Insights into the evolution of the tribe Arctoteae (Compositae: subfamily Cichorioideae s.s.) using trnl-f, ndhf, and ITS

Transcription

1 TAXON 53 (3) August 2004: Funk & al. Evlutin f the tribe Arctteae ASTERACEAE Insights int the evlutin f the tribe Arctteae (Cmpsitae: subfamily Cichriideae s.s.) using trnl-f, ndhf, and ITS Vicki A. Funk*, Raymund Chan 2 & Sterling C. Keeley 2 1 U.S. Natinal Herbarium, Smithsnian Institutin MRC 166, P.O. Bx 37012, Washingtn D.C U.S.A. funk.vicki@nmnh.si.edu (authr fr crrespndence) 2 Department f Btany, University f Hawaii at Mana, Hawaii 96822, U.S.A. raymundc@hawaii.edu; ster- ling@hawaii. edu Cmpsitae (Asteraceae) are the largest flwering plant family (23,000 t 30,000 species) and its members are fund thrughut the wrld in bth temperate and trpical habitats. The subfamilies and tribes f Cmpsitae remained relatively cnstant fr many years; recent mlecular studies, hwever, have identified new subfamilial grups and identified previusly unknwn relatinships. Currently there are 35 tribes and 10 subfamilies (Baldwin & al., 2002; Paner & Funk, 2002). Sme f the tribes and subfamilies have nt been tested fr mnphyly and withut a clear understanding f the majr genera that frm each tribe and subfamily, an accurate phylgeny fr the family cannt be recnstructed. The tribe Arctteae (African daisies) is a diverse and interesting grup with a primarily suthern African distributin (ca. 17 genera, 220 species). They are especially imprtant in that mst f the species are fund in the Cape Flral Kingdm, the smallest flral kingdm and the subject f intense cnservatin interest. Arctteae are part f the mnphyletic subfamily Cichriideae s.s. Other tribes in the subfamily include Eremthamneae, Gundelieae, Lactuceae, Liabeae, Mquineae, and Vernnieae, and these were all evaluated as ptential utgrups. Ultimately 29 ingrup taxa and 16 utgrup taxa with a ttal f 130 sequences (125 newly reprted), frm three genetic regins, tw frm chlrplast DNA (trnl-f and ndhf) and ne frm the nuclear genme (ITS), were used t evaluate the tribe and its prpsed utgrups. Each mlecular regin is examined separately, the chlrplast markers are examined tgether, and the data are cmbined. The data were analyzed with and withut utgrups and prblem taxa using parsimny and maximum likelihd methds. The analyses shwed rbust supprt fr tw utgrup clades, Liabeae-Vernnieae and Gundelieae-Lactuceae and tw main subtribes within Arctteae: Arcttineae and. Supprt fr mnphyly f Arctteae is weak. Within Arctteae, sme taxa f interest are easily placed: Didelta, Cuspidia and Heterrhachis are cnsistently part f subtribe, Cymbntus, the Australian genus, is nested within subtribe Arcttineae, and Haplcarpha is at the base f Arcttineae. Berkheya, Haplcarpha, and Hirpicium are prbably paraphyletic. Furthermre, Platycarpha mst likely des nt belng in Arctteae, and Heterlepis and the tribe Eremthamneae are within Arctteae but nt within either f the tw main subtribes. After sme rearrangements, the tw main subtribes, Arcttineae and, are mnphyletic and the latter has three clades. The study shws that the unusual taxa are f critical imprtance, and they shuld be included in any mlecular analysis. Adequate representatin f the ingrup is als imprtant as all previus studies f Arctteae had invlved nly a few taxa frm the cre subtribes, and s did nt reveal the prblems. Multiple utgrups evaluated in an iterative manner had prnunced effects n the relatinships within the ingrup, nt nly n the psitin f the rt. Finally, unrted cnsensus trees and unrted phylgrams were fund t be very useful in analyzing the data, allwing fr examinatin f placement f taxa withut the bias f a rted tree. KEYWORDS: Arctteae, Asteraceae, Cape Flral Kingdm, Cichriideae, Cmpsitae, ITS, mlecular phylgenetics, ndhf, utgrups, Suth Africa, trnl. INTRODUCTION The Cmpsitae family has the largest number f species f any family f seed plants (23,000-30,000), and tday its members can be fund n every cntinent except Antarctica. The subfamilial classificatin has had minr revisins, but until recently it had nt seriusly changed since the 13 tribes f Bentham (Bentham, 1873a, b). The advent f DNA sequence data frm the chlrplast and nuclear genmes has changed Cmpsitae systematics in dramatic ways: first, they have identified basal clades that turned the ideas abut 637

2 Funk & al. Evlutin f the tribe Arctteae TAXON 53 (3) August 2004: evlutin within the family upside dwn (Jansen & al., 1991; Kim & Jansen, 1995) and secnd, mre recently by revisins that have divided the family int 10 subfamilies and 35 tribes (Baldwin & al., 2002; Paner & Funk, 2002; Paner & al., unpubl.). Many f the traditinal tribes had brad distributins cvering hemispheres (i.e., Lactuceae, Heliantheae s.l.), r nearly the whle glbe (e.g., Senecineae). Three f the mre mdestly sized tribes, Arctteae (suthern Africa and Australia), Calenduleae (suthern Africa), and Liabeae (Andean Suth America, Central America, Mexic, and the Caribbean), have rather restricted distributins and therefre lend themselves t detailed systematic and bigegraphic investigatins. One f these, Arctteae, is the subject f ur investigatin. This tribe is particularly interesting nt nly because it is mre r less cnfined t suthern Africa, but als because mst f its species are endemic t the Cape Flral Kingdm. The tribe Arctteae belngs t the redefined subfamily Cichriideae s.s. (Paner & Funk, 2002). The subfamily cntains frm fur t seven tribes, depending n where the member taxa are fund in the final analysis and n ne's persnal philsphy with regard t Cmpsitae classificatin. The fur traditinal and larger tribes are Arctteae (African daisies), Lactuceae (r Cichrieae; dandelins), Liabeae (Andean sunflwers), and Vernnieae (irnweeds). The three small tribes (with ne r tw genera each) are Eremthamneae {Eremthamnus and Hplphyllum; authrs fr all genera are fund in Table 1), Gundelieae {Gundelia, crwn f thrns), and Mquineae (Mquinea and Pseudstifftia). Nne f the relatinships amng the tribes have been reslved, and sme f the taxa are nt universally accepted at the tribal level. Fr purpses f this study, Vernnieae, Liabeae, and Lactuceae were included as ptential utgrups fr Arctteae. The tribe Mquineae was assumed t be clse t, if nt actually in, the Vernnieae clade and was nt included. The genera f Eremthamneae were treated as part f Arctteae and Gundelia was riginally treated as part f Arctteae, but it eventually fell utside the tribe. Data frm a variety f surces (Cassini, 1816, 1821; Beauverd, 1915a, b; Rbinsn & Brettell, 1973a; Nrlindh, 1977; Rbinsn, 1992, 1994; Bremer, 1994; Herman & al., 2000; Leistner, 2000) as well as persnal bservatins shw that the tribe Arctteae des nt have an abundance f characters t supprt its mnphyly. Beginning with Cassini, the traditinal definitin f Arctteae was based n the presence f a swllen area with a ring f hairs lcated just belw the branch pint n the style. While there are hairs in a ring just belw the divisin in the style, this character is als fund in sme thistles, and the presence f a swllen area is fund mstly in the subtribe. Members f the tw main subtribes f Arctteae have sagittate but nt tailed anthers (except fr Arcttis which has calcarate, shrt caudate anthers), and the heads usually have bth ray and disc flrets. The stigmatic papillae are spread ver the inner surfaces f the style branches, but this character is fund in many tribes in the bttm third f the family Table 1. Highlights f classificatin and nmenclature f the tribe Arctteae (Cmpsitae). Numbers in parentheses indicate the number f species in the genus. Traditinal (mdified Bentham, 1873b) Rbinsn & Brettell, 1973 Subtribe Less. Arcttheca Wendl. (4) Arcttis L. (-64) Cymbntus Gaud. (2) Dymndia Cmptn (1) Haplcarpha Less. (10) Subtribe Benth. & Hk. f. Berkheya Ehrh. (-75) Cuiiumia R. Br. (15) Cuspidia Gaertn. (1) Didelta L'Herit (2) Gazania Gaertn. (17) Grteria L. (3) Heterlepis Cass. (3) Heterrhachis Sch. Bip. (1) Hirpicium Cass. (12) Subtribe Gundeliinae Bentham Gundelia L. (1) Eremthamnus O. Hffm. (1) Platycarpha Less. (3) 638 Hplphyllum DC. (2) Ursinia Gaertn. Tribe Gundelieae H. Rb. & Brettell Tribe Eremthamneae H. Rb. & Brettell Tribe Cynareae Tribe Ursinieae H. Rb. & Brettell Heywd & al. (varius chapters), 1977 Bremer, 1994 by Nrlindh, Mutisieae by Merxmuller Subtribe Gundeliinae Subtribe Eremthamninae Lenis Tribe Cynareae (Nrlindh) (rejected by Dittrich) Tribe Vernnieae Tribe Anthemideae unassigned t subtribe Subtribe unassigned t tribe unassigned t subtribe unassigned t tribe Tribe Anthemideae

3 TAXON 53 (3) August 2004: Funk & al. Evlutin f the tribe Arctteae phylgeny. The pappus is usually made up f scales (absent in Cymbntus and Cullumia), but Heterlepis has what has been described as "bristle-like" scales. Mst members f the tribe are annual r perennial herbs, but sme are shrubs r subshrubs; mst have yellw flwers, but there are sme nticeable exceptins such as Arcttis and Gazania (Figs. IB, C, E). All f the species in the Arctteae, except thse in Cymbntus (2-3 species, Australia), are native t suthern Africa. The tribe Arctteae was first recgnized by Cassini (1816) wh described a ttal f 14 genera, three f which were later placed in synnymy. In 1832, Lessing reduced the grup t the rank f subtribe within the tribe Cardueae (thistles); he recgnized 18 genera, including five new nes. Mst mdern treatments are based n the wrk f Bentham (Bentham, 1873a, b) wh reinstated Arctteae at the tribal level with three subtribal grups: Euarctteae (nw ), Grterieae (), and Gundelieae (Gundelinae). Hffmann (1890) used Bentham's subtribes, but he interpreted the genus Arcttis in the brad sense, encmpassing mst f the mdern-day genera f the subtribe. Minr mvements f prblem genera ensued. Bentham (1873b) remved Heterlepis frm Arctteae and placed it in Inuleae. Hffmann placed Eremthamnus in Senecineae (1890). Beauverd (1915a) transferred Ursinia frm Arctteae t Anthemideae based n style mrphlgy. Mre (1929) mved Eremthamnus int Inuleae, and Merxmiiller (1967) put it back int Senecineae. Stix (1960) suggested that Platycarpha shuld be in Mutisieae. Prir t 1970 Eremthamnus had been placed in the tribes Senecineae, Liabeae, Astereae, Gnaphalieae, and Inuleae, but in 1970 Leins suggested that Eremthamnus was in Arctteae, clse t but nt inside. In 1973, Rbinsn and Brettell (1973a) tk Ursinia ut f Arctteae and put it int its wn tribe based n pllen characters. Als in the same publicatin, Rbinsn and Brettell put Platycarpha in Cardueae (thistles) and returned Heterlepis t Arctteae. In that same year, Rbinsn & Brettell (1973b) mved bth Eremthamnus and Gundelia int tribes f their wn. In the bk Bilgy and Chemistry f the Cmpsitae (Heywd & al., 1977), each tribe was discussed in ne r mre chapters, and cmments were made cncerning the placement f prblem taxa. Nrlindh (1977) prepared the treatment f Arctteae; he accepted the three subtribes f Bentham and added the subtribe Eremthamninae while excluding Platycarpha and Ursinia. Dittrich (1977) in his treatment f the thistles (Cardueae) rejected bth Platycarpha and Gundelia and suggested that they shuld be placed in Arctteae. Merxmiiller (1977), in his treatment f Inuleae, agreed that Heterlepis did nt belng in that tribe and suggested a placement in Mutisieae, and Jnes (1977) included Hplphyllum in Vernnieae. Heywd & Humphries (1977) placed Ursinia int Anthemideae but cnsidered the placement dubius. Mre recently, Karis (1992) published a cladistic study based n mrphlgy that suggested that Hplphyllum was sister t Eremthamnus, and he had mderate supprt fr the tw genera being clsely related t Arctteae. Rbinsn (1994) used pllen data t supprt his hyptheses that Gundelia and Eremthamnus belnged in tribes f their wn and nt in Arctteae. Bergqvist & al. (1995) used cpdna restrictin site data frm 58 genera f the family t examine the psitin f Eremthamnus and fund that it was sister t Arctteae, but he used nly ne genus {Gazania) frm Arctteae. The mst recent classificatin f Arctteae was published by Bremer (1994); he recgnized nly the tw main subtribes by sinking Gundelieae int. He listed Eremthamnus and Hplphyllum as belnging t the subfamily Cichriideae s.l. but "unplaced" as t tribe. Karis & al. (2001) used sequence data frm ndhf t suggest that Gundelia did nt belng in Arctteae but was the sister grup f Cichrieae (Lactuceae). Based n these data, Gundelia culd be included in Lactuceae r left in its wn mntypic tribe, Gundelieae. Mst recently the Saharan genus Warinia has been shwn t be clsely related t, and pssibly the sister taxn f, Gundelia (Paner & Funk, 2002), and these tw tgether nw cnstitute Gundelieae and are sister t Lactuceae. Ursinia has been placed in Anthemideae based n mrphlgical and mlecular data (Heywd & Humphries, 1977; Watsn & al., 2000). Hwever, prblems remain cncerning the placement f several genera: Eremthamnus, Heterlepis, Hplphyllum, and Platycarpha. In additin, Cuspidia, Didelta, Haplcarpha, and Heterrhachis are unusual taxa mrphlgically, and a cnfirmed placement f these genera wuld help with understanding the evlutin f the mrphlgy f the tribe. Heterrhachis and Cuspidia are mntypic genera that have unusual features, Haplcarpha has a variable chrmsme number, and Didelta has an unusual cnditin where its receptacle breaks int parts enclsing the achenes. The uter parts are adnate t ne f the uter invlucral bracts that becme thickened and lignified and new plants may germinate ut f these parts (Fig. 1A). Finally, Cymbntus, the nly genus fund utside f suthern Africa, may be designated "endangered" in its native Australia and s its psitin in the tribe needs t be cnfirmed. Table 1 presents an histrical summary f taxnmy f Arctteae. The ultimate gal f ur research effrt is t prduce a detailed mrphlgical study and mlecular analysis f Arctteae and t use the results t investigate the evlutin and bigegraphical histry within the tribe and amng tribes f the subfamily Cichriideae s.s. Obviusly, this task will take sme time and invlve sev- 639

4 Funk & al. Evlutin f the tribe Arctteae TAXON 53 (3) August 2004: Fig. 1. Variatin in shape and clr f heads in the mstly suthern African tribe Arctteae. A, Didelta; B, C, Arcttis; D, Berkheya; E, Gazania. All phts by V. Funk. 640

5 TAXON 53 (3) August 2004: Funk & al. Evlutin f the tribe Arctteae eral prjects. The gals f this paper are t investigate the mnphyly f Arctteae, determine the sister grup(s) and/r mst apprpriate utgrup(s), determine placement f prblem and unusual genera, and establish a sund basis fr a subtribal classificatin f the tribe. I MATERIALS AND METHODS Taxn sampling. The terms "ingrup" and "utgrup" are, f curse, relative t ne anther and change based n the specific questin being addressed. Fr this study we cnsider the ingrup t include all taxa that were previusly thught t be in the tribe Arctteae, with the exceptin f Ursinia (nw in Anthemideae). These ingrup genera were sampled thrughly by including several species f each genus s that all "grups" within the genera were sampled. At least tw ppulatins were sampled in the mntypic genera. The first set f utgrups fr this study included all taxa utside f traditinal Arctteae that are fund in the subfamily Cichriideae s.s. (Appendix). A secnd set f utgrups frm utside the subfamily were added later (Appendix). In general, all utgrup taxa were sampled less thrughly than the ingrup taxa. Ingrup. Seventeen ingrup genera were used in this study, including all but ne f the genera previusly placed in Arctteae (excluding Ursinia: Anthemideae). A ttal f 76 samples was analyzed and 28 f these ingrup samples (Appendix) were selected t be used in the pruned tree. There are 78 newly reprted sequences, 26 ITS, 27 trnl-f, and 25 ndhf, and tw taken frm GenBank. Outgrups. Sixteen species in 15 utgrup genera were sampled fr this study (Appendix). There are 44 newly reprted sequences, 14 ITS, 15 trnl-f, and 15 ndhf, ne sequence was taken frm GenBank and tw were sent by J. Paner (pers. cmm.). The tribes f Cichriideae s.s. (Arctteae, Eremthamneae, Gundelieae, Lactuceae, Liabeae, Mquineae, and Vernnieae) frm a mnphyletic grup with gd supprt (Paner & Funk, 2002); the relatinships amng these tribes, hwever, is prly understd. All f the tribes were cnsidered as pssible utgrups fr Arctteae, but nly fur were used. The Eremthamneae were cnsidered by Nrlindh (1977) t be part f Arctteae, s it was included in the ingrup. Gundelieae (as Gundelia) was als included in Arctteae by Nrlindh (1977) and Bremer (1994), but, based n ndhf sequence data, Karis suggested that Lactuceae and Gundelia were sister taxa (Karis & al., 2001). Our initial analyses supprted this, and s the tribe Gundelieae was mved t the utgrup. The Gundelieae were, until recently, believed t be mntypic, but they have nw been shwn t cntain Warinia as well as Gundelia (Paner & Funk, 2002); bth genera were used in this study. Lactuceae, mrphlgically distinct but prly knwn mlecularly, was represented by three cmmn genera (Cichrium, Hypchaeris, and Lactuca). The taxa frm Liabeae, a mdest-sized tribe frm the Americas, were selected because they represent the tw main lineages f the tribe and ne member f the paraphyletic base f the tribe (Kim & al., 2003). Vernnieae, a large and diverse tribe with ca species, was included as an utgrup. The taxa frm Vernnieae used in the study were selected because they were near the base f the preliminary trees prduced in an nging mlecular study f the tribe (Keeley & Chan, pers. cmm.). Previusly it has been suggested that Vernnieae and Liabeae might be clsely related, in fact Cassini had Liabeae as a subunit f Vernnieae (Cassini, 1828, 1830) and ther authrs have als placed the tw tgether (e.g., Rbinsn & Funk, 1987; Bergqvist & al., 1995). Mquineae were cnsidered t be part f Vernnieae and were nt included in this study. Once the data were cmbined, additinal utgrups culd be added frm utside f subfamily Cichriideae including Barnadesia and Dasyphyllum frm subfamily Barnadesiideae, Gerbera (tw species) frm the tribe Mutisieae s.s., and Carthamus and Cirsium frm the tribe Cardueae (thistles). The DNA sequences were btained frm several surces. Onging studies by Keeley and Chan (unpubl.) prvided sequences fr Vernnieae. Paner (unpubl.) prvided the trnl-f and ndhf fr Warinia. GenBank prvided tw ITS sequences (Hplphyllum and Warinia) and ne ndhf (Eremthamnus). Althugh we tried repeatedly t btain additinal sequences frm Eremthamnus, we were unsuccessful; these tw regins, therefre, are missing fr this taxn. It des nt appear t have created any prblems, hwever; all ndhf and cmbined analyses were cnducted with and withut the genus, and it made n difference in the results. The remaining 125 sequences are newly reprted; the Appendix cntains a list f vuchers and the GenBank numbers fr all sequences. All plant tissue was cllected in the field and stred in silica gel, sampled frm herbarium specimens, r freshly cllected. DNA amplificatin, sequencing, and analysis. DNA extractins were perfrmed using a Qiagen DNeasy Plant Mini Kit fllwing the instructins supplied but with an extended incubatin perid (up t 40 minutes) fr herbarium material. Primer ITS5A (Dwnie & Katz-Dwnie, 1996), based n White & al.'s (1990) fungal primer ITS5 and crrected at tw psitins fr angisperms, was substituted fr ITS5 in this study. All primer sequences are given in Table 2. Primers used t amplify and sequence the trnl-f and dwnstream trnl-f spacer regin f cpdna were designed by Taberlet & al. 641

6 Funk & al. Evlutin f the tribe Arctteae TAXON 53 (3) August 2004: (1991), and thse used fr the 3' end f the ndhf regin were designed by Jansen (1992). Fr the PCR amplificatin reactins, each 25 til PCR reactin ccktail cntained 12.9 til f sterile water, 2.5 LII f lox PCR reactin buffer A (Prmega), 2 ill f 20 mm dntps (Pharmacia) in an equimlar rati, 2.5 LII f 25 mm magnesium chlride, 0.5 LII f 10 mg/lil Bvine Serum Albumin (Sigma), 1 pi f a 10 iim cncentratin each f the frward and reverse primer, 0.1 LII f Taq DNA plymerase enzyme (5 units/pl frm Prmega), and 2.5 til f sample DNA. The amunt f template DNA was adjusted when necessary t generate sufficient PCR prducts fr DNA sequencing. The amplificatin reactins were cnducted using thin-walled 0.2 ml PCR reactin tubes in a GeneAmp PCR System 9700 (Perkin Elmer). The PCR prgram cnsisted f an initial preheating at 94 C fr 2 minutes. Then, the first reactin cycle prceeded as fllws: 1 minute at 94 C t denature the template DNA, fllwed by 1 minute at 48 C (54 C fr cpdna) t allw primer annealing and 45 secnds at 72 C fr primer extensin. Primer extensin time was increased by 4 secnds (7 secnds fr cpdna) fr each subsequent reactin cycle. After a ttal f 40 reactin cycles, an additinal 7 minute extensin at 72 C was allwed fr cmpletin f unfinished DNA strands. All PCR prducts were quantified by agarse gel electrphresis with cmparisn f an aliqut f prducts with a knwn quantity f a 100 bp DNA ladder (GeneChice; visualized with ethidium brmide). The remainder was stred at 4 C until utilized. PCR prducts used fr sequencing were first purified fr sequencing using an enzymatic PCR prduct presequencing kit (USB). This prcedure invlved mixing 8 LII f the PCR prduct with 1 LII f each enzyme frm the kit and then incubating the mixture first at 37 C fr 30 min, t degrade excess primers and dntps, and then raising the temperature t 80 C fr 15 minutes, t denature the enzymes themselves. This methd f purificatin withut lss f PCR prducts (n filtratin, precipitatin, r washes are necessary) is especially imprtant fr DNA extracted frm herbarium vuchers, which is smetimes nly weakly amplified and yields barely sufficient PCR prduct fr sequencing. Table 2. Primer sequences used fr PCR and cycle sequencing. Name Sequence (5' t 3') ITS5A GGAAGGAGAAGTCGTAACAAGG ITS4 TCC TCC GCT TAT TGA TAT GC trnl C CGA AAT CGG TAG ACG CTA CG trnl F ATT TGA ACT GGT GAC ACG AG ndhf 1603 CCT YAT GAA TCG GAC AAT ACT ATG C ndhf +607 ACC AAG TTC AAT GYT AGC GAG ATT AGT C The cycle sequencing reactins were dne using 96 well micrplates in a PTC-100 thermal cycler (MJ Research). Each ne-eighth cycle sequencing reactin ccktail cntains ng f the purified PCR prduct, 2 pi f a 1 mm cncentratin f the sequencing primer, 0.6 pi f a 5x reactin buffer (400 mm Tris HC1, 10 mm magnesium chlride at ph 9.0), and 1 LII f the reagent pre-mix frm the BigOye (Versin 2/3) dye terminatr cycle sequencing pre-mix kit (Applied Bisystems). The cycle sequencing prgram cnsisted f an initial preheating at 96 C fr 30 secnds. Then, the first reactin cycle prceeded as fllws: 10 secnds at 92 C t denature the template DNA, fllwed by 15 secnds at 55 C t allw primer annealing and 4 minutes at 60 C fr primer extensin. Unincrprated dye terminatrs were remved by Sephadex (Sigma) gel filtratin using MultiScreen plates (Millipre). The purified cycle sequencing prducts were then reslved by electrphresis n a 5% plyacrylamide (MJ Research Kilbasepack) gel using a BaseStatin 51 autmated DNA sequencer (MJ Research). Sequences frm bth strands f each PCR prduct were examined, cmpared, and crrected using Sequence Navigatr sftware (Applied Bisystems). All trnl-f, ndhf, and ITS sequences were aligned visually, with the insertin f gaps where necessary. There were five unambiguus insertins and deletins, mainly in the trnl-f data set. Three deletins and ne insertin supprted all r part f the Gazania-Grteria- Hirpicium clade. The remaining deletin (ndhf) was fund in all f the ingrup and first set f utgrups (Cichriideae s.s.) but nt in the secnd set f utgrup taxa. The taxn grups that these indels supprted ccurred in the phylgenies withut cding the indels (see Results), s it did nt seem necessary t separately cde the indels. Maximum parsimny analysis and parsimny btstrap analysis (with 1000 replicate runs, each with 10 randm taxn additins, TBR branch swapping, and MULPARS in effect) f the aligned trnl-f, ndhf, and ITS sequences were perfrmed (with and withut the utgrups) fr each regin and fr the cpdna data and the cmbined data sets via full heuristic searches with PAUP* (Swffrd, 2002). N weighting was used. Maximum parsimny analysis using a branch-and-bund search was als perfrmed with a reduced dataset f 17 ingrup and three utgrup taxa selected frm previus results. The btstrap runs emplyed 1000 replicates with branch-and-bund searches. The likelihd rati tests were dne using the "Tree Scres" functin in PAUP* under the likelihd criterin, the Hasegawa- Kishin-Yan mdel f sequence evlutin (Hasegawa & al., 1985), and a gamma distributin f rate variatin amng sites (with the shape parameter estimated and with fur rate categries). The likelihd and the bt- 642

7 TAXON 53 (3) August 2004: Funk & al. Evlutin f the tribe Arctteae strap analyses were used n each mlecular regin separately, the tw chlrplast regins cmbined, and all three regins cmbined. I RESULTS A number f full heuristic searches were run using varius utgrups and adding and subtracting members f the ingrup. These initial runs cntained all taxa and all utgrups. These runs prduced thusands f equally parsimnius trees, but they cnsistently shwed several things. The cre elements f tw subtribes frmed strngly supprted clades, Arcttineae (ARCT) and (GORT), and within there are three grups, the Didelta-Berkheya clade (Did), Berkheya-Cullumia clade (Ber), and the Gazania- Grteria-Hirpicium clade (Gaz). Berkheya appears t be paraphyletic and Hirpicium and Haplcarpha are mst likely paraphyletic as well. The 10 utgrup taxa frm the first set f utgrups (Appendix 1) cnsistently divided int tw clades, Liabeae and Vernnieae (LIA- VER) and Gundelieae and Lactuceae (GUN-LAC). Hwever, the placement f sme f the prblem taxa, as well as the relatinships f the utgrups t the clades within the ingrup and t ne anther, was unreslved. An examinatin f many f the equally parsimnius trees shwed that mst f the alternative trees were the result f clsely related taxa changing psitins. In rder t elucidate relatinships amng the prblem taxa, utgrup taxa, and cre subtribes, sme taxa were pruned frm the dataset. Fr instance, in the full dataset there were eight samples f Arcttis, 18 f Berkheya, nine f Gazania, and nine f Hirpicium and all f these were nt pertinent t the gals f this study. In rder t decide which taxa t remve frm this prtin f the study, we ran the data withut utgrups. The resulting unrted phylgrams allwed us t select taxa fr remval that had similar psitins, and s there was n lss f relatinships within r amng genera. Taxa were selected s as t keep the basic structure f the unrted phylgram, e.g., all ptentially paraphyletic grups were maintained and members f the cre subtribes were arranged in the same manner. Because all f the members f each genus indicated t be paraphyletic were cntained within a single subtribe, the fact that they are paraphyletic des nt affect the questins being asked in this study. After pruning the database there were 28 ingrup samples. The analyses were then re-run using the pruned data set t cnfirm t the verall branching structure. Figure 2 shws an unrted phylgram with labels n the majr grups plus abbreviatins that will be used in mst figures; the remaining prblem taxa and utgrups are nt included. The basic shape f Fig. 2 was taken frm GaZ Gazania 62 Gazania 59 Gazania 64 Hirpicium 86 Grteria 69 GORT Grteria 73 Hirpicium 25 Hirpicium 87 ARCT Arcttis 14v Haplcarpha 77 Ber Cymbntus 45 v Arcttis C Berkheya 18 Berkheya Cullumia 37 Cullumia 39 Arcttheca 95 Dymndia 53 Dideita 51 Didelta 50 Berkheya 24 Heterrhachis 84 Fig. 2. An unrted phylgram f Arctteae shwing the lcatin f the tw main subtribes, (ARCT), (GORT), and the three clades f the latter: Gazania-Grteria-Hirpicium (Gaz), Berkheya-Cullumia (Ber), and Didelta (Did). N utgrups r prblem taxa were included. The basic shape was taken frm the results f the cmbined analysis. results f the cmbined analysis. In all analyses cnducted fr this study, sme f the taxa in which we were interested are clearly placed (Fig. 2; n matter what utgrup is used t rt this diagram it always attaches smewhere alng the lng branch between the tw subtribes, thus allwing use f the mnphyletic subtribes in an unrted diagram). Heterrhachis was cnsistently part f the Berkheya- Cullumia clade (Ber) f the subtribe, Haplcarpha was at the base f the subtribe Arcttineae (ARCT), and Cymbntus, the Australian genus, was always part f Arcttineae. In additin, in the analyses cntaining utgrups, Gundelia was always the sister grup f Lactuceae and was, therefre, maintained as part f the utgrup fr the rest f the study. The mrphlgically interesting taxa, Cuspidia and Heterrhachis, are always fund in the Berkheya- Cullumia clade and Didelta is in the Didelta-Berkheya clade; bth clades are in the subtribe. Because they were stable in their placements, they are cnsidered part f ne f the main subtribes and their lcatin is nt discussed further. Hwever, the psitins f the three ther taxa f interest, the tribe Eremthamneae (Eremthamnus and Hplphyllum), and the genera Heterlepis and Platycarpha, were nt clear nr was their relatinship t the tw cre subtribes r t the utgrups cnsistent. The psitin f these three prblem taxa was, therefre, a cncern fr the remainder Did 643

8 Funk & al. Evlutin f the tribe Arctteae TAXON 53 (3) August 2004: f the analysis. trnl-f. Data were available fr all taxa except Eremthamnus (Appendix), resulting in the use f 27 ingrup taxa and 16 utgrup taxa. In an effrt t determine the basic ingrup patterns, the pruned dataset was analyzed withut utgrups and excluding the three remaining prblem taxa (Eremthamneae, Heterlepis, and Platycarpha). This resulted in an analysis with 35 "parsimny infrmative" characters (pi) which prduced 72 trees (L = 84, CI = 0.893, RI = 0.936). The three prblem taxa were then added t the same analysis and ne f the unrted phylgrams is shwn in Fig. 3 (547 trees, L= 109, pi = 38, CI = 0.881, RI = 0.914). All three prblem taxa were n lng branches and very nearly in the same lcatin. When ne f the utgrups, the Liabeae-Vernnieae clade (LIA-VER), was added t the analysis, it frmed a 1 change Het, UIN-LMO i» Did GORT Ber LIA-VER LIA- VER Ere Gaz GUN- Pla Did LAC Fig. 3. Unrted phylgram frm trnl-f data analyzed with prblem taxa but withut utgrups. The arrws indicate placement f the tw utgrup clades, Gundelieae-Lactuceae (GUN-LAC) and Liabeae- Vernnieae (LIA-VER) when they are added t the analysis singularly. Nte that the placement f Platycarpha changes frm psitin "1" when the utgrup is LIA-VER t psitin "2" when the utgrup is GUN-LAC. The * indicates a branch that cllapsed in the unrted strict cnsensus tree (547 trees, L = 109, pi = 38, CI = 0.881, RI = 0.914). The lwer diagram is a btstrap cnsensus tree reduced t shw the main grups. plytmy with Eremthamneae, Platycarpha and Heterlepis. When the ther utgrup clade, the Gundelieae-Lactuceae clade (GUN-LAC), was added it als attached at the same nde, hwever Platycarpha changed its psitin and became the sister taxn f Heterlepis. When any single prblem taxn r utgrup clade was added t the analysis, it attached at r near the same lcatin; when the taxa were cmbined, it resulted in hundreds f trees with varying placement f the taxa in questin. The maximum likelihd tree fr the trnl-f data (scre f single best tree fund = ) supprted mnphyly f the tw main subtribes and f the tw utgrup clades, but the psitin f the tw utgrup clades and the prblem taxa remained unreslved, and Arctteae were nt indicated t be mnphyletic. The btstrap cnsensus tree, shwn in a reduced frm at the bttm f Fig. 3, is fr an analysis with all prblem taxa and bth utgrup clades. Nte the weak supprt fr the placement f the prblem taxa and utgrups. ndhf. There were n ndhf data fr Heterrhachis and fr ne f the Grteria species {Grteria 69) s they were nt included in these analyses. There were ndhf data available fr Eremthamnus, s the taxn was added fr a ttal f 26 ingrup samples; all 10 utgrup samples were included (Appendix). When examined withut utgrups r prblem taxa, the ndhf data set yielded 996 trees (pi = 42, L = 95, CI = 0.821, RI = 0.906). It had the same basic structure as the unrted phylgram frm the trnl-f sequence data. When all three prblem taxa were analyzed tgether (6029 trees, L = 122, pi = 47, CI = 0.803, RI = 0.879) the resulting placement f the taxa put Platycarpha clser t, Eremthamneae clser t Arcttineae and Heterlepis between the tw (Fig. 4). The tw utgrup clades were added separately and their placement is indicated by the arrws n Fig. 4. The Liabeae- Vernnieae clade is placed clser t Platycarpha and, and the Gundelieae-Lactuceae clade is clser t Arcttineae; Heterlepis is between the tw. The maximum likelihd tree fr ndhf (scre f single best tree fund = ) supprted the mnphyly f the tw main subtribes and f the tw utgrup clades, but the psitin f the utgrups and the prblem taxa remained unreslved. The Arctteae culd be mnphyletic if they included Eremthamneae but nt Platycarpha r Heterlepis. The btstrap cnsensus tree, shwn at the bttm f Fig. 4, is fr an analysis with all prblem taxa and bth utgrup clades; it shws weak supprt fr the placement f Eremthamneae, and it has an unreslved cluster at the center f the diagram. Cmbined chlrplast dataset. Neither f the chlrplast datasets had sufficient infrmatin t fully reslve the trees. Hwever, the tw datasets can be cmbined t prduce a larger number f characters that 644

9 TAXON 53 (3) August 2004: Funk & al. Evlutin f the tribe Arctteae 1 change ARCT GUN-LAC LIA-VER r 100 \/ \ E 75 Eremthamneae was sister t Arcttineae. In either explanatin, the tribe Arctteae culd nt be made mnphyletic. Hwever, when the data were analyzed with utgrups but withut the three prblem taxa, the tribe Arctteae was mnphyletic (36 trees, L = 379, pi = 128, CI = 0.815, RI = 0.862). The btstrap cnsensus diagram fr the chlrplast data with all prblem taxa and the tw utgrups is shwn at the base f Fig. 5. ITS. Nuclear sequence data were gathered fr all ingrup taxa except Eremthamnus (28 taxa) and all 10 utgrup taxa. The initial analysis, withut utgrups r prblem taxa, prduced fur trees (4 trees, L = 546, pi = 179, CI = 0.663, RI = 0.809), and in all fur the three prblem taxa attach, when analyzed separately, between the tw subtribes as in the chlrplast sequences. Figure 7 illustrates ne f the three unrted phylgrams prduced when all three prblem taxa are included withut the utgrup clades (3 trees, L = 729, pi =196, CI = 0.595, RI = 0.741). Nte that while Platycarpha remains between the tw subtribes, Heterlepis and Fig. 4. The upper diagram is an unrted phylgram frm ndhf data with prblem taxa and withut utgrups. The arrws indicate placement f the utgrups when they are added t the analysis singularly. The * indicates branches that cllapse in the unrted strict cnsensus tree (6029 trees, L = 122, pi = 47, Cl = 0.803, Rl = 0.879). The lwer diagram is a btstrap cnsensus tree reduced t shw the main grups. GUN-LAC may shed light n the unreslved and cnflicting areas f the trees as well as the utgrup placement. As with bth trnl-f and ndhf data, all three prblem taxa attached between the tw subtribes (Figs. 3, 4). When the utgrup taxa were added separately, the Liabeae- Vernnieae clade cnnected at the base f the Platycarpha and Heterlepis clade, and the Gundelieae- Lactuceae gruped with Eremthamneae becming the sistergrup f. Overall, the Gundelieae- Lactuceae clade was clser t Eremthamneae and and Liabeae-Vernnieae t Heterlepis and. When bth utgrup clades were added t the analysis at the same time, tw very different basal tplgies resulted depending n which utgrup was used t rt the tree (Figs. 5, 6; 108 trees, L = 429, pi = 135, CI =.804, RI =.844). When the tree was rted n Gundelieae-Lactuceae, the Liabeae-Vernnieae clade was nested in the ingrup, sister t alng with Heterlepis and Platycarpha (Fig. 5). When the Liabeae-Vernnieae clade was used as the rt, Heterlepis frmed a trichtmy at the base f the tree and Gundelieae-Lactuceae was sister t the Arcttineae- Eremthamneae clade (Fig. 6). In bth figures, Platycarpha was the sister grup f and Het GUN- Fig. 5. The upper diagram is a strict cnsensus tree frm the chlrplast data (trnl-f and ndhf) with bth utgrup clades and all three prblem taxa rted n the Gundelieae-Lactuceae clade (108 trees, L = 429, pi = 135, CI = 0.804, RI = 0.844). The lwer diagram is a btstrap cnsensus tree reduced t shw the main grups. 645

10 Funk & al. Evlutin f the tribe Arctteae TAXON 53 (3) August 2004: LIA-VER GUN-LAC ) supprted the mnphyly f the tw main subtribes and f the tw utgrup clades, but the psitin f the utgrups remained prblematic. Platycarpha is sister t Liabeae-Vernnieae, and a weak clade f Heterlepis and Hplphyllum is sister t. Arctteae are nt mnphyletic, with Gundelieae- Lactuceae clser t and Liabeae-Vernnieae clser t, depending n the rting. Cmbined data analysis f all sequences. All 28 ingrup taxa and 10 utgrup taxa were used fr the cmbined data analysis {trnl-f, ndhf, ITS). Figure 2 is an unrted phylgram fr the cmbined dataset (withut prblem taxa and utgrups), and the tw main subtribes and the three clades within are distinct. When the prblem taxa were added (2 trees, L = 976, pi = 281, CI = 0.644, RI = 0.767), they were spread ut alng the branch that separates the tw subtribes. The psitin f each utgrup clade was examined individually and the Liabeae-Vernnieae clade was Fig. 6. A strict cnsensus tree frm the chlrplast data {trnl-f and ndhf) with bth utgrup clades and all three prblem taxa rted n the Liabeae-Vernnieae clade. [108 trees, L = 429, pi = 135, Cl = 0.804, Rl = 0.844] 10 changes Pla. ARCT Eremthamneae are sister t ne anther and are nested within. The psitin f the utgrups (if added separately) is indicated with arrws (Fig. 7). The rted trees that were run with bth utgrups included at the same time shwed the utcme f rting with ne utgrup r the ther (Figs. 8, 9; 2 trees, L = 1443, pi = 314, CI = 0.463, RI = 0.628). In Fig. 8, when the tree was rted with the Liabeae-Vernnieae clade, Platycarpha was basal fllwed by mnphyletic Arcttineae, while the Gundelieae-Lactuceae clade was between Arcttineae and. When the same unrted phylgram was rted n the Gundelieae- Lactuceae clade (Fig. 9), Platycarpha became sister t Liabeae-Vernnieae and the tw tgether were then sister t Arcttineae. The clade (including the Eremthamneae and Heterlepis) was the same with either rting f the tree. Nte that in the analysis f the nuclear DNA data, Platycarpha was mst clsely related t either the Liabeae-Vernnieae clade r Arcttineae, while in the chlrplast DNA it was clser t. The results f the btstrap cnsensus analysis invlving all prblem taxa and bth utgrup clades is shwn at the base f Fig. 7; nte the psitin f the Gazania-Grteria-Hirpicium clade in the unreslved center f the diagram. The maximum likelihd tree fr the ITS data (scre f single best tree fund = LIA-VER Gaz GORT Did Pla ^r\\ LIA- VER *Ber Gaz Ere Het GUN- LAC GUN-LAC 8 Di Ere Het Fig. 7. The upper diagram is an unrted phylgram frm ITS data with prblem taxa but withut utgrups. The arrws indicate placement f the utgrups when they are added t the analysis singularly. The * indicates branches that cllapse in the strict cnsensus tree (3 trees, L = 729, pi = 196, CI = 0.595, RI = 0.741). The lwer diagram is a btstrap cnsensus tree reduced t shw the main grups. 646

11 TAXON 53 (3) August 2004: Funk & al. Evlutin f the tribe Arctteae LIA-VER GUN-LAC LIA-VER GUN-LAC 10 changes Fig. 8. A phylgram frm the ITS data with prblem taxa and utgrups, rted with Liabeae-Vernnieae (LIA- VER). The ther utgrup (GUN-LAC) is sister t the subtribe. Fig. 9. A phylgram frm ITS data with prblem taxa and utgrups, rted with Gundelieae-Lactuceae. The ther utgrup (LIA-VER), alng with Platycarpha, is sister t the subtribe. always the sister grup f Platycarpha; hwever the Gundelieae-Lactuceae clade attached in five different places. When the tw utgrups were analyzed tgether, a fur-branched plytmy resulted with the tw utgrup clades, the subtribe Arcttineae, and n a shrt branch the remainder f the ingrup (Fig. 10; 8 trees, L = 1850, pi = 441, CI = 0.530, RI = 0.665). The btstrap cnsensus analysis f the same dataset prduced the diagram shwn at the bttm f Fig. 10. This analysis was, as usual, less reslved than the parsimny analysis s it lacks the branch between the Ere-Het-GORT clade and the rest f the taxa. Since the psitin f the Liabeae- Vernnieae clade was unambiguus in the parsimny analysis, ne culd argue that it wuld make a "better" utgrup and rt the tree using that clade. In such an analysis, Arctteae (including Heterlepis and Eremthamneae but excluding Platycarpha) are mnphyletic. Anther alternative, and the ne used here, was t gather sequence data frm additinal taxa that were utside the subfamily Cichriideae. Prir attempts t use these taxa in this study had failed because with trnl-f and ndhf data there were t few characters t reslve the tree, and with the ITS sme f the new utgrups were s different that the results were ambiguus. Hwever, with the cmbined dataset there was a sufficiently large number f "parsimny infrmative" characters, shrter branches, and mre reliable results making the inclusin f these utside taxa pssible. The additinal utgrups (Appendix 1) included tw taxa frm the subfamily Barnadesiideae (Barnadesia and Dasyphyllum), the basal branch in the family, alng with tw species f African Mutisieae (Gerbera), and tw species f Cardueae (thistles; Carthamus and Cirsium). Data frm ndhf and trnl-f were cllected fr all six taxa and ITS data frm five (minus Dasyphyllum) fr a ttal f 17 additinal sequences. All f these taxa are lcated relatively clse t the base f the family. The trnl-f and the ndhf f these six additinal taxa aligned relatively easily, but the ITS sequences were aligned with less cnfidence. Frtunately, the ambiguus areas were cnfined t tw places in the data matrix, and the data culd be analyzed with and withut these tw areas. Figure 11 shws ne f tw trees prduced by the cmbined dataset {trnl-f, ndhf and ITS) f all taxa 647

12 Funk & al. Evlutin f the tribe Arctteae TAXON 53 (3) August 2004: Hespermannia 1 LIA-VER \Gymanthemum K11 10 changes ARCT Gundelia 96 Cichrium 136 GUN-LAC Hypchaehs 33 Lactuca 133 Berkheya 18 Cullumia 37 erkheya 99 Cullumia 39 Heterrhachis 84 Berkheya 31 Cuspidia 104 Hirpicium 87 Hirpicium 25 Grteria 73 ^. Gazania 64 'Grteria 69 Gazania 62 x^ Gazania 59 Hirpicium 86 Ber Fig. 10. The upper diagram is an unrted phylgram frm the cmbined data set (trnl-f, ndhf, ITS), with prblem taxa and utgrup clades. The * indicates branches that cllapse in the strict cnsensus tree (8 trees, L = 1850, pi = 441, Cl = 0.530, Rl = 0.665). The lwer diagram is a btstrap cnsensus tree reduced t shw the main grups. including the secnd set f utgrups (L = 2345, pi = 516, CI = 498, RI = 0.638). The tw trees differed nly in a minr change in the psitin f ne species f Cullumia. The Gundelieae-Lactuceae clade is mre distant frm Arctteae than the Liabeae-Vernnieae clade. Platycarpha is basal t the Liabeae-Vernnieae clade and cannt be cnsidered part f Arctteae. Within mnphyletic Arctteae there are several clades: the subtribe Arcttineae, the genus Heterlepis, the tribe Eremthamneae, and the subtribe. Furthermre, can be brken up int three clades: the Gazania-Grteria-Hirpicium clade, the Didelta-Berkheya clade and the Berkheya-Cullumia clade. The same result was als btained using just Mutisieae and Cardueae as utgrups r Cardueae r Mutisieae alne. The btstrap values are listed n the branches; nte that althugh there is gd supprt fr nearly all the branches (all but tw critical ndes have supprt f 72% r higher), the supprt fr Arctteae is less than 50%. Likewise there is little supprt fr the gruping f Eremthamneae and Heterlepis r fr these tw taxa gruping with the subtribe. If the data are analyzed withut the three prblem taxa, the supprt fr mnphyly f Arctteae is 72%. The maximum likelihd tree f the ingrup rted n Platycarpha has mnphyletic Arcttineae and mnphyletic with Eremthamneae and Heterlepis between the tw subtribes (scre ). The maximum likelihd tree f the ingrup with the Liabeae-Vernnieae clade as the utgrup gave the same tree except that, because the tree was rted with the Liabeae-Vernnieae clade, Platycarpha was basal t this clade; Fig. 11 (scre ). Table 3 gives the size f the aligned matrices, the number f gaps added in rder t align the sequences, the number f infrmative characters, and the percent f sequence divergence (calculated using PAUP 4.0*) fr all three regins. When applicable, the figures were calculated fr bth the ingrup alne and fr the ingrup plus the utgrup. This table shws that the percent sequence divergence is lw in the cpdna ( % fr trnl-f and % fr ndhf) and higher in the ITS sequences ( %). Hwever, nne f the divergence percentages were alarmingly high. Of mre cn- 648

13 TAXON 53 (3) August 2004: Funk & al. Evlutin f the tribe Arctteae d 100 c changes Dasyphyllum 465 BAR Barnadesia K79 I Gerbera 75 MUT Gerbera 134 Carthamus 117 CAR Cirsium 118 Gundelia 96 GUN 100 Warinia 100 Cichhum Hypchaeris 33 Lactuca Platycarpha 91 LAC 1001 Gymanthemum K11 92 ' Hespermannia 1 Oligactis Munnzia K39 LIA Philglssa 120 Haplcarpha Dymndia Cymbntus 45 ARCT 54 Arcttheca 95 Arcttis :^ Arcttis 14 - Heterlepis 82 Hplphyllum 109 Eremthamnus GB Hirpicium 87 Q az Gazania 64 99T Ga; Gazania 59 Gazania 62 Hirpicium H j Hirpicium rq_j Grteria 69 ^- Grteria l Berkheya 24 [i D/de/te 50 Did 66 I T D/'cte/fa 51 - Cuspidia Berkheya 18 Berkheya 31 Heterrhachis r Berkheya Cullumia Cullumia 39 Ber GORT ARC VER Fig. 11. Phylgram with all taxa frm the cmbined data set (trnl-f, ndhf, ITS). The tribe Arctteae is mnphyletic, the subtribes Arcttineae and are mnphyletic; tw prblem taxa, the genus Heterlepis and the tribe Eremthamneae, are weakly gruped tgether and are sister t. The clsest utgrup is the Liabeae- Vernnieae clade and the prblem genus Platycarpha. The btstrap values are listed n the branches; nte that althugh there is gd supprt fr nearly all the branches, the supprt fr Arctteae is less than 50%. cern is the number f infrmative characters, which reaches 50% fr ITS data in the cmbined analysis (with all utgrups). The cpdna scres reach as high as 8.6% fr the trnl-f and as high as 15% fr the ndhf (cmbined analysis using all utgrups). The alignment prblems in the ITS were cnfined t tw areas, psitins (ITS 1) and psitins (ITS 2). As an experiment, these tw areas were replaced with questin marks fr all f the utgrups and the three prblem taxa. All f the analyses were rerun, including the additin and subtractin f all utgrups and prblem taxa. The nly real difference between the final figure (cmbined analyses) fr this altered dataset and Fig. 11 is a slight change in the btstrap values fr sme ndes and the fact that 649

14 Funk & al. Evlutin f the tribe Arctteae TAXON 53 (3) August 2004: Table 3. Size f aligned matrices, number f gaps added, number f infrmative characters, and percent sequence divergence fr trnl-f, ndhf, and ITS. Figures usually given fr bth "nly the ingrup" and fr "ingrup plus all f the utgrups"; single utliers have been remved. Regins Size f aligned # f gaps added # f infrmative characters % sequence divergence matrices (ingrup/utgru P) (ingrup/utgrup) (ingrup/utgrup) trnl-f / / / ndhf / / / ITS / / / Ttal 2275 ca. 113/ca /526 n/a Heterlepis mves t a psitin as the sister taxn t subtribe Arcttineae. Since the psitin f Heterlepis in Fig. 11 r in the new analyses is nt supprted by either high btstrap values r the maximum likelihd analysis, this shifting f psitins is nt surprising. I DISCUSSION Mlecular data. The final phylgeny (Fig. 11) supprts three ut f fur f the previusly described subtribes f Arctteae:,, and Eremthamninae; the remaining subtribe, Gundeliinae, was previusly elevated t tribal level and is here cnfirmed as the sister grup f Lactuceae. It is clear that Haplcarpha and Cymbntus belng in Arcttineae, and Heterrhachis, Cuspidia, and Didelta in. Hwever, t achieve mnphyly in Arctteae, Platycarpha must be remved frm the tribe. Over the years this genus has been in the tribes Mutisieae and Cardueae as well as Arctteae, and in the mst recent classificatin it was "unassigned t tribe" (Bremer, 1994). Of any existing tribes it may be the clsest t the Liabeae- Vernnieae clade. Hwever, final placement f this genus must await the additin f several taxa which may be near the base f the Liabeae-Vernnieae clade. The phylgeny frm the cmbined analysis (Fig. 11) is a majr step frward in understanding relatinships amng taxa within Arctteae, specifically the cmpsitin f the subtribes, and within subfamily Cichriideae s.s., particularly the sistergrup f Arctteae, and placement f Eremthamneae. The extensive analyses have als prvided insights int affinities f taxa f Arctteae that are nt expressed in the final figure. Fr instance, when any f the three DNA regins were examined alne r in cmbinatin, but withut any f the prblem taxa, the results were similar: the tw main subtribes were mnphyletic, the tw utgrup clades were mnphyletic, and either Arctteae was mnphyletic r the relatinship amng the fur clades (tw utgrups and tw subtribes) was unreslved. The clades always have the same cmpsitin, hwever, and there is little if any cnflict; it is just a prblem f reslutin. Hwever, when the prblem taxa were added, changes ccurred. In results f the analysis using chlrplast data, Platycarpha was the sister grup f, Eremthamneae was the sister grup f and Heterlepis was near the Liabeae-Vernnieae clade, but its exact psitin was unreslved (Figs. 5, 6). In ITS results, Platycarpha was clser t the Liabeae- Vernnieae clade, which in turn was clser t Arcttineae while Heterlepis and Eremthamneae were inside (Figs. 8, 9). This presents a nearly cmplete reversal f their previus psitins. The cmbined analysis prduced results that were smewhere in the middle, with Platycarpha sister t Liabeae-Vernnieae (as in the ITS tree), Arctteae and its tw main subtribes ( and ) mnphyletic; Heterlepis and Eremthamneae were between the tw subtribes and the sister grup f. It is nt unusual fr there t be sme discrdance f chlrplast and nuclear DNA (e.g., Y & al., 2002), and it is usually attributed t the pssibility f hybridizatin. Fllwing that reasning, the prblem taxa culd have such a histry. Chrmsme numbers might be useful in searching fr hybrids but they are nt available fr mst taxa in this analysis. Fr seed plants it has been shwn that inadequate taxn sampling can be respnsible fr cnflicting results (Rydin & Kallersj, 2002), but that is mst likely nt the prblem with this study because the taxa remved frm the analysis were very similar in their mlecular characters t nes that were retained in the study. Fr nw it seems best t keep Heterlepis and Eremthamneae in Arctteae but ut f either f the main subtribes. Taxa within each f the tw subtribes are clsely related, as evidenced by the shrt branch lengths that are usually fund within them. Hwever, the prblem taxa and utgrups have much lnger branches and a few f the branches have weak r n supprt frm btstrap analysis (Fig. 11). It is pssible that there has been a relatively recent radiatin within the tw subtribes and that the utgrups and prblem taxa represent ld lineages that have been separated fr a lng time. Mrphlgy. Based n the literature (Cassini, 1816, 1828; Rbinsn & Brettell, 1973a; Nrlindh, 1977; Rbinsn, 1992, 1994; Bremer, 1994; Herman & al., 2000) and persnal bservatin, the mrphlgy can be examined in light f the phylgeny (Fig. 11). 650

15 TAXON 53 (3) August 2004: Funk & al. Evlutin f the tribe Arctteae Fig. 12. Phtgraphs f several heads and habits f Arctteae. A, Didelta; B, Arcttis; C, Cullumia; D, Hirpicium; E, Gazania; F, Berkheya; G, Didelta; H, Arcttis; I, Grteria; J, Berkheya. All phts by V. Funk. Phtgraphs f several members f the tribe are fund in Figs. 1 and 12. The members f the subtribe (Arcttis, Arcttheca, Cymbntus, Dymndia and Haplcarpha; Figs. IB, C, 12B, H) can be characterized as fllws: they d nt prduce latex; their invlucral bracts are nt fused (ne species f Arcttheca and tw f Haplcarpha have a tendency tward fusin), the utermst bracts are fliaceus and have a scarius apical lamina and the receptacle is smth r shallwly arelate-alvelate; the ligulate flrets have 4 veins and 3- lbes when lbes are present (similar t the tribe Liabeae and the subfamily Asterideae), and they are fertile (except fr Arcttheca); the central flrets have shallw- 651

16 Funk & al. Evlutin f the tribe Arctteae TAXON 53 (3) August 2004: ly lbed crllas, the anthers are nt tailed (except fr Arcttis the largest genus f the subtribe), and the style has a swllen prtin belw the branch pint smetimes with a ring f hairs; the achenes have 3-5 drsal, welldevelped ribs r wings. Many f the members f this subtribe are rsette-frming, perennial herbs (Fig. 12H). Mst f these characters wuld be cnsidered plesimrphic except fr the swllen prtin f the style with the ring f sweeping hairs (als fund in sme thistles) and the 3-5 well-develped ribs r wings n the achenes. The lack f latex is mst likely apmrphic, but it cmes and ges s ften in the subfamily that it is difficult t use at this level. The members f the subtribe (Berkheya, Cullumia, Cuspidia, Didelta, Gazania, Grteria, Heterrhachis, and Hirpicium; Figs. 1A, D, E, 12A, C-G, I, J) are better defined as fllws: they have laticifers (the cells that nrmally cntain latex), and latex is present in Gazania, sme Berkheya and pssibly thers; invlucral bracts are cnnate at least at the base (Fig. 12E), r in varius degrees upwards, frming a cup; receptacles are mre r less deeply alvelate and enclsing at least the base f the achenes, the apex f the ray flrets ften have 5 veins and 4 lbes when lbes are present, but it can vary frm 2-5 lbes in sme taxa; the rays are sterile, the central flrets are deeply lbed (Figs. 1A and D), the anthers are sagittate but nt tailed, and the previusly mentined cnspicuus swllen prtin f styles is either nt present r nt well-develped; the achenes are withut well-develped ribs r wings. Figure 11 shws the three clades f this subtribe: the Gazania- Hirpicium-Grteria clade cmprises annual r perennial herbs with strngly fused invlucral bracts (Fig. 12E), the Berkheya-Cullumia clade cmprises a mixture f subshrubs, shrubs, and annual and perennial herbs that are usually spiny in sme manner (Figs. ID, 12C, F, J), and the Didelta-Berkheya clade cnsists f subshrubs r shrubs with the Didelta members having heads that break apart (Figs. 1 A, 12A, G). Members f bth the Berkheya- Cullumia and the Didelta-Berkheya clades have partially fused invlucral bracts. The apmrphic characters fr this subtribe include the cnnate invlucres, deeply alvelate receptacles, and 4-lbed and 5-veined sterile rays. All three prblem taxa have sets f characters that make it difficult t place them in either f the subtribes. The genus Platycarpha (three species) is a perennial herb cnfined t suthern Africa. The heads are discid and have nly a few flrets, which are purple, and these small heads are aggregated int a secndary head that is large and sessile, lying mstly flat n the grund with the leaves spread ut like the spkes f a wheel. The plant is either acaulescent, withut branches, r with subterranean branches. The receptacle has pales (bracts), the anthers either have tails (r are sagittate), and the style has a swelling and a ring f sweeping hairs. The achenes are nly faintly ribbed and the pappus is made up f scales. While Platycarpha has the swllen style and the ring f sweeping hairs f Arcttineae (and sme Cardueae), it des nt have the ther ptential apmrphies f either subtribe, and it has purple flwers and pales which they d nt. Heterlepis (three species) is fund nly in the Western Cape f Suth Africa. It is a small shrub with invlucral bracts smewhat cnnate in 1-3 rws with the uter nes smetimes herbaceus and the inner with membraneus margins. They have tailed anthers and the heads have fertile rays each with 3 lbes and 4 veins. The styles are slender with shrt branches, the apical prtin either is nt r is nly slightly thickened, and it has a ring f sweeping hairs. There are n ribs n the achenes and the pappus is made up f slender "bristle-like" scales. Heterlepis has smewhat cnnate invlucral bracts but nne f the ther apmrphies f. The margins f its invlucral bracts and style are smewhat similar t Arcttineae. The tribe Eremthamneae {Eremthamnus, ne species frm Namibia; Hplphyllum, tw species frm Nrthwest Cape Prvince, Suth Africa) cntains shrubs that are radiate r discid (respectively). When present, the rays are female and fertile with three apical lbes. The anthers have shrt tails and the styles are lng and slender (similar t Vernnieae and sme Liabeae), they have unusual bi- and tri-cellular sweeping hairs but nt the ring f sweeping hairs fund in. There are n distinct ribs n the achenes, and the pappus is capillary. It has nne f the apmrphies f either subtribe althugh its members have spines r thrns n the leaves as d many members f. It is heartening that all three f the prblem taxa (based n mlecular data) have mrphlgical characters that have traditinally made it difficult t place them in either f the tw main subtribes f Arctteae. Platycarpha has a swllen area n the shaft f the style, but it als has discid heads with purple flrets, a paleaceus receptacle, and tailed anthers, characters that are unlike either f the subtribes. Heterlepis has tailed anthers, unlike the tw subtribes, cnnate invlucral bracts as in but withut the deeply alvelate receptacle, the cmmn type f ray flret as in, and an unusual pappus. Finally, members f Eremthamneae have unique hairs n lng, slender styles, and, unlike members f the tw subtribes, they have a capillary pappus and tailed anthers, and Hplphyllum has a discid head. Nne f them have the cnnate invlucral bracts with the deeply alvelate receptacle and the 4-lbed sterile rays f, nr d they have the prminently winged r ribbed achenes. Platycarpha and 652

17 TAXON 53 (3) August 2004: Funk & al. Evlutin f the tribe Arctteae Eremthamneae d nt have the scarius-margined bracts f. Given the mrphlgical and mlecular data, it seems that we can be certain that the tw main subtribes, and, are mnphyletic (as we have defined them) with rbust supprt. The three prblem taxa d nt belng in either f these tw subtribes nr are they clsely related t ne anther. Our data indicate that Eremthamneae and pssibly Heterlepis mst likely belng in Arctteae but that Platycarpha des nt. Of curse, with the inclusin f bth Heterlepis and the tribe Eremthamneae (as a subtribe it wuld be Eremthamninae) the few mrphlgical characters that existed fr the tribe Arctteae have been lst; the scaly pappus, lack f tailed anthers, usually radiate heads, and typical styles are nt fund in ne r bth f these grups. A separate mrphlgical analysis is underway (Karis & Funk, pers. cmm.) that will hpefully shed light n this prblem. The weak supprt fr the tribe is supprted by repeated btstrap analyses, with and withut prblem taxa, which have failed t find strng supprt fr mnphyletic Arctteae. Fr nw, ur cnclusin must be that there are little data (either frm mlecules r mrphlgy) t supprt the mnphyly f Arctteae, and mlecular wrk currently underway in bth Lactuceae and Vernnieae may help in making this determinatin. There are several imprtant lessns learned in this study. First, the prblem taxa are f critical imprtance. It is clear that in the subfamily Cichriideae s.s. unusual and mrphlgically hard t place taxa must be included in any mlecular analysis. Fr instance, in Fig. 2 (all prblem taxa and all utgrups remved), the resulting tree shws that the tw subtribes culd easily be mnphyletic, and if nly ne f the tw utgrup clades were used it wuld present a perfect picture f a mnphyletic Arctteae. If any f the prblem taxa {Heterlepis, Eremthamneae, r Platycarpha) r any f the utgrups are added, they attach between the tw subtribes, and when used ne at a time r in certain cmbinatins f tw, they prduce a clear result. Cmbinatins f tw r mre prblem taxa in cnjunctin with bth main utgrups generates prblems with mnphyly f the tribe. All previus studies invlving a few taxa frm the cre subtribes did nt reveal the prblems in the tribe. Secnd, multiple utgrups must be evaluated in an exhaustive prcess t determine hw the utgrups are behaving and what effect they are having n the ingrup. This is prbably ne f the mst underrated steps in cladistic analyses, and it has great impact n the utcme. One r tw tken representatives will nt suffice unless a thrugh analysis has been dne previus t the study in questin. Finally, unrted phylgrams and unrted strict cnsensus trees give very use- ful results fr analyzing data by freeing the investigatr frm precnceived ntins abut relatinship. We thank the many clleagues wh have sent us material and prvided assistance in the field, particularly Marinda Kekemer (PRE) and Terry Trinder-Smith (BOL), and the varius herbaria wh have either prvided material r laned specimens (F, K, MO, NY, PRE, US). We als thank MJ Research, especially Mark Nrman and Jnathan Schimmel, fr allwing us t use their facilities, Jse Paner fr sending tw unpublished sequences, and K. Peytn, K. Redden, and C. Kellff fr technical assistance. We send a big thank yu t Tm Hllwell fr his help with the graphics. We especially appreciate the funding that was prvided by the Natinal Science Fundatin (DEB t SK), the ffice f the Dean f the Cllege f Natural Sciences, University f Hawaii (t SK), and the Melln Fundatin and Schlarly Studies prgrams f the Smithsnian Institutin's Office f Fellwships and Grants (t VAF). We appreciate the help f Linda Watsn wh gave us advice n the analysis and Per Ola Karis and an annymus reviewer wh prvided cmments n the manuscript and, f curse, the editrs fr their helpful suggestins. LITERATURE CITED Baldwin, B. G., Wessa, B. L. & Paner, J. L Nuclear rdna evidence fr majr lineages f Heleniid Heliantheae (Cmpsitae). Syst. Bt. 27: Beauverd, G. 1915a. Cntributins a 1'etude des Cmpsees X. A. La place des Ursinia parmi les Cmpsees- Tubuliflres. B. Les representants australiens des Arcttidees et leurs rapprts avec les Arcttidenees africaines. Bull. Sc. Bt. Geneve (2 ser.) 7: 21^-0. Beauverd, G. 1915b. Cnspectus generum specierumque Arcttidinearum. Bull. Sc. Bt. Geneve (2 ser.) 7: Bentham, G. 1873a. Ntes n the classificatin, histry and gegraphical distributin f Cmpsitae. J. Linn. Sc, Bt. 13: Bentham, G. 1873b. Cmpsitae. Pp , in: Bentham, G. & Hker, J. D. (eds.), Genera Plantarum, vl. 2(1). Reeve & C., Lndn. Bergqvist, G., Bremer, B. & Bremer, K Chlrplast DNA variatin and the tribal psitin f Eremthamnus (Asteraceae). Taxn 44: Bremer, K Asteraceae: Cladistics and Classificatin. Timber Press, Prtland, Oregn. Cassini, H Arcttidees. Pp in: Cuvier, G. L. (ed.), Dictinnaire des Sciences Naturelles, vl. 2 (Suppl.). Le Nrmant, Paris. Cassini, H Les Arcttidees (Arcttideae). Pp in: Cuvier, G. L. (ed.), Dictinnaire des Sciences Naturelles, vl. 20. Le Nrmant, Paris. Cassini, H Vernniees. Pp in: Cuvier, G. L. (ed.), Dictinnaire des Sciences Naturelles, vl. 57. Le 653

18 Funk & al. Evlutin f the tribe Arctteae TAXON 53 (3) August 2004: Nrmant, Paris. Cassini, H Tableau synptique des Synantherees. Pp in: Cuvier, G. L. (ed.), Dictinnaire des Sciences Naturelles, vl. 60. Le Nrmant, Paris. Dittrich, M Cynareae-systematic review. Pp in: Heywd, V. H., Harbrne, J. B. & Turner, B. L. (eds.), The Bilgy and Chemistry f the Cmpsitae, vl. 2. Academic Press, Lndn. Dwnie S. R. & Katz-Dwnie, D. S A mlecular phytgeny f Apiaceae subfamily Apiideae: evidence frm nuclear ribsmal DNA internal transcribed spacer sequences. Amen J. Bt. 83: Hasegawa, M., Kishin, H. & Yan T Dating the human-ape split by a mlecular clck f mitchndrial DNA. J. Mlec. Evl. 22: Herman, P. P. J., Relief, E., Kekemer, M. & Welman, W. G Asteraceae (Cmpsitae). In Leistner, O. A. (ed.), Seed plants f Suthern Africa. Strelitzia 10: Heywd, V. H., Harbrne, J. B. & Turner, B. L. (eds.) The Bilgy and Chemistry f the Cmpsitae, vls Academic Press, Lndn. Heywd, V. H. & Humphries, C Anthemideae-systematic review. Pp in: Heywd, V. H., Harbrne, J. B. & Turner, B. L. (eds.), The Bilgy and Chemistry f the Cmpsitae, vl. 2. Academic Press, Lndn. Hffmann, O Cmpsitae. Pp in: Engler, A. & Prantl, K. (eds.), Die naturlichen Pflanzenfamilien, vl. 4(5). Wilhelm Engelmann, Leipzig. Jansen, R. K Current Research. PL Mlec. Evl. Newsl. 2: Jansen, R. K., Michaels, H. J. & Palmer, J. D Phylgeny and character evlutin in the Asteraceae based n chlrplast DNA restrictin site mapping. Syst. Bt. 16: Jnes, S Vernnieae-systematic review. Pp in: Heywd, V. H., Harbrne, J. B. & Turner, B. L. (eds.), The Bilgy and Chemistry f the Cmpsitae, vl. 1. Academic Press, Lndn. Karis, P. O Hplphyllum DC, the sister grup t Eremthamnus O. Hffm. (Asteraceae)? Taxn 41: Karis, K., Eldenas, P. & Kallersj, M New evidence fr the systematic psitin f Gundelia L. with ntes n delimitatin f Arctteae (Asteraceae). Taxn 50: Kim, H.-G, Funk, V. A., Vlasek, A. & Zimmer, E. A A Phylgeny f the Munnziinae (Cmpsitae, Liabeae): circumscriptin f Munnzia and a new placement f M. p#/bwa. f/. jyaf. 6W. 239: Kim, K. J. & Jansen, R. K ndhf sequence evlutin and the majr clades in the sunflwer family. Prc. Natl. Acad. Sci. U.S.A. 92: Leins, P Die Pllenkrner und Verwandtschaftsbeziehungen der Gattung Eremthamnus (Asteraceae). Mitt. Bt. Staatssamml. Miinchen 7: Leistner, O. A. (ed.) Seed Plants f Suthern Africa: families and genera. Strelitzia 10: Lessing, C. F Synpsis Generum Cmpsitarum. Duncker & Humblt, Berlin. Merxmiiller, H Asteraceae. In: Merxmiiller, H. (ed.), Prdrmus einer Flra vn Flra vn Siidwestafrika, vl Cramer, Vaduz. Merxmiiller, H Inuleae-systematic review. Pp in: Heywd, V. H., Harbrne, J. B. & Turner, B. L. (eds.), The Bilgy and Chemistry f the Cmpsitae, vl. 1. Academic Press, Lndn. Mre, S Alabastra diversa. XXXVI(2). Ntes n African Cmpsitae. J. Bt. 67: Nrlindh, T Arctteae-systematic review. Pp in: Heywd, V. H., Harbrne, J. B. & Turner, B. L. (eds.), The Bilgy and Chemistry f the Cmpsitae, vl. 2. Academic Press, Lndn. Paner, J. L. & Funk, V. A Tward a phylgenetic subfamilial classificatin fr the Cmpsitae (Asteraceae). f/wc. #/. Sc. %fa:ngt/: 115: Rbinsn, H Observatins n the unique frm f sweeping hairs n the styles f the Eremthamneae (Asteraceae). Taxn 41: Rbinsn, H Ntes n the tribes Eremthamneae, Gundelieae, and Mquinieae, with cmparisns f their pllen. Taxn 43: 33^4-4. Rbinsn, H. & Brettell, R. D. 1973a. Tribal revisins in the Asteraceae. VIII. Arcttideae. Phytlgia 26: Rbinsn, H. & Brettell, R. D. 1973b. Tribal revisins in the Asteraceae. XI. Eremthamneae. Phytlgia 26: Rbinsn, H. & Funk, V. A A phylgenetic analysis f Leibldia, Lepidnia, and a new genus Stramentpappus (Vernnieae: Asteraceae). Bt. Jahrb. Syst. 108: Rydin, C. & Kallersj, M Taxn sampling and seed plant phylgeny. Cladistics 18: Stix, E Pllenmrphlgische Untersuchungen an Cmpsiten. Grana Palynl. 2: Swffrd, D. L PAUP*. Phylgenetic Analysis Using Parsimny (* and ther methds). Versin 4.0b 10. Sinauer Assciates, Sunderland, Massachusetts. Taberlet, P., Gielly, L., Pautu, G & Buvet, J Universal primers fr amplificatin f three nn-cding regins f chlrplast DNA. PI. Mlec. Bil. 17: Watsn, L. E., Evans, T. M. & Bluarte, T Mlecular phylgeny and bigegraphy f the tribe Anthemideae (Asteraceae), based n chlrplast gene ndhf. Mlec. Phyl. Evl. 15: White, T. J., Bruns, T., Lee, S. & Taylr, J Amplificatin and direct sequencing f fungal ribsmal RNA genes fr phylgenetics. Pp in: Innis, M., Gelfand, D., Sninsky, J. & White, T. (eds.), PCR Prtcls: A Guide t Methds and Applicatins. Academic Press, San Dieg. Y, K.-0., Lwry P. P. II & Wen, J Discrdance f chlrplast and nuclear ribsmal DNA data in Osmrhiza (Apiaceae). /(/nee J. #f. 89:

19 .:-' '- ; ^1! TAXON 53 (3) August 2004: Funk & al. Evlutin f the tribe Arctteae k, a TS a \c <c \ \ j ^f ^f ^f Tf!! in vn vn iri C- f- -rf- \ un rn ^O ^O ^O ^ <*J- O t> t"- t"- t> ^f ^f ^f Tf ^f u LO LO in LO >H >H >H >H >H < < < < < r--i--t--t--t--i--t--t^i-^ OO -~ <N t^ ON O <N en m <N <N m r-- r- r- r^ t^ t^ vn vn vi vn vn vn >H >H S, >H >H >H 9 9^999-4 a 0O0O0OO\O\O\O\O\O\O\0OO\O\0O ^ ( ( - t - t- t t - t- t t - r S"f a: * 3: >S>S>,>S>S>S>,>S>S>S>,>S>S>S OOOOOONOOOOOOOOOO t^r^r-t^ C- f- t- t--t--t--i-^r^t--i--t--t--t-- a H t t- t- c - t t- t- c - t t- t- c t~-t~-t^r~~t~-t~-t^r~~t~-t~-t^^t~ $ 333 JH JH JW JH JH JH JH JH JH JH J>H JH JH ^ t> > ^ ^ ^- \ < <d < < < < -C w 3 3 "»i«i«n«ss2c<«c< fcfcdddddfcfcs pq S 1/3 1/3 H^ (/) 1/3 t/3 DD^fcD k D S D pa S e SDDDfc c- «-1 d Z 4 vj C- 3 U) -< 0).Q E 3 C ^ n. CO a c 0) O T3 c r r T3 0) c 0) 3 CT 0) U) O a U) H 0) 3 t X T3 c Q. JZ a. < 2 * E tja,~,~ tja <B '<B ttj tja ea ;c JJ,~ E E,~,_,~ ttj,~ tja jj := tja,~ 3g d TD 3 th 3 1 < -5 3 < - - < J5 <<< 'S 3 & & ca : a *g 1 S s 8 3, i < 3 1 b 3 O O O O a O O O O 3 O a a a a O O O O a O O 1 ^ S * 1/3 1/3 1/3 1/3 1/3 1/3 t/3 1/3 1/3 1/3 < 1/3 1/3 1/3 z t/3 1/3 1/3 1/3 1/3 1/3 1/3 1/3 1/3 z 1/3 1/3 1/3 D ~ < x < fc u w S fc ~ D pq (^ < >C K ""> \c -V- Os Os \= r 1 >C ^ "» -h SC "\ > O. Os Os Os Os = "N 9 " 'n -is -v -«-is -M -M -is -is s Z 1 fn k. k, % 1 ^ CN k, k, 3 1 O Os % 1 ^ K 1 5 -is 3 3 =8 s rs, 3^ SC 5 (D 5 l "3 =8 s C pi a l c c l l l l l I c %; c 1 s e "-I 05 E 3 E is "^.5 "5? -«# 1? S S IS 1 ^3 b -is -_s is si -is -ig = -s ^ -5 a :l 3.0 '? O ko 3 ko O s L a L0 1 ^ til ^ s Q s :S^ 3 s k s ^ ^ O "3 t> k. t, q b, t, k, - ^ k. ta :% N s & a a^ 5 a w ia a u u S^-Ci C h-l pq J3 < g 3 '-5 P. 1 0 i-4 J 3 g a.5 s 5 i: s 5 u 3 55 ~.2 c: _Q 2 * 3 s '.6 -SiT ^ -s -a ^ ^ s> 6- S S "a S I ". 3 M rt «j a J P5 3 a a S s -a a -S 41 J Q O '5, a -3 «s s ~ 6, a - -s X & P. H s; n. u.> -c P< 3 O Q < J >J e< M S a u Pi.2 I W a & :3 -S p g P - s = gs S P-Q a a 'Si E a.3-2 R N «-. O-^ K,.. s n W, 3 1 Q pq 5" s B, a s -S JO 5 S P E s-p -p ff^^^s^ c q H ^ '3 '5 X -I ± ' = T3 O O T3.2.H % 0 0 M r3 a -a j 3 3 a rt TO cti rt pq O O pq Gun Vern Vern pq a M - 00 as -~ Tf t^ as 3 - as en CN m m,, sas(n-!(-<r, guit^sc g OS 5am CTs-«.a"u f-moom : -S m K S- E E E n. s ^ I >s %) %) >s % >s S) >s'g ff! ^ -s:.«.«.«.2.2 a ~^" % P. a 3.3 -S - s"«a a - a a a %) is %) ^ c c i, i, U c^ U k %.-/ 2<" -3 ^ -5 -a -s a "3l s "-3 s 'a -Ci "^ "^ ~ CL^: %j %j 3 3 tj M U k is 1^' n, a ^s IS ^2 O Q, fe r- r- f ^ 3 ^.3 ^ 22 ^ [5 2 nq 655