,
More informationSupplementary Table 1. Primers used in this study.
Supplementary Tale 1. Primers used in this study. Name Primer sequence (5'-3') Primers of PCR-ased molecular markers developed in this study M1 F M1 R M2 F M2 R M3 F M3 R M4 F M4 R M5 F M5 R M6 F M6 R
More informationSupplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Mourier et al., http://www.jcb.org/cgi/content/full/jcb.201411100/dc1 Figure S1. Size and mitochondrial content in Mfn1 and Mfn2 knockout hearts. (A) Body
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1121356/dc1 Supporting Online Material for Polar PIN Localization Directs Auxin Flow in Plants Justyna Wiśniewska, Jian Xu, Daniela Seifertová, Philip B. Brewer, Kamil
More informationEpigenetics and Flowering Any potentially stable and heritable change in gene expression that occurs without a change in DNA sequence
Epigenetics and Flowering Any potentially stable and heritable change in gene expression that occurs without a change in DNA sequence www.plantcell.org/cgi/doi/10.1105/tpc.110.tt0110 Epigenetics Usually
More informationGenetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity
Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity Shih-Heng Su, Maria Cristina Suarez-Rodriguez, Patrick Krysan
More informationRegulation of Phosphate Homeostasis by microrna in Plants
Regulation of Phosphate Homeostasis by microrna in Plants Tzyy-Jen Chiou 1 *, Kyaw Aung 1,2, Shu-I Lin 1,3, Chia-Chune Wu 1, Su-Fen Chiang 1, and Chun-Lin Su 1 Abstract Upon phosphate (Pi) starvation,
More informationSupplemental Table 1. Primers used for cloning and PCR amplification in this study
Supplemental Table 1. Primers used for cloning and PCR amplification in this study Target Gene Primer sequence NATA1 (At2g393) forward GGG GAC AAG TTT GTA CAA AAA AGC AGG CTT CAT GGC GCC TCC AAC CGC AGC
More informationSUPPLEMENTARY INFORMATION
Supplemental Methods Isolation and mapping of SPCH An EMS-mutagenized population of tmm-1 (Col);E1728 (an enhancer trap GFP marking guard cells) was created. M2 seeds were collected from M1 s planted in
More informationSUPPLEMENTARY INFORMATION
Figure S1. Haploid plant produced by centromere-mediated genome elimination Chromosomes containing altered CENH3 in their centromeres (green dots) are eliminated after fertilization in a cross to wild
More informationDOI: 10.1038/ncb2819 Gαi3 / Actin / Acetylated Tubulin Gαi3 / Actin / Acetylated Tubulin a a Gαi3 a Actin Gαi3 WT Gαi3 WT Gαi3 WT b b Gαi3 b Actin Gαi3 KO Gαi3 KO Gαi3 KO # # Figure S1 Loss of protein
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/452/ra106/dc1 Supplementary Materials for Stem-piped light activates phytochrome B to trigger light responses in Arabidopsis thaliana roots Hyo-Jun Lee, Jun-Ho
More informationTable S1. Sequence of primers used in RT-qPCR
Table S1. Sequence of primers used in RT-qPCR Primer Name P16Ink4a-F P16Ink4a-R P15Ink4b-F P15Ink4b-R P19Arf-F P19Arf-R P53-F P53-R P21cip1-F P21cip1-R P27kip1-F P27kip1-R P18Ink4c-F P18Ink4c-R P19Ink4d-F
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Figure S1. Mitochondrial morphology in Fis1-null, Mff-null and Fis1/Mff-null MEF cells. (A) Western blotting of lysates from Fis1-null, Mff-null and Fis1/Mff-null cells. Lysates were
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Overexpression of YFP::GPR-1 in the germline.
Supplementary Figure 1 Overexpression of YFP::GPR-1 in the germline. The pie-1 promoter and 3 utr were used to express yfp::gpr-1 in the germline. Expression levels from the yfp::gpr-1(cai 1.0)-expressing
More informationLast time: Obtaining information from a cloned gene
Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?
More information4) Please cite Dagda et al J Biol Chem 284: , for any publications or presentations resulting from use or modification of the macro.
Supplement Figure S1. Algorithmic quantification of mitochondrial morphology in SH- SY5Y cells treated with known fission/fusion mediators. Parental SH-SY5Y cells were transiently transfected with an empty
More informationSOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent Seed Germination Downstream of PIL5 W
The Plant Cell, Vol. 20: 1260 1277, May 2008, www.plantcell.org ª 2008 American Society of Plant Biologists SOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent
More informationBiological Roles of Cytokinins
Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators
More informationdownstream (0.8 kb) homologous sequences to the genomic locus of DIC. A DIC mutant strain (ro- 6
A B C D ts Figure S1 Generation of DIC- mcherry expressing N.crassa strain. A. N. crassa colony morphology. When a cot1 (top, left panel) strain is grown at permissive temperature (25 C), it exhibits straight
More informationLipid transfer proteins confer resistance to trichothecenes
Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance
More informationUNIVERSITY OF AGRICULTURAL SCIENCES AND VETERINARY MEDICINE
UNIVERSITY OF AGRICULTURAL SCIENCES AND VETERINARY MEDICINE FACULTY OF HORTICULTURE OANA CIUZAN ROLE OF THE GLYCINE-RICH RNA-BINDING PROTEINS IN PLANT EARLY DEVELOPMENT AND ABIOTIC STRESS RESPONSE ABSTRACT
More informationNature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.
Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary
More informationMitochondrial Dynamics Is a Distinguishing Feature of Skeletal Muscle Fiber Types and Regulates Organellar Compartmentalization
Cell Metabolism Supplemental Information Mitochondrial Dynamics Is a Distinguishing Feature of Skeletal Muscle Fiber Types and Regulates Organellar Compartmentalization Prashant Mishra, Grigor Varuzhanyan,
More informationHRS1 Acts as a Negative Regulator of Abscisic Acid Signaling to Promote Timely Germination of Arabidopsis Seeds
HRS1 Acts as a Negative Regulator of Abscisic Acid Signaling to Promote Timely Germination of Arabidopsis Seeds Chongming Wu 1,2., Juanjuan Feng 1,2., Ran Wang 1,2, Hong Liu 1,2, Huixia Yang 1,2, Pedro
More informationAuxin and Light Control of Adventitious Rooting in Arabidopsis Require ARGONAUTE1 W
The Plant Cell, Vol. 17, 1343 1359, May 2005, www.plantcell.org ª 2005 American Society of Plant Biologists RESEARCH ARTICLES Auxin and Light Control of Adventitious Rooting in Arabidopsis Require ARGONAUTE1
More informationSUPPLEMENTARY INFORMATION
reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative
More informationPYR1 PYL1 PYL2 PYL3 PYL4 PYL5 PYL6 PYL7 PYL8 PYL9 PYL10 PYL11/12
Supplemental Data. Gonzalez-Guzman et al. Plant Cell. (212). 1.115/tpc.112.98574 Supplemental Figure 1. Gene expression levels of the PYR/PYL/RCAR ABA receptors in the Arabidopsis transcriptome genomic
More informationSupplemental Data. Yang et al. (2012). Plant Cell /tpc
Supplemental Figure 1. Mature flowers of P. heterotricha. (A) An inflorescence of P. heterotricha showing the front view of a zygomorphic flower characterized by two small dorsal petals and only two fertile
More informationFlowering Time Control in Plants -How plants know the time to flower?
Advanced Molecular and Cell Biology II, 2015/12/04 Flowering Time Control in Plants -How plants know the time to flower? Masaki NIWA Grad. Sch. Biostudies, Kyoto Univ. Why can plants bloom every year in
More informationSlide 1 / 7. Free Response
Slide 1 / 7 Free Response Slide 2 / 7 Slide 3 / 7 1 The above diagrams illustrate the experiments carried out by Griffith and Hershey and Chaserespectively. Describe the hypothesis or conclusion that each
More information7.06 Problem Set #4, Spring 2005
7.06 Problem Set #4, Spring 2005 1. You re doing a mutant hunt in S. cerevisiae (budding yeast), looking for temperaturesensitive mutants that are defective in the cell cycle. You discover a mutant strain
More informationLooking for LOV: Location of LOV1 function in Nicotiana benthamiana cells
Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells By: Patrick Rutledge 1 Dr. Jennifer Lorang 2,3, Dr. Marc Curtis 2,3, Dr. Thomas Wolpert 2,3 BioResource Research 1, Botany and
More informationArabidopsis homologs of components of the SWR1 complex regulate flowering and plant development
RESEARCH ARTICLE 1931 Development 134, 1931-1941 (2007) doi:10.1242/dev.001891 Arabidopsis homologs of components of the SWR1 complex regulate flowering and plant development Kyuha Choi 1, Chulmin Park
More informationTrithorax-group proteins ARABIDOPSIS TRITHORAX4 (ATX4) and ATX5 function in abscisic acid and dehydration stress responses
Research Trithorax-group proteins ARABIDOPSIS TRITHORAX4 (ATX4) and ATX5 function in abscisic acid and dehydration stress responses Yutong Liu, Ai Zhang, Hao Yin, Qingxiang Meng, Xiaoming Yu, Shuangzhan
More informationIllegitimate translation causes unexpected gene expression from on-target out-of-frame alleles
Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN
More informationSupplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2.
Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice. Percentage of marginal zone B cells in the spleen of wild-type mice (+/+), mice homozygous for cpm or pri
More informationSupplementary Figure 1. Nature Genetics: doi: /ng.3848
Supplementary Figure 1 Phenotypes and epigenetic properties of Fab2L flies. A- Phenotypic classification based on eye pigment levels in Fab2L male (orange bars) and female (yellow bars) flies (n>150).
More informationFrom network to phenotype: the dynamic wiring of an Arabidopsis transcriptional network induced by osmotic stress
Article From network to phenotype: the dynamic wiring of an Arabidopsis transcriptional network induced by osmotic stress Lisa Van den Broeck 1,,, Marieke Dubois 1,,,, Mattias Vermeersch 1,, Veronique
More informationPOTASSIUM IN PLANT GROWTH AND YIELD. by Ismail Cakmak Sabanci University Istanbul, Turkey
POTASSIUM IN PLANT GROWTH AND YIELD by Ismail Cakmak Sabanci University Istanbul, Turkey Low K High K High K Low K Low K High K Low K High K Control K Deficiency Cakmak et al., 1994, J. Experimental Bot.
More informationBIS &003 Answers to Assigned Problems May 23, Week /18.6 How would you distinguish between an enhancer and a promoter?
Week 9 Study Questions from the textbook: 6 th Edition: Chapter 19-19.6, 19.7, 19.15, 19.17 OR 7 th Edition: Chapter 18-18.6 18.7, 18.15, 18.17 19.6/18.6 How would you distinguish between an enhancer and
More informationIn order to confirm the contribution of diffusion to the FRAP recovery curves of
Fonseca et al., Supplementary Information FRAP data analysis ) Contribution of Diffusion to the recovery curves In order to confirm the contribution of diffusion to the FRAP recovery curves of PH::GFP
More informationRepression of flowering under a noninductive photoperiod by the HDA9-AGL19-FT module in Arabidopsis
Research Repression of flowering under a noninductive photoperiod by the HDA9-AGL19-FT module in Arabidopsis Min-Jeong Kang 1, Hong-Shi Jin 1, Yoo-Sun Noh 1,2 and Bosl Noh 3 1 School of Biological Sciences,
More informationSupplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day
Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day conditions. Photo was taken when the wild type plant started to bolt. Scale bar represents 1 cm. Supplemental Figure 2. Flowering
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1 Sns and Duf co-localise in embryonic nephrocytes a-c, Wild-type stage 11 (a),14 (b) and 16 (c) embryos stained with anti-duf (green) and anti-sns (red). Higher magnification images
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3267 Supplementary Figure 1 A group of genes required for formation or orientation of annular F-actin bundles and aecm ridges: RNAi phenotypes and their validation by standard mutations.
More informationFrom basic research to crop improvement. Dirk Inze VIB-UGent Center for Plant Systems Biology
From basic research to crop improvement Dirk Inze VIB-UGent Center for Plant Systems Biology Oct 2017 The Great Challenge By 2050 70% more food on the same land area Growing world population Climate change
More informationOther funding Sources Agency Name: MSU Agricultural Experiment Station /Project GREEEN Amount requested or awarded: 30,000
FINAL PROJECT REPORT Project Title: Functional genomics of flowering in apple PI: Herb Aldwinckle Co-PI(2): Steve VanNocker Organization: Cornell University Organization: Michigan State University Telephone/email:
More informationSupporting Online Material
1 Stomatal Patterning and Differentiation by Synergistic Interactions of Receptor Kinases Elena D. Shpak, Jessica Messmer McAbee, Lynn Jo Pillitteri, and Keiko U. Torii Supporting Online Material Material
More informationStress Effects on Myosin Mutant Root Length in Arabidopsis thaliana
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange University of Tennessee Honors Thesis Projects University of Tennessee Honors Program 5-2011 Stress Effects on Myosin
More informationCharacterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach
Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach ABSTRACT SUBMITTED TO JAMIA MILLIA ISLAMIA NEW DELHI IN PARTIAL FULFILMENT OF
More informationTransitivity-dependent and transitivity-independent cell-to-cell movement of RNA
Himber et al. Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA silencing SUPPLEMENTAL MATERIAL Supplemental material 1. Short-range movement of GFP silencing affects a nearly
More information. Supplementary Information
. Supplementary Information Supplementary Figure S1. Mature embryo sac observations. Supplementary Figure S2. STT observations. Supplementary Figure S3. Comparison of the PTB1 cdna with that of the mutant.
More informationArabidopsis TERMINAL FLOWER1 Is Involved in the Regulation of Flowering Time and Inflorescence Development through Transcriptional Repression C W OA
The Plant Cell, Vol. 23: 3172 3184, September 2011, www.plantcell.org ã 2011 American Society of Plant Biologists. All rights reserved. Arabidopsis TERMINAL FLOWER1 Is Involved in the Regulation of Flowering
More informationLife Science Journal 2014;11(9) Cryptochrome 2 negatively regulates ABA-dependent seed germination in Arabidopsis
Cryptochrome 2 negatively regulates ABA-dependent seed germination in Arabidopsis Sung-Il Kim 1, Sang Ik Song 3, Hak Soo Seo 1, 2, 4 * 1 Department of Plant Science and Research Institute of Agriculture
More informationHormonal and other chemical effects on plant growth and functioning. Bill Davies Lancaster Environment Centre, UK
Hormonal and other chemical effects on plant growth and functioning Bill Davies Lancaster Environment Centre, UK Integrating the impacts of soil drought and atmospheric stress High radiant load Reduced
More informationFigure 18.1 Blue-light stimulated phototropism Blue light Inhibits seedling hypocotyl elongation
Blue Light and Photomorphogenesis Q: Figure 18.3 Blue light responses - phototropsim of growing Corn Coleoptile 1. How do we know plants respond to blue light? 2. What are the functions of multiple BL
More informationDEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA
DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA CHASE BALLARD LINDA EAN HECTOR LOPEZ DR. JOANNA WERNER-FRACZEK IN COLLABORATION WITH DR. PATRICIA SPRINGER S LAB AT UCR AND ROBERT KOBLE PURPOSE OF RESEARCH
More informationA small multigene hydroxyproline-ogalactosyltransferase. arabinogalactan-protein glycosylation, growth and development in Arabidopsis
Basu et al. BMC Plant Biology (215) 15:295 DOI 1.1186/s1287-15-67-7 RESEARCH ARTICLE Open Access A small multigene hydroxyproline-ogalactosyltransferase family functions in arabinogalactan-protein glycosylation,
More informationMaria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner
ABA represses the transcription of chloroplast genes Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner Supplementary data Supplementary tables Table
More informationElectromagenetic spectrum
Light Controls of Plant Development 1 Electromagenetic spectrum 2 Light It is vital for photosynthesis and is also necessary to direct plant growth and development. It acts as a signal to initiate and
More informationThe Arabidopsis Small G Protein ROP2 Is Activated by Light in Guard Cells and Inhibits Light-Induced Stomatal Opening W
The Plant Cell, Vol. 20: 75 87, January 2008, www.plantcell.org ª 2008 American Society of Plant Biologists The Arabidopsis Small G Protein ROP2 Is Activated by Light in Guard Cells and Inhibits Light-Induced
More informationSupplementary Figure 1.
Supplementary Figure 1. Characterisation of IHG-1 overexpressing and knockdown cell lines. (A) Total cellular RNA was prepared from HeLa cells stably overexpressing IHG-1 or mts-ihg-1. IHG-1 mrna was quantified
More informationEffect of Acetosyringone on Agrobacterium-mediated Transformation of Eustoma grandiflorum Leaf Disks
JARQ 51 (4), 351-355 (2017) https://www.jircas.go.jp Improvement in Agrobacterium-mediated Transformation of Eustoma grandiflorum by Acetosyringone Effect of Acetosyringone on Agrobacterium-mediated Transformation
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/301/ra98/dc1 Supplementary Materials for Regulation of Epithelial Morphogenesis by the G Protein Coupled Receptor Mist and Its Ligand Fog Alyssa J. Manning,
More informationTHE ROLE OF THE PHYTOCHROME B PHOTORECEPTOR IN THE REGULATION OF PHOTOPERIODIC FLOWERING. AnitaHajdu. Thesis of the Ph.D.
THE ROLE OF THE PHYTOCHROME B PHOTORECEPTOR IN THE REGULATION OF PHOTOPERIODIC FLOWERING AnitaHajdu Thesis of the Ph.D. dissertation Supervisor: Dr. LászlóKozma-Bognár - senior research associate Doctoral
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. NAD + -related genes expression in mouse tissues and in cells overexpressing NRK1. mrna (a) and protein (b) levels of NRK1, NRK2 and other enzymes involved
More informationSupplementary Figure 1: Mechanism of Lbx2 action on the Wnt/ -catenin signalling pathway. (a) The Wnt/ -catenin signalling pathway and its
Supplementary Figure 1: Mechanism of Lbx2 action on the Wnt/ -catenin signalling pathway. (a) The Wnt/ -catenin signalling pathway and its transcriptional activity in wild-type embryo. A gradient of canonical
More informationBrassinosteroids Stimulate Plant Tropisms through Modulation of Polar Auxin Transport in Brassica and Arabidopsis
The Plant Cell, Vol. 17, 2738 2753, October 2005, www.plantcell.org ª 2005 American Society of Plant Biologists Brassinosteroids Stimulate Plant Tropisms through Modulation of Polar Auxin Transport in
More information