: Q343 : A : (2005)
|
|
- Benjamin Parrish
- 5 years ago
- Views:
Transcription
1 2005, 28 (2) : Journal of N anjing A gricultural U niversity BM PR2IB 1, 2, 1, 2, 1, 2, 1 1, 33, (11, ; 21, ; 31, ) : BMPR2IB, PCR2RFLP 553, BMPR2IB, BMPR2IB ( ) 3 (BB B ), ( ) ( P < 0101) BB; BB B % 30% 19% ; ( ) + + : BB B , (BB B +, P < 0105; BB + +, P < 0101) ; BB B , + + (112) ( P < 0101), BB B +( ) kg ( ) kg, + + ( ( ) kg, P < 0105) ; + + ( P < 0105) ;, BMPR2IB, : ; ; BMPR2IB ; ; ; : Q343 : A : (2005) Polymorphism of BM PR2IB gene and its relationship to litter size and growth and development in Chinese M erino meat2prolificacy stra in GUAN Feng 1, L IU Shou2ren 2, CHENG Rui2he 1, DA I Rong 2, SH I Guo2qing 1, 2, A I Jun2tao 1 1, 33, YANG L i2guo ( 11Research Institute of Animal B reeding & Rep roduction, Nanjing Agricultural University, Nanjing , China; 21 Institute of Animal Husbandry and Veterinary Medicine, Xinjiang Academy of Agricultural Reclamation, Shihezi , China; 31College of Animal Science and Technology, Huazhong Agricultural University, W uhan , China) Abstract: DNA samp les were collected and amp lified for bone morphogenetic p rotein recep tor type IB gene (BMPR2IB) by PCR2 RFLP method from 553 sheep from 7 breeds or strains i1e. Hu, Suffolk, Dorset, Charolais, Romney H ills Chinese M erino and Chinese M erino meat2prolificacy strain. and development were analyzed. Relationship between the polymorphism of BMPR2IB gene and p rolificacy as well as growth The results showed that the genotype frequency of BM PR2IB gene was significantly different in these breeds or strains. In Chinese M erino meat2p rolificacy strain, the genotype frequencies of BB, B + and + + were 51%, 30% and 19%, respectively. Excep t for Hu sheep with only BB genotype, other breeds had only + + genotype. The analysis re2 sults of litter size, body weight and body size within Chinese Merino meat2prolificacy strain showed that the mean litter sizes at 1 st lambing of BB, B + and + + genotype populations were 210, 115 and 111, respectively, and there were significantly differences between group s (BB vs B +, P < 0105; BB vs + +, P < 0101). Sheep with genotype BB and B + had a greater total litter size than those with genotype + + ( P < 0101), the number were 218, 213 and 112 respectively. A t age of days, the body weights of lambs with genotype BB and B + were ( ) kg and ( ) kg, significantly greater than that of pep2 ulation with + + ( ) kg genotype ( P < 0105). The lambs with genotype BB and B + were significantly greater than : : ( (2002) ) : (1977 ),, E2mail: guanfengheyh@ yahoo1com1cn 3 Corresponding author: ( 1962 ),,,, E2mail: ylg@mail1hzau1edu1cn
2 76 28 those with genotype + + in chest girth and chest width, group s. but at age of days there was no significant difference between these two These findings indicated that the BMPR2IB gene was a major gene that regulates litter size and affects growth and develop2 ment during a certain period. Key words: sheep; Chinese M erino meat2prolificacy strain; BM PR2IB gene; litter size; body weight; body size,, 3, Booroola( FecB ) IB ( bone morphogenetic p rotein recep tor IB, BMPR2IB ) 746 A G, Booroola (Q249R), PCR2RFLP [ 1 3 ] FecB [ 4 7 ] ; FecB [ 8 10 ], BMPR2IB, 7, BMPR2IB, (117 ) (87 ) (101 ) ; (21 ) (56 ) (22 ) ; (53 ) (50 ) (46 ) DNA, 75% 5 g, 2 [ 11 ] BM PR2IB Davis [ 12 ] BMPR2IB, 3, (A va ) ( G GTCC) : : : 5 2CCAGAGGACAATAGCAAAGCAAA23 ; 5 2CAAGATGTTTTCATGCCTCATCAACAGGTC23 PCR : 94 5 m in; s, s, s, 30 ; 72 5 m in PCR 4 LA va ( ), 8%, [ 11 ] PBR322 /MSP DNA Marker ( ), 113 DNA PCR, 1 bp, BMPR2IB PCR 160 bp + 30 bp, BB ; 1 bp 160 bp + 30 bp B + ; 1 bp + + ( 1) 114 PCR 1 BM PR2IB PCR2RFL P F ig11 D etection of BM PR2IB gene by PCR2RFL P (2 4 ) ;,
3 2 : BMPR2IB 77 [ 13 ] ; SPSS 1110, x SD BM PR2IB BMPR2IB PCR2RFLP ( 1), BMPR2IB Booroola (A746G),, 3, 1 3, ( ), BB, + +( 1), 1 ( ) BM PR2IB Table 1 The frequency of BM PR2IB genotype in d ifferen t breeds or stra in s of sheep ( ) B reed or strain Animals Genotype frequency BB B Hu sheep Chinese Merino meat2prolificacy strain Suffolk Dorset Charolais Chinese Merino Romney H ills BM PR2IB 2, BB B , ( P < 0105) ;, BB + + ( P < 0101) ; B ( P > 0105) BB B , + + ( P < 0101) ; BB B +015, ( P > 0105) Genotype 2 Table 2 Com par ison of litter size am ong d ifferen t genotypes of sheep Number of animals Mean litter size at 1 st lambing Total mean litter size BB aa A B b A B B :, ( P < 0105) ( P < 0101) Note: Valules in same columns with small letters mean P < 0105, with cap ital letters mean P < The same as follows. 213 BM PR2IB 3,,, BB B + + +,, BB B ( P < 0105), 3 Table 3 Com par ison of body we ight am ong d ifferen t genotypes of sheep a t ages of and days Genotype Number of animals /kg B irth weight /kg d body weight /kg d body weight BB a B a b
4 BM PR2IB, BB B + + +, ( P < 0105), ( 4) 4 Table 4 Com par ison of body size in d ifferen t genotypes of sheep a t ages of and days /d Genotype Number of animals Age ( days) /cm Body length /cm Body height Heart girth Chest depth Chest width Cannon girth BB a a B a a b b ,,,,, [ 14, 15 ], 12 FecB [ 8 ],, [ 9, 10 ] 1981 ( A ),,,, [ 10, 16 ],,, BMPR2IB,,, FecB 1 [ 6 ] [ 17 ], 015, , BB B ; BB B ,, BMPR2IB BB,, BB /B + + +, [ 18 ] BB /B + + +,,,, BMPR2IB BB,,, BMPR2IB [ 14, 15 ],,,, : [ 1 ] Mulsant P, Lecerf F, Fabre S, et al. Mutation in bone morphogenetic p rotein recep tor2ib is associated with increased ovulation rate in Boo2 roola Merino ewes [ J ]. Proc Natl Acad Sci USA, 2001, 98 (9) : [ 2 ] Souza C J, MacDougal C, Campbell B K, et al. The Booroola ( FecB ) phenotype is associated with a mutation in the bone morphogenetic recep tor type 1B (BM PR 21B ) gene [ J ]. J Endocrinol, 2001, 169 (2) : R1 6. [ 3 ] W ilson T, W u X Y, Juengel J L, et al. H ighly p rolific Booroola sheep have a mutation in the intracellular kinase domain of bone morphoge2
5 2 : BMPR2IB 79 netic p rotein IB recep tor (ALK26) that is exp ressed in both oocytes and granulosa cells [ J ]. B iology of Rep roduction, 2001, 64: [ 4 ] Shimasaki S, Zachow R J, L i D, et al. A functional bone morphogenetic p rotein system in the ovary [ J ]. Proc Natl Acad Sci USA, 1999, 96: [ 5 ]. Booroola FecB [ J ]., 2001, 3 (2) : [ 6 ],. Booroola Merino FecB [ J ]., 1999, 35 (4) : [ 7 ] Piper L R, B indon B M, Davis G H. The single gene inheritance of the high litter size of the Booroola Merino [ J ]. Genetics of Rep roduc2 tion in Sheep, 1985, 38 (2) : [ 8 ],, Davis G H,. DNABooroola ( FecB ) [ J ]., 2003, 26 (1) : [ 9 ],,. BMPR2IB BMP15 [ J ]., 2003, 30 ( 8 ) : [ 10 ],,,. BMPR2IB[ J ]., 2003 (2) : [ 11 ] J, E F, T. [M ]. 2.,,. :, [ 12 ] Davis G H, Galloway SM, Ross L K, et al. DNA tests in p rolific sheep from eight countries p rovide new evidence on origin of the Booroola ( FecB ) mutation [ J ]. B iol of Rep rod, 2002, 66: [ 13 ]. [M ]. 2. :, [ 14 ],,,. [ J ]., 1998, 19 (3) : [ 15 ],,,. [ J ]., 2000 (4) : [ 16 ],,,. ( ) [ J ]., 1995, 27 (6) : [ 17 ] Davis G H. Fecunity genes in sheep [ J ]. Animal Rep rod Sci, 2004, 82: [ 18 ] Sm ith P, O W S, Hudson N L, et al. Effects of the Booroola gene ( FecB ) on body weight, ovarian development and hormone concentra2 tions during fetal life [ J ]. J Rep rod Fertil, 1993, 98 (1) : :
Immunogen icity of eleven geographical stra ins of E im eria m axim a
2005, 28 (4) : 104 108 Journal of N anjing A gricultural U niversity 1, 2, 13, 2, 2, 3 (1., 210095; 2., 225009; 3., 225003) :,, 100, 1 10 5 70 %, 1 10 4 97142 %,, 10 20109 % 82144 %, 3 75 %, 10 27143 %
More informationIntroduction to Quantitative Genetics. Introduction to Quantitative Genetics
Introduction to Quantitative Genetics Historical Background Quantitative genetics is the study of continuous or quantitative traits and their underlying mechanisms. The main principals of quantitative
More informationEffect of different foliar fertilizers on growth of Capsicum annuum L.
2009, 32 (2) : 76281 Journal of N anjing A gricultural U niversity http: / / nauxb1njau1edu1cn,,,. [ J ]., 2009, 32 (2) : 76281, 3,,, (, 210095) :,,,, 1210% 2416%, N P K,,,, C,,,, : ; ; ; : S64113; S143
More information32 20 N N, E E,
6 2 2 0 0 8 6 W ETLAND SC IENCE Vol. 6 No. 2 June, 2 0 0 8 1, 2, 2, 2, 3 (1., 100083; 2., 100101; 3., 100083) : ( ), 5 15, 15 ; ; ; Q 10 15 25 (4. 4 ), 1 2, 15 25 : ; ; ; ; : S153 : A : 1672-5948 (2008)
More informationMajor Genes, Polygenes, and
Major Genes, Polygenes, and QTLs Major genes --- genes that have a significant effect on the phenotype Polygenes --- a general term of the genes of small effect that influence a trait QTL, quantitative
More informationNO - : S511 : A : (2005) Compa rison of nitra te utiliza tion by four diffe rent rice (O ryza sa tiva L.
2005, 28 (1) : 52 56 Journal of N anjing A gricultural U niversity NO -,,,, 3 (, 210095) : 4 ( 63 6 917 57) (NRA) ( GSA), 1 mmol L - 1 NH + 4,, 1 mmol L - 1 NO - 3 28 d,,, 6, 57 ; NRA GSA, NRA 5817%, GSA
More informationJournal of Xiamen University (Natural Science)
47 2 2008 12 ( ) Journal of Xiamen University (Natural Science) Vol. 47 Sup. 2 Dec. 2008 hsp70 m RNA, 3 (, 361005) : (D rosophila m elanogaster) hsp70 DNA,, hsp70 mrna., hsp70 mrna., hsp70 mrna. hsp70
More information(2009) Journal of Rem ote Sensing (, 2006) 2. 1 (, 1999), : ( : 2007CB714402) ;
100724619 (2009) 0220183207 Journal of Rem ote Sensing 1, 2, 3, 3, 3, 1 1., 100101; 2., 100049; 3., 100080 :,,, 3, ( ),1%,, :,,, : TP79 : A 1 20,,,,;, (, 1999),,,,, (, 2006),,,,, 2 2. 1 : 2007209217; :
More information2. Der Dissertation zugrunde liegende Publikationen und Manuskripte. 2.1 Fine scale mapping in the sex locus region of the honey bee (Apis mellifera)
2. Der Dissertation zugrunde liegende Publikationen und Manuskripte 2.1 Fine scale mapping in the sex locus region of the honey bee (Apis mellifera) M. Hasselmann 1, M. K. Fondrk², R. E. Page Jr.² und
More informationLecture 3. Introduction on Quantitative Genetics: I. Fisher s Variance Decomposition
Lecture 3 Introduction on Quantitative Genetics: I Fisher s Variance Decomposition Bruce Walsh. Aug 004. Royal Veterinary and Agricultural University, Denmark Contribution of a Locus to the Phenotypic
More informationList the five conditions that can disturb genetic equilibrium in a population.(10)
List the five conditions that can disturb genetic equilibrium in a population.(10) The five conditions are non-random mating, small population size, immigration or emigration, mutations, and natural selection.
More informationPart 2- Biology Paper 2 Inheritance and Variation Knowledge Questions
Part 2- Biology Paper 2 Inheritance and Variation Knowledge Questions AQA TRILOGY Biology (8464) from 2016 Topic T4.6 Inheritance, variation and evolution Topic Student Checklist R A G Describe features
More informationCoding sequence array Office hours Wednesday 3-4pm 304A Stanley Hall
Coding sequence array Office hours Wednesday 3-4pm 304A Stanley Hall Review session 5pm Thursday, Dec. 11 GPB100 Fig. 1.13 RNA-seq Expression effects of cancer AAAAA AAAAA AAAAA Solexa sequencing counts
More informationgenome a specific characteristic that varies from one individual to another gene the passing of traits from one generation to the next
genetics the study of heredity heredity sequence of DNA that codes for a protein and thus determines a trait genome a specific characteristic that varies from one individual to another gene trait the passing
More informationBig Idea 3: Living systems store, retrieve, transmit, and respond to information essential to life processes.
Big Idea 3: Living systems store, retrieve, transmit, and respond to information essential to life processes. Enduring understanding 3.A: Heritable information provides for continuity of life. Essential
More informationKEY: Chapter 9 Genetics of Animal Breeding.
KEY: Chapter 9 Genetics of Animal Breeding. Answer each question using the reading assigned to you. You can access this information by clicking on the following URL: https://drive.google.com/a/meeker.k12.co.us/file/d/0b1yf08xgyhnad08xugxsnfvba28/edit?usp=sh
More informationGenome Analysis In Domestic Animals By H. Geldermann
Genome Analysis In Domestic Animals By H. Geldermann If you are searched for the ebook by H. Geldermann Genome Analysis in Domestic Animals in pdf form, then you've come to faithful website. We furnish
More informationOutline. P o purple % x white & white % x purple& F 1 all purple all purple. F purple, 224 white 781 purple, 263 white
Outline - segregation of alleles in single trait crosses - independent assortment of alleles - using probability to predict outcomes - statistical analysis of hypotheses - conditional probability in multi-generation
More informationQuantitative Genetics & Evolutionary Genetics
Quantitative Genetics & Evolutionary Genetics (CHAPTER 24 & 26- Brooker Text) May 14, 2007 BIO 184 Dr. Tom Peavy Quantitative genetics (the study of traits that can be described numerically) is important
More informationGenetic polymorphism analysis of t wo kinds of genetic markers in Hu sheep and Tong sheep
2003, 26 (4) : 64 68 Joural of N ajig A gricultural U iversity,,,, (, 225009) : 63 65 14 7, ( H) ( PIC) ( N e ) :, :, ; DNA ; : ; ; ; ; : S82612 : A : 1000 2030 ( 2003) 04 0064 05 Geetic polymorphism aalysis
More information, Waxy : A : (2003)
2003, 26 (3) : 1 6 Journal of Nanjing Agricultural University ( T1 ae stivum L1) Waxy 3, (, 210095) : SDS2PAGE 293 ( ) Waxy, Wx2A1 2 ; Wx2B1 15, 14 ; Wx2D1 2 ; Wx2A1 Wx2B1 2 ; 3 Waxy, Wx2A1 STS : ; Waxy
More informationChapter 7 The Genetic Model for Quantitative Traits
Chapter 7 The Genetic Model for Quantitative Traits I. The Basic Model II. Breeding Value III. Gene Combination Value IV. Producing Ability Chapter 7 The Genetic Model for Quantitative Traits Learning
More informationLECTURE # How does one test whether a population is in the HW equilibrium? (i) try the following example: Genotype Observed AA 50 Aa 0 aa 50
LECTURE #10 A. The Hardy-Weinberg Equilibrium 1. From the definitions of p and q, and of p 2, 2pq, and q 2, an equilibrium is indicated (p + q) 2 = p 2 + 2pq + q 2 : if p and q remain constant, and if
More informationThe phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.
Series 1: Cross Diagrams There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome: When both
More informationFull file at CHAPTER 2 Genetics
CHAPTER 2 Genetics MULTIPLE CHOICE 1. Chromosomes are a. small linear bodies. b. contained in cells. c. replicated during cell division. 2. A cross between true-breeding plants bearing yellow seeds produces
More informationPurification Kit DNA DNA UMN2303 UMN2303 INRA124. .(Hamidi, 2006) .(Daneshyar, 2003) .(Iranian National Atlas, 2001)
(337-344) 1390 4 42 2 1 * 2 1 (90/10/5 : - 89/12/25 : ). 17 20.. UMN2303 Purification Kit.. PCR UMN0108 BM81 INRA057 INRA189 UMN0907 UMN0929 UMN0504 UMN040 UMN3008 UMN270 UMN0301 UMN2405 UMN0307 17 102.
More informationChapter 2 Section 1 discussed the effect of the environment on the phenotype of individuals light, population ratio, type of soil, temperature )
Chapter 2 Section 1 discussed the effect of the environment on the phenotype of individuals light, population ratio, type of soil, temperature ) Chapter 2 Section 2: how traits are passed from the parents
More informationChanges in photosyn thesis and chlorophyll fluorescence parameters during rice leaf senescence in low chlorophyll b mutant
2009, 32 (2) : 10214 Journal of N anjing A gricultural U niversity http: / / nauxb1njau1edu1cn,,. b [ J ]., 2009, 32 ( 2) : 10214 b,, 3 (, 210095) : b ( 249) 5, ( P n ) Rubisco,, P n Rubisco b,, Rubisco,
More informationAP Biology Essential Knowledge Cards BIG IDEA 1
AP Biology Essential Knowledge Cards BIG IDEA 1 Essential knowledge 1.A.1: Natural selection is a major mechanism of evolution. Essential knowledge 1.A.4: Biological evolution is supported by scientific
More informationRole as adhesin of muramidase released protein of Streptococcus s uis type 2
2002, 25 (4) : 6771 Journal of Nanjing Agricultural University 2 1,2 1 3, (11, 210095 ; 21, 730070) : 2 (SS2) (MRP) : 11 HA9801 (MRP + ) SH006444 (MRP - ) HEp 2, MRP + MRP + ( P < 0105) 21 56 1 h ; DNase
More informationModule Contact: Dr Doug Yu, BIO Copyright of the University of East Anglia Version 1
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2014-2015 EVOLUTIONARY BIOLOGY & CONSERVATION GENETICS BIO-3C24 Time allowed: 3 hours Answer ALL questions in Section
More informationQuestion: If mating occurs at random in the population, what will the frequencies of A 1 and A 2 be in the next generation?
October 12, 2009 Bioe 109 Fall 2009 Lecture 8 Microevolution 1 - selection The Hardy-Weinberg-Castle Equilibrium - consider a single locus with two alleles A 1 and A 2. - three genotypes are thus possible:
More information2. What is meiosis? The process of forming gametes (sperm and egg) 4. Where does meiosis take place? Ovaries- eggs and testicles- sperm
Name KEY Period Biology Review Standard 3 Main Idea Explain the significance of meiosis and fertilization in genetic variation. How I can demonstrate what a smart. Person I am 1. What is fertilization?
More informationAHP JOURNAL OF NATURAL RESOURCES Feb., 2010 : F32614 : A : (2010)
25 2 Vol125 No12 20102 JOURNAL OF NATURAL RESOURCES Feb., 2010 AHP,, (, 510300) :,(AHP), 3 23,, 19782007,30,, 1984, 1978 51. 7%1999, 2007 1978 72. 4%, : ; ; ; ; : F32614: A : 1000-3037 (2010) 02-0249 -
More informationINTRODUCTION TO ANIMAL BREEDING. Lecture Nr 2. Genetics of quantitative (multifactorial) traits What is known about such traits How they are modeled
INTRODUCTION TO ANIMAL BREEDING Lecture Nr 2 Genetics of quantitative (multifactorial) traits What is known about such traits How they are modeled Etienne Verrier INA Paris-Grignon, Animal Sciences Department
More informationIs KIT locus polymorphism rs related to white belt phenotype in Krškopolje pig?
Is KIT locus polymorphism rs328592739 related to white belt phenotype in Krškopolje pig? Jernej Ogorevc, Minja Zorc, Martin Škrlep, Riccardo Bozzi, Matthias Petig, Luca Fontanesi, Marjeta Čandek-Potokar,
More informationDirected Reading B. Section: Traits and Inheritance A GREAT IDEA
Skills Worksheet Directed Reading B Section: Traits and Inheritance A GREAT IDEA 1. One set of instructions for an inherited trait is a(n) a. allele. c. genotype. d. gene. 2. How many sets of the same
More informationChina Academic Journal Electronic Publishing House. All rights reserved.
Vol. 27 No. 4 2 0 0 6 4 CHEM ICAL JOURNAL OF CH INESE UN IVERSITIES 687 69,, (,, 030006),, ( 2 ) ;, HSA BSA, 2,. ; (HSA) ; (BSA) ; O644; O657 A 02520790 (2006) 0420687205 ( ) ( ) ( ) ( ),. DNA, DNA [ ],
More informationChapter Eleven: Heredity
Genetics Chapter Eleven: Heredity 11.1 Traits 11.2 Predicting Heredity 11.3 Other Patterns of Inheritance Investigation 11A Observing Human Traits How much do traits vary in your classroom? 11.1 Traits
More informationChinese Journal of Scientific Instrument. High frequency we ighted M FCC extraction for noise robust speaker ver if ication
29 3 20083 Chinese Journal of Scientific Instrument Vol129 No13 Mar. 2008 M FCC 1, 1, 2 (1 400044; 2 400044) : MFCC Mel,,,,, MFCC,,, : ; ; ; ; MFCC : TP192. 3 : A: 520. 2040 High frequency we ighted M
More informationa type of reproduction in which one parent organism produces offspring without meiosis and fertilization
Define the following terms: Term Final Exam Vocabulary Review 2016-2017 Definition adaptation an inherited trait that increases an organism's chance of surviving and reproducing in a particular environment
More informationChapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype.
Chapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype. please read pages 38-47; 49-55;57-63. Slide 1 of Chapter 2 1 Extension sot Mendelian Behavior of Genes Single gene inheritance
More information11.1 Traits. Studying traits
11.1 Traits Tyler has free earlobes like his father. His mother has attached earlobes. Why does Tyler have earlobes like his father? In this section you will learn about traits and how they are passed
More informationLecture 2. Basic Population and Quantitative Genetics
Lecture Basic Population and Quantitative Genetics Bruce Walsh. Aug 003. Nordic Summer Course Allele and Genotype Frequencies The frequency p i for allele A i is just the frequency of A i A i homozygotes
More informationBaes, C., Spring, P. Mattei, S., Sidler, X. Ampuero, S., Bee, G. Luther, H., Hofer, A.
Closing the phenomic gap: methods, data collection and experiments to select for new traits, Email Christine_Baes@gmx.de Performance testing for boar taint a pivotal step towards ending surgical castration
More informationBS 50 Genetics and Genomics Week of Oct 3 Additional Practice Problems for Section. A/a ; B/B ; d/d X A/a ; b/b ; D/d
BS 50 Genetics and Genomics Week of Oct 3 Additional Practice Problems for Section 1. In the following cross, all genes are on separate chromosomes. A is dominant to a, B is dominant to b and D is dominant
More informationQ2 (4.6) Put the following in order from biggest to smallest: Gene DNA Cell Chromosome Nucleus. Q8 (Biology) (4.6)
Q1 (4.6) What is variation? Q2 (4.6) Put the following in order from biggest to smallest: Gene DNA Cell Chromosome Nucleus Q3 (4.6) What are genes? Q4 (4.6) What sort of reproduction produces genetically
More informationOCR Biology Checklist
Topic 1. Cell level systems Video: Eukaryotic and prokaryotic cells Compare the structure of animal and plant cells. Label typical and atypical prokaryotic cells. Compare prokaryotic and eukaryotic cells.
More informationLecture 2. Fisher s Variance Decomposition
Lecture Fisher s Variance Decomposition Bruce Walsh. June 008. Summer Institute on Statistical Genetics, Seattle Covariances and Regressions Quantitative genetics requires measures of variation and association.
More informationPopulation Genetics & Evolution
The Theory of Evolution Mechanisms of Evolution Notes Pt. 4 Population Genetics & Evolution IMPORTANT TO REMEMBER: Populations, not individuals, evolve. Population = a group of individuals of the same
More informationOCR Biology Checklist
Topic 1. Cell level systems Video: Eukaryotic and prokaryotic cells Compare the structure of animal and plant cells. Label typical and atypical prokaryotic cells. Compare prokaryotic and eukaryotic cells.
More informationTitle: WS CH 18.1 (see p ) Unit: Heredity (7.4.1) 18.1 Reading Outline p Sexual Reproduction and Meiosis
Title: WS CH 18.1 (see p.612-625) Unit: Heredity (7.4.1) 18.1 Reading Outline p. 612-625 NPD A. What is sexual reproduction? (p615) 1. _ produces an offspring when genetic materials from two different
More informationInheritance part 1 AnswerIT
Inheritance part 1 AnswerIT 1. What is a gamete? A cell with half the number of chromosomes of the parent cell. 2. Name the male and female gametes in a) a human b) a daisy plant a) Male = sperm Female
More informationDuplication of an upstream silencer of FZP increases grain yield in rice
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41477-017-0042-4 In the format provided by the authors and unedited. Duplication of an upstream silencer of FZP increases grain yield in rice
More informationQ1. The diagram shows how the number of species in different vertebrate groups changed between 400 million years ago and 5 million years ago.
Q. The diagram shows how the number of species in different vertebrate groups changed between 400 million years ago and 5 million years ago. The wider a block is, the more species there are. (a) Which
More informationVCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design
VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and
More informationAP Biology Curriculum Framework
AP Biology Curriculum Framework This chart correlates the College Board s Advanced Placement Biology Curriculum Framework to the corresponding chapters and Key Concept numbers in Campbell BIOLOGY IN FOCUS,
More informationDepartment of Forensic Psychiatry, School of Medicine & Forensics, Xi'an Jiaotong University, Xi'an, China;
Title: Evaluation of genetic susceptibility of common variants in CACNA1D with schizophrenia in Han Chinese Author names and affiliations: Fanglin Guan a,e, Lu Li b, Chuchu Qiao b, Gang Chen b, Tinglin
More informationChapter 13 Meiosis and Sexual Reproduction
Biology 110 Sec. 11 J. Greg Doheny Chapter 13 Meiosis and Sexual Reproduction Quiz Questions: 1. What word do you use to describe a chromosome or gene allele that we inherit from our Mother? From our Father?
More informationJust to review Genetics and Cells? How do Genetics and Cells Relate? The cell s NUCLEUS contains all the genetic information.
Just to review Genetics and Cells? How do Genetics and Cells Relate? The cell s NUCLEUS contains all the genetic information. It s called: DNA A. Describe what Gregor Mendel discovered in his experiments
More informationPicture from "Mendel's experiments: Figure 3," by Robert Bear et al
Plant Genetics Learning Objectives: Understand the basics o genetics Understand how genetics is used in Plant Science today Learn the basics o extracting DNA Learn how to make crosses between plants and
More informationAll living things share the characteristics of life.
Section 1: All living things share the characteristics of life. K What I Know W What I Want to Find Out L What I Learned Essential Questions What is biology? What are possible benefits of studying biology?
More informationSPRING SEMESTER 2017 FINAL EXAM STUDY GUIDE NAME: HR:
SPRING SEMESTER 2017 FINAL EXAM STUDY GUIDE NAME: HR: Parent signature for 10% bonus points on final: Chapter 5.1: Cell Cycle Notes 1. A cycle of growth, development, and division that most cells in an
More informationQuantitative trait locus analysis for ear height in maize based on a recombinant inbred line population
Quantitative trait locus analysis for ear height in maize based on a recombinant inbred line population Z.Q. Li 4,5, H.M. Zhang 1,4, X.P. Wu 1,4, Y. Sun 3,4 and X.H. Liu 2 1 Maize Research Institute, Shanxi
More informationTime allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2017-2018 GENETICS BIO-5009A Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section
More informationGenetics and Natural Selection
Genetics and Natural Selection Darwin did not have an understanding of the mechanisms of inheritance and thus did not understand how natural selection would alter the patterns of inheritance in a population.
More information(2) The drawings show stages in the evolution of the human skeleton.
GENETICS AND EVOLUTION. Thornton College NAME.. Q. Charles Darwin proposed the theory of natural selection. (a) What is meant by natural selection? (b) The drawings show stages in the evolution of the
More informationPage 2. M1.(a) (i) any two from:
M.(a) (i) (dead) animal buried in sediment allow imprint in mud hard parts / bones do not decay or soft parts do decay allow (one of) the conditions for decay is missing accept example, eg oxygen / water
More informationWhen one gene is wild type and the other mutant:
Series 2: Cross Diagrams Linkage Analysis There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:
More informationTexas Biology Standards Review. Houghton Mifflin Harcourt Publishing Company 26 A T
2.B.6. 1 Which of the following statements best describes the structure of DN? wo strands of proteins are held together by sugar molecules, nitrogen bases, and phosphate groups. B wo strands composed of
More informationPersonalised Learning Checklists AQA Biology Paper 2
AQA Biology (8461) from 2016 Topic B4.5 Homeostasis and response Topic Student Checklist R A G Describe what homeostasis is and why it is important stating specific examples from the human body 4.5.1 Homeostasis
More informationUnit 2 Lesson 4 - Heredity. 7 th Grade Cells and Heredity (Mod A) Unit 2 Lesson 4 - Heredity
Unit 2 Lesson 4 - Heredity 7 th Grade Cells and Heredity (Mod A) Unit 2 Lesson 4 - Heredity Give Peas a Chance What is heredity? Traits, such as hair color, result from the information stored in genetic
More informationKahramanmaras Sutcu Imam University, Faculty of Agriculture, Department of Animal Science, Unit of Biometry and Genetics, Kahramanmaras, Turkey 2
680 M. Sahin, S. Cankaya and A. Ceyhan Bulgarian Journal of Agricultural Science, 7 (No 5) 0, 680-686 Agricultural Academy Canonical Correlation Analysis for Estimation of Relationships Between Some Traits
More information10. How many chromosomes are in human gametes (reproductive cells)? 23
Name: Key Block: Define the following terms: 1. Dominant Trait-characteristics that are expressed if present in the genotype 2. Recessive Trait-characteristics that are masked by dominant traits unless
More informationMeiosis and Fertilization Understanding How Genes Are Inherited 1
Meiosis and Fertilization Understanding How Genes Are Inherited 1 How does a child inherit one copy of each gene from each parent? Compare what you already know with this flowchart. 1. Fill in each blank
More informationChina Academic Journal Electronic Publishing House. All rights reserved JOURNAL OF NATURAL RESOURCES Aug, 2009
24 8 Vol124 No18 20098 JOURNAL OF NATURAL RESOURCES Aug, 2009, (, 710062) : 19962006,,, 15,:,,,,,,, : ; ; ; : F29111: A : 1000-3037 (2009) 08-1378 - 08 1 1978 1719%20064319%, 0193 [ 1 ] 20 90,, 19962002
More informationAxial magnetic force model for large outer diameter m ulti2annular2nesting permanent magnetic bear ings
3 3 0095 EL ECTR ICMACH I ESADCO TROL Vol3 o3 May 009,, 3, 4 (., 70048;., 70048; 3., 70069; 4., 7007) :,,, : ;,;,,, : ; ; ; : TH333 : A : 007-449X (009) 03-0349- 07 Axial magnetic force model for large
More informationExpression of H IF21 and MM P22 in va sculogen ic m im icry of ovar ian cancer. Su M in 1,
H IF21 MMP22 3 1, 133, 2, 2, 3, 1 (1. ; 2. ; 3., 226001) :H IF21MMP22 (VM ) : 2000 1 2009 5 81, H IF21 MMP22,CD34 PAS VM,H IF21 MMP22 VM : H IF21( r = 0. 392, P = 0. 020) ( r = 0. 358, P = 0. 035),MMP22(
More informationAEC 550 Conservation Genetics Lecture #2 Probability, Random mating, HW Expectations, & Genetic Diversity,
AEC 550 Conservation Genetics Lecture #2 Probability, Random mating, HW Expectations, & Genetic Diversity, Today: Review Probability in Populatin Genetics Review basic statistics Population Definition
More informationGene mapping in model organisms
Gene mapping in model organisms Karl W Broman Department of Biostatistics Johns Hopkins University http://www.biostat.jhsph.edu/~kbroman Goal Identify genes that contribute to common human diseases. 2
More information, VX2. Em p ir ica l Study of Chem oem boliza tion Com b ined w ith Extract of Fung i of Hua ier on Hepa tic Tum or of Rabb it VX2
407 VX2 g g, 3,,,,, ( TACE) VX2 VX2 2,MR I VX2 3, 12, : A, 0. 2 m l/kg ; B TACE, 0. 2 m l/kg + 0. 5 mg/kg ; C TACE +, TA2 CE B, 500 mg/kg, 2,, ; 1 3 ( P > 0. 05) 2, B, A C ( P < 0. 05) ; A C ( P > 0. 05)
More informationHEREDITY: Objective: I can describe what heredity is because I can identify traits and characteristics
Mendel and Heredity HEREDITY: SC.7.L.16.1 Understand and explain that every organism requires a set of instructions that specifies its traits, that this hereditary information. Objective: I can describe
More informationChapter 6 Meiosis and Mendel
UNIT 3 GENETICS Chapter 6 Meiosis and Mendel 1 hairy ears (hypertrichosis)- due to holandric gene. (Y chromosome)-only occurs in males. Appears in all sons. 2 Polydactyly- having extra fingers Wendy the
More informationGENETICS - CLUTCH CH.1 INTRODUCTION TO GENETICS.
!! www.clutchprep.com CONCEPT: HISTORY OF GENETICS The earliest use of genetics was through of plants and animals (8000-1000 B.C.) Selective breeding (artificial selection) is the process of breeding organisms
More informationMeiosis and Mendel. Chapter 6
Meiosis and Mendel Chapter 6 6.1 CHROMOSOMES AND MEIOSIS Key Concept Gametes have half the number of chromosomes that body cells have. Body Cells vs. Gametes You have body cells and gametes body cells
More informationScience Unit Learning Summary
Learning Summary Inheritance, variation and evolution Content Sexual and asexual reproduction. Meiosis leads to non-identical cells being formed while mitosis leads to identical cells being formed. In
More informationIntroduction to population genetics & evolution
Introduction to population genetics & evolution Course Organization Exam dates: Feb 19 March 1st Has everybody registered? Did you get the email with the exam schedule Summer seminar: Hot topics in Bioinformatics
More informationControl of Gene Expression
Control of Gene Expression Mechanisms of Gene Control Gene Control in Eukaryotes Master Genes Gene Control In Prokaryotes Epigenetics Gene Expression The overall process by which information flows from
More informationReadings Lecture Topics Class Activities Labs Projects Chapter 1: Biology 6 th ed. Campbell and Reese Student Selected Magazine Article
Unit Subtopics and Duration Unit 1: Principles of Science Themes in science Research and Lab techniques 6 days Readings Lecture Topics Class Activities Labs Projects Chapter 1: Biology 6 th ed. Campbell
More informationCampbell BIOLOGY IN FOCUS 1 st Edition, AP Edition, 2014 Reece Urry Cain Wasserman Minorsky Jackson
A Correlation of Campbell BIOLOGY IN FOCUS 1 st Edition, AP Edition, 2014 Reece Urry Cain Wasserman Minorsky Jackson To the AP Biology Curriculum Framework AP is a trademark registered and/or owned by
More informationGEO GRA P HICAL RESEA RCH
27 2 2008 3 GEO GRA P HICAL RESEA RCH Vol127, No12 Mar1, 2008 1,5, 1,6, 3, 2, 3, 4 (11, 100101 ; 21, 100101 ; 31, 210098 ; 41, 450004 ; 51, 100049 ; 61, 100081) : GL U E,, :, UM, (R 2 ), CS, R 2, B, R
More informationBENCHMARK 1 STUDY GUIDE SPRING 2017
BENCHMARK 1 STUDY GUIDE SPRING 2017 Name: There will be semester one content on this benchmark as well. Study your final exam review guide from last semester. New Semester Material: (Chapter 10 Cell Growth
More informationTERAHERTZ WAVE REFLECTION IMAGING SYSTEM BASED ON BACKWARD WAVE OSC ILLATOR AND ITS APPL ICATION
29 1 2010 2 J. Infrared M illim. W aves Vol. 29, No. 1 February, 2010 : 1001-9014 (2010) 01-0015 - 04,,, (, 100048) :..,. 0. 7THz,.,,. : ; ; ; : O439 : A TERAHERTZ WAVE REFLECTION IMAGING SYSTEM BASED
More informationLecture 6: Introduction to Quantitative genetics. Bruce Walsh lecture notes Liege May 2011 course version 25 May 2011
Lecture 6: Introduction to Quantitative genetics Bruce Walsh lecture notes Liege May 2011 course version 25 May 2011 Quantitative Genetics The analysis of traits whose variation is determined by both a
More informationSouth Pacific Form Seven Certificate BIOLOGY. QUESTION and ANSWER BOOKLET
/ South Pacific Form Seven Certificate INSTRUCTIONS BIOLOGY 7 Write your Student Personal Identification Number (SPIN) in the space provided on the top right hand corner of this page. Answer ALL QUESTIONS.
More informationName: Per: Task: To create a model that explains how bi-racial parents can have black and white twins
Name: Per: Genetics Test Review Task: To create a model that explains how bi-racial parents can have black and white twins Part 1: DNA to Protein to Trait LT15 (Protein and Traits) - Proteins express inherited
More informationUntitled Document. A. antibiotics B. cell structure C. DNA structure D. sterile procedures
Name: Date: 1. The discovery of which of the following has most directly led to advances in the identification of suspects in criminal investigations and in the identification of genetic diseases? A. antibiotics
More informationAP Biology Gene Regulation and Development Review
AP Biology Gene Regulation and Development Review 1. What does the regulatory gene code for? 2. Is the repressor by default active/inactive? 3. What changes the repressor activity? 4. What does repressor
More informationMORPHOLOGICAL AND PRODUCTIVE CHARACTERISTICS OF TWO TSIGAIE ECOTYPES, USED AS GENETIC STOCK
Lucrări ştiinţifice Zootehnie şi Biotehnologii, vol. 42 (2) (2009), Timişoara MORPHOLOGICAL AND PRODUCTIVE CHARACTERISTICS OF TWO TSIGAIE ECOTYPES, USED AS GENETIC STOCK CARACTERISTICI MORFO-PRODUCTIVE
More informationDevelopmental genetics: finding the genes that regulate development
Developmental Biology BY1101 P. Murphy Lecture 9 Developmental genetics: finding the genes that regulate development Introduction The application of genetic analysis and DNA technology to the study of
More information