Purification Kit DNA DNA UMN2303 UMN2303 INRA124. .(Hamidi, 2006) .(Daneshyar, 2003) .(Iranian National Atlas, 2001)
|
|
|
- Anne Clara Williamson
- 5 years ago
- Views:
Transcription
1 ( ) * 2 1 (90/10/5 : - 89/12/25 : ) UMN2303 Purification Kit.. PCR UMN0108 BM81 INRA057 INRA189 UMN0907 UMN0929 UMN0504 UMN040 UMN3008 UMN270 UMN0301 UMN2405 UMN UMN0803 UMN2713. ( 5) UMN2303 ( 1). : 2..(Daneshyar, 2003) ) ) ( (...(Hamidi, 200) 8 70/ (Iranian National Atlas, 2001) 2. Molecular Markers 1. Molecular methodes mmohammadabadi@yahoo.com : : *
2 (Naghavi et al., 2.( ). FAO. ) FAO ( (FAO, 2004) SNP. 3 (PAR) X 4..(Liu et al., 2002) 0.(Kayser et al., 2000) X.(Liu et al., 2002) 5 (2/ mb) () (0/32 mb) q.(kayser et al., 2000) 14/5 mb p 8 mb q.(1 ).(Hannah, 2003) 2. International society for animal genetics 3. Pseodo Autosomal Region 4. -Specific Region 5. Distal.. (Bahrampoor et al., 2008;.Rajaei, 2005; Msoffe et al., 2005).(Nagamine & Higuchi, 2001) 1.(Moore et al., 1991)..(Liu et al., 2003) ( ).(Edwards et al., 2000) ( ) (mt).. 1. Microsatellite
3 : MS pb 14-4 Liu et al..(kayser et al., 2000) 0/9±0/ (2003) 38 (Liu et 14 (2004) Liu et al..al., 2003) (Liu et al., 2004) PCR EDTA. 23. Purification. Kit. PCR Male Spcific Region of the Ovine -Chromosome (PAR) ( q p ) -1 (7) % (Liu 104.et al., 2002) ).(Liu et al., 2003) (.(Edwards et al., 2000) ( ) (mt). (2000) Edwards et al.. (Edwards et al., 11 (2004) Meadows et al..2000)
4 UVIDOC. (2)... PCR UMN0929 UMN2303. INRA057 INRA189 UMN0907 UMN2405 UMN0307 UMN0108 BM81 UMN040 UMN3008 UMN270 UMN0301 UMN0803 UMN2713 UMN PCR C.. 5 ( ) ( ) 95 C 94 C C 30 ( 3) 72 C 30 ( ).( ) 72 C 5. 4 C 8 PCR Rapid Silver Staining UMN0803 UMN0929 UMN0108 UMN3008 UMN0307 UMN0907 UMN2303 UMN0301 UMN040 UMN0504 UMN2405 UMN270 UMN2713 INRA057 INRA189 BM81-1 (5-3 ) (5-3 ) GATCCACATCCCCCTCAC CTGCTTTTGTCCCGCTAA ACCAGCTGATACACAAGTGC GGTCAGAGAATGAAACAGAG GATCCATCCACATTGCTGCA CCAAGCGTCCATCAATTTAC TTGTGGAGGACTATTCATGG TCTGGACTCGACAGGACACC GATACAGCTGAGTGACTAAC GTGCAGACATCTGAGCTGTG CTGTTGATACTTTCTTCCTG CTGATGGACATCTGATATTC TACTTGCTTGAGACTTACTG TGTGAACACATCTGATTCTG GCCTGGGCTAGTGCGCAACC CAAAACTGTTGCACTGTTTC GTTGAGGACTCTTGCATCTG TGCTTCATCCTTCATTCCAC AGGCCATCTGCATAGTGAAG TGCTGGACTGCTCATCTCTG CCTGCCATCCATTGTGAAGA CTGCTTACCTGGTCAGGATT TTGTTGAGGACTCTTGCATC CCACATATCAGGCAAAGTCAT GTACCTACACTAATATGTTCA CCAAAGAAAGTTCAGGTACA CCTAGCGACTGTCCAAGCG CACGGGCTGAGAATTCAAAC GATCTTTGCAACTGGTTTG AGGACACAGGTCTGAGAATG TTTTGTTTCCCGTGCTGAG GAACCTCGTCTCCTTGTAGCC TTGAGCCACCTGGAAAGC CAAGCGGTTGGTTCAGATG ( C)
5 : UMN0803 UMN0929 UMN0108 UMN3008 UMN0307 UMN0907 UMN2303 UMN0301 UMN040 UMN0504 UMN2405 UMN270 UMN2713 INRA057 INRA189 BM81 (bp) UMN2303 ( 1) 38. ( 5) (Liu et al., 2002). PCR....(Liu et al., 2003) TSP UMN (Matthews and Reed, 1992) PCR. 8. (2004) Liu et al
6 (Liu et al., 131 (2005) Nguyen et al..2004) (BM81 INRA12) (INRA189 (Nguyen et al., PCR ).2005) -3 ( m) INRA057 (2002) Han et al. (f) 13.(Liu et al., 2004) (Liu et al., 2003) (UMN0103 (200) Xin et al. UMN2404) (2003) Liu et al. UMN2404 UMN2713. PCR. PCR.. X X. (Liu et al.,.2003). (BR) 1200 X 100.(Matthews & Reed, 1992) TSP PCR. PCR (2004) Liu et al..
7 :.. INRA12.(182 bp).(edwards et al., 2000) X INRA12. Han et. INRA12 (2002) Qi et al. BM81 83 (2002) al. INRA (2002) Han et al. 252 (2002) Qi et al. Nguyen et al.. (BM81 INRA12) (2005). INRA189 INRA12 BM81 REFERENCES 1. Bahrampoor, V., Mohammadabadi, M. R., Mirzaei, H., Baghizadeh, A., Dashab, Gh., Mohammadi, A., Alinaghizadeh, R., Soflaei, M. & Khesali, A. (2008). Molecular analysis of Calpastatin gene in Kermani sheep herds. Journal of Agricultural Science and Natural Resources, 15(4), Daneshyar, P. (2003). Polymorphism determination of 9 microsatellite markers in Balouchi sheep breed of Abasabad station of Mashhad. M.Sc. thesis of Animal science. Zabol University. 3. Edwards, C. J., Gaillard, C., Bradley, D. G. & MacHugh, D. E. (2000). -specific microsatellite polymorphisms in a range of bovid species. Animal Genetics, 31(2), FAO. (2004). Measurement of domestic animal diversity-a review of recent diversity studies. Commission on genetic resources for food and agriculture. Third session. 5. Hamidi, Z. (200). Study of Genetic diversity for microsatellite loci in Mazandaran native chickens. M.Sc. thesis of Animal science. Agriculture and natural resources university of Varamin. Ahvaz. Iran.. Han, J., Ochieng, J. W., Rege, J. E. O. & Hanotte, O. (2002). Low level of cattle introgression in yak populations from Bhutan and China: Evidences from -specific microsatellites and mitochondrial markers. In: Proceedings of the third international congress on yak, in Lhasa, China, 4-9 September International Livestock Research Institute (ILRI), Nairobi, pp Hannah, S. (2003). Mutation and Diversity in Avian Sex Chromosomes. Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology, ISSN X; Iranian National Atlas. (2001). Study of biological environment. (1 st ed.). Mapping center of Iran publication. 9. ISAG/ FAO standing committee. (2004). Secondary guidelines for development plans. MODAD: Recommended microsatellite markers. To be presented at ISAG. 10. Kayser, M., Roewer, L., Hedman, M., Henke, L., Henke, J., Brauer, S., Kruger, C., Krawczak, M., Nagy, M., Dobosz, T., Szibor, R., Knijff, P., Stoneking, M. & Sajantila, A. (2000). Characteristics and frequency of germline mutations at microsatellite loci from the human chromosome, as revealed by direct observation in father/son pairs. American Journal of Human Genetics, (5), Liu, W. S., Beattie, C. W., Cockett, N. E. & Ponce de Leon, F. A. (2004). Comparative analysis of 38 bovine -chromosome microsatellite in cattle, sheep and goat.plant & Animal Genomes XII Conference. Poster: P Liu, W. S., Beattie, C. W. & Ponce de Leon, F. A. (2003). Bovine chromosome microsatellite polymorphisms. Animal Genomics, 102, Liu, W. S., Mariani, P., Beattie, C. W., Alexander, L. J. & Ponce de Leon, F. A. (2002). A radiation hybrid map for the bovine chromosome. Mammalian Genome, 13, Matthews, M. E. & Reed, K. C. (1992). Sequences from a family of bovine -chromosomal repeats. Genomics, 13, Meadows, J. R. S., Hawken, R. J. & Kijas, J. W. (2004). Nucleotide diversity on the ovine
8 chromosome. Animal Genetics, 35(5), Moore, S. S., Sargeant, L. L., King, T. J., Mattick, J. S., Georges, M. & Hatzel, D. J. S. (1991). The conservation of dinucleotide microsatellites among mammalian genomes allow the use of heterologous RCR primer pairs in closely related species. Genomics, 10, Msoffe, P. L. M., Mtambo, M. M. A., Minga, U. M., Juul-Madsen, H. R. & Gwakisa, P. S. (2005). Genetic structure among the local chicken ecotypes of Tanzania based on microsatellite typing. African Journal of biotechnology, 4(8), Nagamine,. & Higuchi, M. (2001). Genetic distance and classification of domestic animals using genetic markers. Journal of Animal Breeding and Genetic, 118, Naghavi, M. R., Moradi, M., Ramshini, H. A. & Fazelinasab, B. (2004). Comparative analyses of the genetic diversity among wheat genotypes based on RAPD and SSR markers. Iranian Journal of Biotechnology, 2(3), Nguyen, T. T., Genini, S., Menetrey, F., Malek, M., Vogeli, P., Goe, M. R. & Stranzinger, G. (2005). Application of bovine microsatellite markers for genetic diversity analysis of Swiss yak (Poephagus grunniens). Animal Genetics, 3(), Qi, X., Han, J., Rege, E. O. & Hanotte, O. (2002). -chromosome specific microsatellite polymorphism in Chinese yak. In: Proceedings of the 7 th world congress on genetics applied to livestock production held in Montpellier, France, August 2002, 33, Rajaei, M. A. (2005). Study of Genetic diversity for Japan quil population using microsatellite Markers. M.Sc. thesis of Animal science. Faculty of Agriculture. Tarbiat Modares University. 23. Xin, C., Hong, C., Shan, W., Kai, X. & Chuzhao, L. (200). Polymorphisms of two chromosome microsatellites in Chinese cattle. Genetic Selection Evolution, 38,
Mitochondrial DNA Variation and Genetic Relationships in Japanese and Korean Cattle
1394 Asian-Aust. J. Anim. Sci. Vol. 19, No. 10 : 1394-1398 October 2006 www.ajas.info Mitochondrial DNA Variation and Genetic Relationships in Japanese and Korean Cattle S. Sasazaki*, S. Odahara, C. Hiura
Diagnostics and genetic variation of an invasive microsporidium (Nosema ceranae) in honey bees (Apis mellifera)
Diagnostics and genetic variation of an invasive microsporidium (Nosema ceranae) in honey bees (Apis mellifera) Dr. M. M. Hamiduzzaman School of Environmental Sciences University of Guelph, Canada Importance
Wheat Genetics and Molecular Genetics: Past and Future. Graham Moore
Wheat Genetics and Molecular Genetics: Past and Future Graham Moore 1960s onwards Wheat traits genetically dissected Chromosome pairing and exchange (Ph1) Height (Rht) Vernalisation (Vrn1) Photoperiodism
OMICS Journals are welcoming Submissions
OMICS Journals are welcoming Submissions OMICS International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best possible
Investigation of Correlation and Board Sense Heritability in Tritipyrum Lines under Normal and Drought Stress Conditions
American-Eurasian J. Agric. & Environ. Sci., 3 (): 07-, 03 ISSN 88-6769 IDOSI Publications, 03 DOI: 0.589/idosi.aejaes.03.3.0.333 Investigation of Correlation and Board Sense Heritability in Tritipyrum
Production type of Slovak Pinzgau cattle in respect of related breeds
Original Paper Production type of Slovak Pinzgau cattle in respect of related breeds Veronika Šidlová* 1, Nina Moravčíková 1, Anna Trakovická 1, Maja Ferenčaković 2, Ino Curik 2, Radovan Kasarda 1 1 Slovak
Microsatellites as genetic tools for monitoring escapes and introgression
Microsatellites as genetic tools for monitoring escapes and introgression Alexander TRIANTAFYLLIDIS & Paulo A. PRODÖHL What are microsatellites? Microsatellites (SSR Simple Sequence Repeats) The repeat
Genome Analysis In Domestic Animals By H. Geldermann
Genome Analysis In Domestic Animals By H. Geldermann If you are searched for the ebook by H. Geldermann Genome Analysis in Domestic Animals in pdf form, then you've come to faithful website. We furnish
Unique variations of SRY gene result in distinct patrilineal phylogeny of Capra hircus and other domestic Bovidae*
Animal Science Papers and Reports vol. 30 (2013), no. 3, 219-227 Institute of Genetics and Animal Breeding, Jastrzębiec, Poland Unique variations of SRY gene result in distinct patrilineal phylogeny of
Lesson 4: Understanding Genetics
Lesson 4: Understanding Genetics 1 Terms Alleles Chromosome Co dominance Crossover Deoxyribonucleic acid DNA Dominant Genetic code Genome Genotype Heredity Heritability Heritability estimate Heterozygous
Conservation Genetics. Outline
Conservation Genetics The basis for an evolutionary conservation Outline Introduction to conservation genetics Genetic diversity and measurement Genetic consequences of small population size and extinction.
Genome-wide linkage disequilibrium and past effective population size in three Korean cattle breeds
SHORT COMMUNICATION doi: 10.1111/age.12488 Genome-wide linkage disequilibrium and past effective population size in three Korean cattle breeds P. Sudrajad*, D. W. Seo*, T. J. Choi, B. H. Park, S. H. Roh,
BIOL 502 Population Genetics Spring 2017
BIOL 502 Population Genetics Spring 2017 Lecture 1 Genomic Variation Arun Sethuraman California State University San Marcos Table of contents 1. What is Population Genetics? 2. Vocabulary Recap 3. Relevance
Review of Bacterial Source Tracking in Texas. Kevin Wagner, George DiGiovanni, Terry Gentry, Elizabeth Casarez, Emily Martin
Review of Bacterial Source Tracking in Texas Kevin Wagner, George DiGiovanni, Terry Gentry, Elizabeth Casarez, Emily Martin Bacteria The #1 Cause of Water Quality Impairment in Texas Where did the Bacteria
A. Correct! Genetically a female is XX, and has 22 pairs of autosomes.
MCAT Biology - Problem Drill 08: Meiosis and Genetic Variability Question No. 1 of 10 1. A human female has pairs of autosomes and her sex chromosomes are. Question #01 (A) 22, XX. (B) 23, X. (C) 23, XX.
Genetic diversity of beech in Greece
Genetic diversity of beech in Greece A.C. Papageorgiou (1), I. Tsiripidis (2), S. Hatziskakis (1) Democritus University of Thrace Forest Genetics Laboratory Orestiada, Greece (2) Aristotle University of
PLANT VARIATION AND EVOLUTION
PLANT VARIATION AND EVOLUTION D. BRIGGS Department of Plant Sciences, University of Cambridge S. M. WALTERS Former Director of the University Botanic Garden, Cambridge 3rd EDITION CAMBRIDGE UNIVERSITY
KEY: Chapter 9 Genetics of Animal Breeding.
KEY: Chapter 9 Genetics of Animal Breeding. Answer each question using the reading assigned to you. You can access this information by clicking on the following URL: https://drive.google.com/a/meeker.k12.co.us/file/d/0b1yf08xgyhnad08xugxsnfvba28/edit?usp=sh
Leber s Hereditary Optic Neuropathy
Leber s Hereditary Optic Neuropathy Dear Editor: It is well known that the majority of Leber s hereditary optic neuropathy (LHON) cases was caused by 3 mtdna primary mutations (m.3460g A, m.11778g A, and
The problem of Y-STR rare haplotype
The problem of Y-STR rare haplotype February 17, 2014 () Short title February 17, 2014 1 / 14 The likelihood ratio When evidence is found on a crime scene, the expert is asked to provide a Likelihood ratio
Name: Hour: Teacher: ROZEMA. Inheritance & Mutations Connected to Speciation
Name: Hour: Teacher: ROZEMA Inheritance & Mutations Connected to Speciation Let s Review What We Already Know: What Have We Learned? Lesson 26: PI 1 (Projected Image) - Human Karyotype (image from https://en.wikipedia.org/wiki/karyotype#/media/file:nhgri_human_male_karyotype.png)
Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
Genetic Structure and Diversity of the Medano- Zapata Bison Herd using Microsatellite Data
University of Colorado, Boulder CU Scholar Undergraduate Honors Theses Honors Program Fall 2018 Genetic Structure and Diversity of the Medano- Zapata Bison Herd using Microsatellite Data Torrey E. Davis
Curriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
Dissecting the Matrilineal Components of Tongjiang Cattle from Southwest China
Biochem Genet (2008) 46:206 215 DOI 10.1007/s10528-008-9144-z Dissecting the Matrilineal Components of Tongjiang Cattle from Southwest China Shi-Yi Chen Æ Yi-Ping Liu Æ Wei Wang Æ Cheng-Zhong Gao Æ Yong-Gang
Genetic diversity and population structure in rice. S. Kresovich 1,2 and T. Tai 3,5. Plant Breeding Dept, Cornell University, Ithaca, NY
Genetic diversity and population structure in rice S. McCouch 1, A. Garris 1,2, J. Edwards 1, H. Lu 1,3 M Redus 4, J. Coburn 1, N. Rutger 4, S. Kresovich 1,2 and T. Tai 3,5 1 Plant Breeding Dept, Cornell
Genome-wide analysis of zygotic linkage disequilibrium and its components in crossbred cattle
Jiang et al. BMC Genetics 2012, 13:65 RESEARCH ARTICLE Open Access Genome-wide analysis of zygotic linkage disequilibrium and its components in crossbred cattle Qi Jiang 1, Zhiquan Wang 1, Stephen S Moore
Department of Forensic Psychiatry, School of Medicine & Forensics, Xi'an Jiaotong University, Xi'an, China;
Title: Evaluation of genetic susceptibility of common variants in CACNA1D with schizophrenia in Han Chinese Author names and affiliations: Fanglin Guan a,e, Lu Li b, Chuchu Qiao b, Gang Chen b, Tinglin
MARKER ASSISTED SELECTION (MAS) FOR DROUGHT TOLERANCE IN WHEAT USING MARKERS ASSOCIATED WITH MEMBRANE STABILITY
AN. I.N.C.D.A. FUNDULEA, VOL. LXXVII, 2009 GENETICA ŞI AMELIORAREA PLANTELOR MARKER ASSISTED SELECTION (MAS) FOR DROUGHT TOLERANCE IN WHEAT USING MARKERS ASSOCIATED WITH MEMBRANE STABILITY SELECŢIA ASISTATĂ
: Q343 : A : (2005)
2005, 28 (2) : 75 79 Journal of N anjing A gricultural U niversity BM PR2IB 1, 2, 1, 2, 1, 2, 1 1, 33, (11, 210095; 21, 832000; 31, 430070) : BMPR2IB, PCR2RFLP 553, BMPR2IB, BMPR2IB ( ) 3 (BB B + + + ),
Intracolonial nepotism during colony fissioning in honey bees?
Intracolonial nepotism during colony fissioning in honey bees? Juliana Rangel Co-authors: Heather Mattila, Thomas Seeley Department of Neurobiology and Behavior Cornell University Apimondia Conference,
Lodging-Resistance Breeding of Platycodon grandiflorus Using Distant Hybridization
American Journal of Plant Sciences, 2015, 6, 2844-2849 Published Online November 2015 in SciRes. http://www.scirp.org/journal/ajps http://dx.doi.org/10.4236/ajps.2015.618281 Lodging-Resistance Breeding
X-Sheet 3 Cell Division: Mitosis and Meiosis
X-Sheet 3 Cell Division: Mitosis and Meiosis 13 Key Concepts In this session we will focus on summarising what you need to know about: Revise Mitosis (Grade 11), the process of meiosis, First Meiotic division,
Genetic diversity and phylogenetic relationship using mitochondrial ND5 partial sequences in three cattle breeds
Mal. J. Anim. Sci. 14:7-12 (211) Genetic diversity and phylogenetic relationship using mitochondrial ND5 partial sequences in three cattle breeds Aslinda, K. 1,4 *, Wan Somarny, W.M.Z. 1, Mat Tasol, S.
Duplication of an upstream silencer of FZP increases grain yield in rice
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41477-017-0042-4 In the format provided by the authors and unedited. Duplication of an upstream silencer of FZP increases grain yield in rice
GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION
FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^
Ascertainment of evolutionary processes from the genetic variation associated to each geographic point in a map
Ascertainment of evolutionary processes from the genetic variation associated to each geographic point in a map J. R. Quevedo, * E. Fernández-Combarro, * L. J. Royo, I. Álvarez, A. Beja-Pereira, I. Fernández,
Neutral Theory of Molecular Evolution
Neutral Theory of Molecular Evolution Kimura Nature (968) 7:64-66 King and Jukes Science (969) 64:788-798 (Non-Darwinian Evolution) Neutral Theory of Molecular Evolution Describes the source of variation
Plant Genetic Resources: Effective Utilization
Plant Genetic Resources: Effective Utilization AU: Please check if the affiliation has been identified correctly. Hikmet Budak Faculty of Engineering and Natural Science, Biological Science and Bioengineering
Microsatellite data analysis. Tomáš Fér & Filip Kolář
Microsatellite data analysis Tomáš Fér & Filip Kolář Multilocus data dominant heterozygotes and homozygotes cannot be distinguished binary biallelic data (fragments) presence (dominant allele/heterozygote)
7.2: Natural Selection and Artificial Selection pg
7.2: Natural Selection and Artificial Selection pg. 305-311 Key Terms: natural selection, selective pressure, fitness, artificial selection, biotechnology, and monoculture. Natural Selection is the process
AEC 550 Conservation Genetics Lecture #2 Probability, Random mating, HW Expectations, & Genetic Diversity,
AEC 550 Conservation Genetics Lecture #2 Probability, Random mating, HW Expectations, & Genetic Diversity, Today: Review Probability in Populatin Genetics Review basic statistics Population Definition
Meiosis -> Inheritance. How do the events of Meiosis predict patterns of heritable variation?
Meiosis -> Inheritance How do the events of Meiosis predict patterns of heritable variation? Mendel s peas 1. Genes determine appearance (phenotype) 2. Genes vary and they are inherited 3. Their behavior
Chapter 6 Linkage Disequilibrium & Gene Mapping (Recombination)
12/5/14 Chapter 6 Linkage Disequilibrium & Gene Mapping (Recombination) Linkage Disequilibrium Genealogical Interpretation of LD Association Mapping 1 Linkage and Recombination v linkage equilibrium ²
CONSERVATION AND THE GENETICS OF POPULATIONS
CONSERVATION AND THE GENETICS OF POPULATIONS FredW.Allendorf University of Montana and Victoria University of Wellington and Gordon Luikart Universite Joseph Fourier, CNRS and University of Montana With
Multivariate analysis of genetic data an introduction
Multivariate analysis of genetic data an introduction Thibaut Jombart MRC Centre for Outbreak Analysis and Modelling Imperial College London Population genomics in Lausanne 23 Aug 2016 1/25 Outline Multivariate
BS 50 Genetics and Genomics Week of Oct 3 Additional Practice Problems for Section. A/a ; B/B ; d/d X A/a ; b/b ; D/d
BS 50 Genetics and Genomics Week of Oct 3 Additional Practice Problems for Section 1. In the following cross, all genes are on separate chromosomes. A is dominant to a, B is dominant to b and D is dominant
Analysis of Y-STR Profiles in Mixed DNA using Next Generation Sequencing
Analysis of Y-STR Profiles in Mixed DNA using Next Generation Sequencing So Yeun Kwon, Hwan Young Lee, and Kyoung-Jin Shin Department of Forensic Medicine, Yonsei University College of Medicine, Seoul,
Transfer of Rust Resistance from Triticum aestivum L. Cultivar Chinese Spring to Cultivar WL 711
Tropical Agricultural Research Vol. 16:71-78 (2004) Transfer of Rust Resistance from Triticum aestivum L. Cultivar Chinese Spring to Cultivar WL 711 S.P. Withanage and H. S. Dhaliwal 1 Rubber Research
Epigenetic vs. genetic diversity of stenoendemic short toothed sage (Salvia brachyodon Vandas)
Epigenetic vs. genetic diversity of stenoendemic short toothed sage (Salvia brachyodon Vandas) Biruš, I., Liber, Z., Radosavljević, I., Bogdanović, S., Jug Dujaković, M., Zoldoš, V., Šatović, Z. Balkan
Maize Genetics Cooperation Newsletter Vol Derkach 1
Maize Genetics Cooperation Newsletter Vol 91 2017 Derkach 1 RELATIONSHIP BETWEEN MAIZE LANCASTER INBRED LINES ACCORDING TO SNP-ANALYSIS Derkach K. V., Satarova T. M., Dzubetsky B. V., Borysova V. V., Cherchel
Raphael Mrode. Training in quantitative genetics and genomics 30 May 10 June 2016 ILRI, Nairobi. Partner Logo. Partner Logo
Basic matrix algebra Raphael Mrode Training in quantitative genetics and genomics 3 May June 26 ILRI, Nairobi Partner Logo Partner Logo Matrix definition A matrix is a rectangular array of numbers set
Microsatellite evolution in Adélie penguins
Microsatellite evolution in Adélie penguins Bennet McComish School of Mathematics and Physics Microsatellites Tandem repeats of motifs up to 6bp, e.g. (AC) 6 = ACACACACACAC Length is highly polymorphic.
GENETICS - CLUTCH CH.1 INTRODUCTION TO GENETICS.
!! www.clutchprep.com CONCEPT: HISTORY OF GENETICS The earliest use of genetics was through of plants and animals (8000-1000 B.C.) Selective breeding (artificial selection) is the process of breeding organisms
9 Genetic diversity and adaptation Support. AQA Biology. Genetic diversity and adaptation. Specification reference. Learning objectives.
Genetic diversity and adaptation Specification reference 3.4.3 3.4.4 Learning objectives After completing this worksheet you should be able to: understand how meiosis produces haploid gametes know how
Semester Outline of ALS Animals Standards
Semester Outline of ALS Animals Standards ALS: Animals Standards to be covered during Fall Semester (Level of Importance to Course Content: *low, **medium, ***high) Standard 1 Taxonomy and Classification
Xllth EUROPEAN CONFERENCE ON ANIMAL BLOOD GROUPS AND BIOCHEMICAL POLYMORPHISM
EUROPEAN SOCIETY FOR ANIMAL BLOOD GROUP RESEARCH Xllth EUROPEAN CONFERENCE ON ANIMAL BLOOD GROUPS AND BIOCHEMICAL POLYMORPHISM Edited by G. KOVÁKCS and M. PAPP 1972 DR. W. JUNK N.V., PUBLISHER THE HAGUE
Module Contact: Dr Doug Yu, BIO Copyright of the University of East Anglia Version 1
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2014-2015 EVOLUTIONARY BIOLOGY & CONSERVATION GENETICS BIO-3C24 Time allowed: 3 hours Answer ALL questions in Section
KIR gene polymorphism study in the Uygur population in Xinjiang, China
KIR gene polymorphism study in the Uygur population in Xinjiang, China G.-Y. Lin and Y.-B. Wang No. 474 Hospital of Chinese PLA, Urumqi, China Corresponding author: G.-Y. Lin E-mail: lgy474@yeah.net Genet.
Lecture WS Evolutionary Genetics Part I 1
Quantitative genetics Quantitative genetics is the study of the inheritance of quantitative/continuous phenotypic traits, like human height and body size, grain colour in winter wheat or beak depth in
When one gene is wild type and the other mutant:
Series 2: Cross Diagrams Linkage Analysis There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:
Major questions of evolutionary genetics. Experimental tools of evolutionary genetics. Theoretical population genetics.
Evolutionary Genetics (for Encyclopedia of Biodiversity) Sergey Gavrilets Departments of Ecology and Evolutionary Biology and Mathematics, University of Tennessee, Knoxville, TN 37996-6 USA Evolutionary
Assessment Schedule 2012 Scholarship Biology (93101)
Scholarship Biology (93101) 2012 page 1 of 9 Assessment Schedule 2012 Scholarship Biology (93101) Evidence Statement Question One Blackcaps: Evidence Statement Migratory behaviour (M) MM A mutation has
Why the Indian subcontinent holds the key to global tiger recovery
Why the Indian subcontinent holds the key to global tiger recovery QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture. Samrat Mondol K. Ullas Karanth Uma Ramakrishnan NCBS-TIFR
Reproduction and Evolution Practice Exam
Reproduction and Evolution Practice Exam Topics: Genetic concepts from the lecture notes including; o Mitosis and Meiosis, Homologous Chromosomes, Haploid vs Diploid cells Reproductive Strategies Heaviest
Principles of QTL Mapping. M.Imtiaz
Principles of QTL Mapping M.Imtiaz Introduction Definitions of terminology Reasons for QTL mapping Principles of QTL mapping Requirements For QTL Mapping Demonstration with experimental data Merit of QTL
Name: Period: EOC Review Part F Outline
Name: Period: EOC Review Part F Outline Mitosis and Meiosis SC.912.L.16.17 Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual reproduction and their consequences
13-1 Changing the Living World Slide 1 of 18
1 of 18 Selective Breeding Selective Breeding Selective breeding allows only those organisms with desired characteristics to produce the next generation. Nearly all domestic animals and most crop plants
Quiz Section 4 Molecular analysis of inheritance: An amphibian puzzle
Genome 371, Autumn 2018 Quiz Section 4 Molecular analysis of inheritance: An amphibian puzzle Goals: To illustrate how molecular tools can be used to track inheritance. In this particular example, we will
Part 2- Biology Paper 2 Inheritance and Variation Knowledge Questions
Part 2- Biology Paper 2 Inheritance and Variation Knowledge Questions AQA TRILOGY Biology (8464) from 2016 Topic T4.6 Inheritance, variation and evolution Topic Student Checklist R A G Describe features
COMBINING ABILITY ANALYSIS FOR CURED LEAF YIELD AND ITS COMPONENT TRAITS IN BIDI TOBACCO (NicotianatabacumL.)
International Journal of Science, Environment and Technology, Vol. 5, No 3, 2016, 1373 1380 ISSN 2278-3687 (O) 2277-663X (P) COMBINING ABILITY ANALYSIS FOR CURED LEAF YIELD AND ITS COMPONENT TRAITS IN
Molecular tools and analytical approaches for the characterization of farm animal genetic diversity
REVIEW ARTICLE doi: 10.1111/j.1365-2052.2011.02309.x Molecular tools and analytical approaches for the characterization of farm animal genetic diversity J. A. Lenstra*, L. F. Groeneveld, H. Eding, J. Kantanen,
The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.
Series 1: Cross Diagrams There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome: When both
Level 3 Biology, 2014
91606 916060 3SUPERVISOR S Level 3 Biology, 2014 91606 Demonstrate understanding of trends in human evolution 9.30 am Thursday 13 November 2014 Credits: Four Achievement Achievement with Merit Achievement
SSR ( ) Vol. 48 No ( Microsatellite marker) ( Simple sequence repeat,ssr),
48 3 () Vol. 48 No. 3 2009 5 Journal of Xiamen University (Nat ural Science) May 2009 SSR,,,, 3 (, 361005) : SSR. 21 516,410. 60 %96. 7 %. (),(Between2groups linkage method),.,, 11 (),. 12,. (, ), : 0.
Detecting selection from differentiation between populations: the FLK and hapflk approach.
Detecting selection from differentiation between populations: the FLK and hapflk approach. Bertrand Servin bservin@toulouse.inra.fr Maria-Ines Fariello, Simon Boitard, Claude Chevalet, Magali SanCristobal,
Genetic characterization of the invasive populations of Vespa velutina in France
Genetic characterization of the invasive populations of Vespa velutina in France M.ARCA 1,2, C.CAPDEVIELLE-DULAC DULAC 1, C.NADEAU 1, C.VILLEMANT 3, G.ARNOLD 2, J.F. SILVAIN 1 (1) IRD, UR 072, Laboratoire
Cowboy Genetics GENE HUNTING ON HORSEBACK A TRIP THROUGH THE WILD WORLD OF MOLECULAR GENETICS!
Cowboy Genetics GENE HUNTING ON HORSEBACK A TRIP THROUGH THE WILD WORLD OF MOLECULAR GENETICS! by Lana Kaiser, DVM I was hoping for a heifer (okay, let s face it, I am always hoping for a heifer, but this
Molecular characterisation of a population derived from microspores of Brassica napus B. carinata hybrids
Molecular characterisation of a population derived from microspores of Brassica napus B. carinata hybrids Annaliese Mason 1, Matthew Nelson 1,2, Guijun Yan 1 and Wallace Cowling 1,2 1 School of Plant Biology,
Population Structure
Ch 4: Population Subdivision Population Structure v most natural populations exist across a landscape (or seascape) that is more or less divided into areas of suitable habitat v to the extent that populations
SPECIATION. REPRODUCTIVE BARRIERS PREZYGOTIC: Barriers that prevent fertilization. Habitat isolation Populations can t get together
SPECIATION Origin of new species=speciation -Process by which one species splits into two or more species, accounts for both the unity and diversity of life SPECIES BIOLOGICAL CONCEPT Population or groups
VCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design
VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and
Contents PART 1. 1 Speciation, Adaptive Radiation, and Evolution 3. 2 Daphne Finches: A Question of Size Heritable Variation 41
Contents List of Illustrations List of Tables List of Boxes Preface xvii xxiii xxv xxvii PART 1 ear ly problems, ea r ly solutions 1 1 Speciation, Adaptive Radiation, and Evolution 3 Introduction 3 Adaptive
You are encouraged to answer/comment on other people s questions. Domestication conversion of plants or animals to domestic uses
The final exam: Tuesday, May 8 at 4:05-6:05pm in Ruttan Hall B35. 75 multiple choice questions for 150 points 50 questions from Lecture 20 27 25 questions directly from the first two exams. Key for exam
Chapter 17: Population Genetics and Speciation
Chapter 17: Population Genetics and Speciation Section 1: Genetic Variation Population Genetics: Normal Distribution: a line graph showing the general trends in a set of data of which most values are near
Developing continental maps of African animal trypanosomosis: the example of Ethiopia, Kenya and Uganda
Developing continental maps of African animal trypanosomosis: the example of Ethiopia, Kenya and Uganda 32 nd Meeting of the International Scientific Council for Trypanosomiasis Research and Control (ISCTRC)
Limited dimensionality of genomic information and effective population size
Limited dimensionality of genomic information and effective population size Ivan Pocrnić 1, D.A.L. Lourenco 1, Y. Masuda 1, A. Legarra 2 & I. Misztal 1 1 University of Georgia, USA 2 INRA, France WCGALP,
WHAT IS BIOLOGICAL DIVERSITY?
WHAT IS BIOLOGICAL DIVERSITY? Biological diversity or biodiversity is the variety of life - the wealth of life forms found on earth. 9 WHAT IS BIOLOGICAL DIVERSITY? Wilcox s (1984) definition: Biological
ACTA AGRONOMICA SINICA SSR. Classification for Some Sterile Lines and Their Restorers of Hybrid Rice with SSR Markers
32 2 2006 2 169 175 ACTA AGRONOMICA SINICA Vol132, No12 pp1 169-175 Feb1, 2006 SSR 1 1,2, # 1 1 1 1, 3 2 2 Ξ ( 1, 330045 ; 2,,100094) : ( Oryza sativa L. ) 12 36 SSR(simple sequence repeats), 5 7 54 300,
Rapid speciation following recent host shift in the plant pathogenic fungus Rhynchosporium
Rapid speciation following recent host shift in the plant pathogenic fungus Rhynchosporium Tiziana Vonlanthen, Laurin Müller 27.10.15 1 Second paper: Origin and Domestication of the Fungal Wheat Pathogen
UNIT 8 BIOLOGY: Meiosis and Heredity Page 148
UNIT 8 BIOLOGY: Meiosis and Heredity Page 148 CP: CHAPTER 6, Sections 1-6; CHAPTER 7, Sections 1-4; HN: CHAPTER 11, Section 1-5 Standard B-4: The student will demonstrate an understanding of the molecular
4/26/18. Domesticated plants vs. their wild relatives. Lettuce leaf size/shape, fewer secondary compounds
The final exam: Tuesday, May 8 at 4:05-6:05pm in Ruttan Hall B35. 75 multiple choice questions for 150 points 50 questions from Lecture 20 27 25 questions directly from the first two exams. Key for exam
Faculty of Biosciences Department of Plant Sciences Master in Plant Sciences
Faculty of Biosciences Department of Plant Sciences Master in Plant Sciences Specializations: Plant Production Systems Plant Biotechnology Plant Protection Admission 2018 Master in Plant Sciences Master
5/31/2012. Speciation and macroevolution - Chapter
Speciation and macroevolution - Chapter Objectives: - Review meiosis -Species -Repro. Isolating mechanisms - Speciation -Is evolution always slow -Extinction How Are Populations, Genes, And Evolution Related?
that of Phylotree.org, mtdna tree Build 1756 (Supplementary TableS2). is resulted in 78 individuals allocated to the hg B4a1a1 and three individuals to hg Q. e control region (nps 57372 and nps 1602416526)
IUCN Red List Process. Cormack Gates Keith Aune
IUCN Red List Process Cormack Gates Keith Aune The IUCN Red List Categories and Criteria have several specific aims to provide a system that can be applied consistently by different people; to improve
Linkage disequilibrium and the genetic distance in livestock populations: the impact of inbreeding
Genet. Sel. Evol. 36 (2004) 281 296 281 c INRA, EDP Sciences, 2004 DOI: 10.1051/gse:2004002 Original article Linkage disequilibrium and the genetic distance in livestock populations: the impact of inbreeding
MOLECULAR MAPS AND MARKERS FOR DIPLOID ROSES
MOLECULAR MAPS AND MARKERS FOR DIPLOID ROSES Patricia E Klein, Mandy Yan, Ellen Young, Jeekin Lau, Stella Kang, Natalie Patterson, Natalie Anderson and David Byrne Department of Horticultural Sciences,
Biology 110 Survey of Biology. Quizzam
1. Mendel conducted his most memorable experiments on A) peas. B) roses. C) guinea pigs. D) fruit flies. E) clones. 2. Varieties of plants in which self-fertilization produces offspring that are identical
Chapter 5 Evolution of Biodiversity. Sunday, October 1, 17
Chapter 5 Evolution of Biodiversity CHAPTER INTRO: The Dung of the Devil Read and Answer Questions Provided Module 14 The Biodiversity of Earth After reading this module you should be able to understand