Deuteration: Structural Studies of Larger Proteins
|
|
- Archibald Lane
- 5 years ago
- Views:
Transcription
1 Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated proteins (See Gardner and Kay (1998) Ann. Rev. Biophys. and Biomol. Str. 27, for a general review)
2 Tendamistat 8 kda Cdc42 21 kda
3 R1b 9 kda τc = 6nsec Cdc42/ACK 26 kda τc=18nsec
4 Effects of Increasing Molecular Size number of resonances - crowded spectra faster relaxation - broad lines - low intensity - overlap - long experiment time
5 Transverse relaxation times as a function of protein size N() C α (D) transverse relaxation time T2 [ms] n C α () α 0 β correlation time [ns] Cx CyNz = msec Cx Cy =20-27 msec but T2 often less than 30 msec
6 Linewidth vs. Correlation Time coherence transfer Sensitivity α Π n sin(πj ) Π m cos(πj ) active passive relaxation exp(-r 2 Σ ) } Linewidth ν 1/2 = 1/πT 2 τ c MW 5ns 10kDa 10ns 20kDa 15ns 30 kda 25ns 50kDa ppm ppm ppm ppm
7 Relaxation Mechanisms Dipole-Dipole interactions (DD) Chemical shift anisotropy dip R 1,2 (X) ~ D. I(I+1).(γ X γ Y ) 2. Σ J(ω i ) i internal DD contributions X X= 13 C, 15 N external DD contributions γd/γ = 1/6.5 d CD /d C = 1/16
8 Impact of deuteration on relaxation rates relaxation rate constant/z τc =12 nsec Cα N α N removed by sidechain deuteration fixed
9 Impact of deuteration on relaxation rates T2 τc = 18 nsec T1
10 Effects of deuteration on Cα relaxation times Isolated C- pair T 2 (CD)/T 2 (C) T 2 (CD) / T 2 (C) J(0) dominate 12 Ratio Ratio 10 8 J(ω C -ω D ) effects 6 4 T 1 (CD)/T 1 (C) T 1 (CD) / T 1 (C) overall correlation time [ns] Correlation time (nsec)
11 Approaches to the Structure Determination of Larger Proteins For τ c up to ~12 ns (20 kda) - 13 C/ 15 N-labelling For τ c up to ~18 ns (35 kda) - fractional deuteration and 13 C/ 15 N- labelling For τ c above ~18 ns - selective protonation and 13 C/ 15 N-labelling
12 Triple Resonance NMR and Random Fractional Deuteration Backbone assignments Side-chain assignments Measurement of NOE contacts
13 Backbone Assignments NCA N(CO)CA O O 4 N Cα Cβ D C N N 4 Cα Cβ C 3 D N 6 β Cγ β Cγ γ γ Deuteration reduces relaxation Maximum sensitivity with 100% deuteration - Grzesiek et al., (1993) J. Am. Chem. Soc. 115, Yamazaki et al., (1994) J. Am. Chem. Soc. 116, Yamazaki et al., (1994) J. Am. Chem. Soc. 116,
14 Backbone Experiments with Deuterated Proteins Out and back CT for 13 C evolution (1/J cc ) 1 T1s: longer recycle delay preserve water Deuterium decoupling Removal of residual Cα Sensitivity enhancement (20 nsec limit?) Shan et al (1996) JACS
15 1 τ d 15 N 13 Cα 2 t1/2 Tc Tc-t1/2 y -y WALTZ16 x 2Tc = 26.6 ms = 1/J cc τ d = 1.7ms = 1/4J C 2 restored to z-axis (lock stability) Cα evolves for 1/2J C - removed by 1 decoupling
16 Backbone Assignments /D BCB/ACANN /D BCB/ACA(CO)NN Cβ /D Cβ /D Cα C N Cα Cα C N Cα O /D Cβ /D O /D Cβ /D β β Nietlispach et al., (1996) J. Am. Chem. Soc. 118,
17 Isotopomers in 50% 2 Proteins Isotopomer Fraction Contribution for Cβ peaks Cβ 2 -Cα 12.5% 4% CβD-Cα 25% 16% Cβ 2 -CαD 12.5% 17% CβD-CαD 25% 63% CβD 2 -Cα 12.5% 0% CβD 2 -CαD 12.5% 0%
18 Effect of Deuteration on BCB/ACA(CO)N for a protein with τ c ~18ns (30kDa) 0% 2 50% 2 75% 2
19 Effect of Deuteration on BCB/ACANN for a protein with 18 nsec correlation time ppm % 2 50% 2
20 Triple Resonance NMR and Random Fractional Deuteration Backbone assignments Side-chain assignments Measurement of NOE contacts
21 Side-chain Assignments CC(CO)NN O 1 N Cβ 3 Cα 2 C α 4 N 5 β 1 Cγ 2 γ Deuteration reduces relaxation Maximum sensitivity with 50% deuteration Nietlispach et al., (1996) J. Am. Chem. Soc. 118,
22 Effect of Deuteration on CC(CO)NN for a Protein with a 12 nsec Correlation Time ppm 0% 50%
23 Side-chain Assignments CC-COSY CC-TOCSY D C D C D C D C C D C D Deuteration reduces relaxation Deuteration removes both protons
24 Effect of Deuteration on CC- TOCSY for a Protein with 18 nsec Correlation Time α α α β Val α γ1 0% α γ % δ β δ γ1 δ γ2 δ Ile δ 0% %
25 Isotope Shifts Isotope effects: 1 13 C ~ ppm 2 13 C ~ -0.1 ppm 3 13 C ~ ppm 1 15 N ~ -0.3 ppm 2 15 N ~ to -0.1 ppm e.g 13 Cα in 100% D protein -0.5 ppm isotope shift weak secondary structure dependency. Isotopomers not resolved in most experiments
26 Triple Resonance NMR and Random Fractional Deuteration Backbone assignments Side-chain assignments Measurement of NOE contacts
27 Measurement of NOE Contacts Deuteration affects the measurement of N - N, N - C and C - C cross peaks in different ways Nietlispach et al., (1996) J. Am. Chem. Soc. 118,
28 Distance Restraints and Fractional Deuteration τ c = 12 nsec N/sidechain N/N 0% 2 50% 2 75% 2
29 Measurement of NOE Contacts J-correlated CD NOESY CD C 2 C 2 δ (ppm) δ (ppm) Similar contributions from different isotopomers lead to comparable chemical shifts
30 Structure Calculations Use of ARIA for structure determination Nilges (1995) J. Mol. Biol. 245, Global fold from selectively protonated data Use Talos to estimate backbone torsion angles from chemical shifts
31 Fractional Deuteration at 50% Improved sensitivity and linewidth No complications from different isotopomers Backbone and sidechain assignments possible 1 / 1 NOEs can be observed Applicable to proteins up to 30 kda
32 Approaches to the Structure Determination of larger Proteins For proteins of up to τ c ~ 12 ns, use 13 C/ 15 N-labelling For proteins of up to τ c ~ 18 ns, use fractional deuteration and 13 C/ 15 N-labelling For proteins τ c ~ 18 ns and above, use selective protonation and 13 C/ 15 N-labelling
33 Approaches for Proteins Larger than 30 kda Complete deuteration maximum sensitivity for backbone experiments but limited NOE information (N <-> N) Selective protonation of residues e.g AILV in deuterated background Selective protonation of Methyl-groups (Gardner J. Am. Chem. Soc. 119, 7599)
34 Triple Resonance NMR and Selective Protonation Label proteins with ILV+FY Methyl and aromatic 13 C and 1 nuclei relax more slowly Allows measurement of N-N, N-methyl and methyl-methyl NOE contacts These residues are typically found in the protein core or interfaces Biosynthetic pathways allow straightforward labelling Can adjust the number of residue types labelled
35 Triple Resonance NMR and Selective Protonation Backbone assignments Side-chain assignments Measurement of NOE contacts
36 Backbone Assignments NCA N(CO)CA O O 4 N Cα Cβ D C N N 4 Cα Cβ D C N 6 β Cγ β Cγ γ γ Deuteration reduces relaxation Maximum sensitivity with 100% deuteration ILV - Cα mainly deuterated Me-selective - Cα 100% deuterated
37 Triple Resonance NMR and Selective Protonation Backbone assignments Side-chain assignments Measurement of NOE contacts
38 Side-chain Assignments NCACB CC(CO)NN O O 6 N 5 4 Cβ 1 2 Cα 3 D C N N Cβ 2 Cα 1 D C 3 N 4 D Cγ D Cγ 1 D D Deuteration reduces relaxation Maximum sensitivity with 100% deuteration Yamazaki et al., (1994) J. Am. Chem. Soc. 116, Farmer et al., (1995) J. Am. Chem. Soc. 117,
39 Side-chain Assignments ()CC(CO)NN O N Cβ 3 Cα 2 D C 4 N 5 D 1 Cγ 2 γ Gardner et al (1996) J. Biomol. NMR 8,
40 Triple Resonance NMR and Selective Protonation Backbone assignments Side-chain assignments Measurement of NOE contacts
41 Measurement of NOE Contacts 3D 15 N- and 13 C-NOESY 3D Val/Ile (M)CMCB(CMM) NOESY Zwahlen et al., (1998) J. Am. Chem. Soc. 120, D 13 C/ 13 C-NOESY Zwahlen et al., (1998) J. Am. Chem. Soc. 120, D QQF-NOESY
42 Methyl-Selective Correlation Experiments all 1 transverse (16 msec) φ 3 φ 1 DEPT- QQC 1 13C (Kessler, 1989) ξ 2 CT t 1 /2 CT t 1 /2 φ rec BB a φ 2 QQF φ 5 φ 1 φ 3 t 1 /4 /2 φ rec QQF 1 13C ξ 4 φ 4 t 1 /4 + b 3 t 1 /2 2 CT c t 1 /4 + BB G 1 G 2 G 2 G 3 G 3 G 4 G 4 G z a y b 2 1x C y c 8 1x C y 2z 3z (5 evolution of J C ) 6 1/Jcc = 24 msec only 1 proton transverse between b and c
43 Sensitivity Improvement in QQF (a) QQF (b) QQC (c) DEPT-QQC (c) QQF-SQC (ppm)
44 Resolution Improvement in QQF Cdc42 methyl region I126 γ2 I117 γ2 I46 γ2 A142 β C (ppm) 8 0 V77 γ1 V85 γ2 I4 γ L165 δ L112 δ2 1.4 L δ1 L53 δ (ppm) L112 δ
45 Structure Calculations Use ARIA for structure determination Nilges (1995) J. Mol. Biol. 245, Restrain φ and ϕ angles in early stages and slacken off later
46 Limited Restraints in Structure Determination Ras: Mixed α and β structure Reasonable size (21kDa) Single domain Numbers of Methyls and Aromatics: 11 Ile 11 Leu 15 Val 5 Phe 9 Tyr 0 Trp
47
48 N/N 2 Ns only - 13Å RMSD
49 Ile, Val, Leu
50 Aromatic
51 Structures from Limited Restraints Ras NMR Structure 0.6Å RMSD 101 N-N 1171 N-S/C 1862 SC/SC 13 C/ 15 N ILVFY 2.0Å RMSD 101 N-N (ass-ass) 390 N-S/C (ass-amb) 431 S/C-S/C (ass-ass) 13 C/ 15 N ILV 15 N FY 5.0Å RMSD 101 N-N (ass-ass) 390 N-S/C (ass-amb) 231 ILV-ILV (ass-ass) 174 ILV-FY (ass-amb) 26 FY-FY (amb-amb) 13 C/ 15 N ILV 15 N FY 1.7Å N NOEs to 5Å As above with 330 N-N NOEs
52 Structures from Limited Restraints: Effect of Dipolar Couplings Clore et al (1999) JACS BAF - 89 residues all α CVN residues 2 domains - all β BAF CVN N-N N-Me N-arom Me-Me Me-arom arom-arom 5 5 Total bonds RDC bonds + N + Me ~4Å accuracy Adding aromatics Å (BAF) 1.53Å (CVN) Adding RDC Å (BAF) 1.10Å (CVN) RDC: N,N-C,N-C,Cα-,Cα-C
53 Conclusions Selective Protonation optimises the sensitivity of experiments used to correlate side-chain and backbone resonances allows one to obtain limited NOE data and structural models use of orientational restraints should improve structures
54 Practical Aspects of Producing Deuterated Proteins Random fractional deuteration LB/ 2 O LB/50% D 2 O OD 600 = 0.4 M9 in 50% D 2 O with either [50% 2, 100% 13 C/ 15 N] algal hydrolysate or [100% 2 / 13 C] glucose
55 Practical Aspects of Producing Deuterated Proteins Selective protonation Use 2 / 13 C glucose, amino acids and: C 3 -CD 2 -CO-COO- [3,3-2 ]- 13 C-2-ketobutyrate C 3 -CD 2 -CD(CD 3 )-CD(ND 3+ )-COO- isoleucine Gardner and Kay (1997) J. Am. Chem. Soc. 119, LB/ 2 O LB/95-99% D 2 O OD 600 = 0.4 M9 in 95-99% D 2 O [100% 2 / 13 C] glucose [100% 3,3 2 2, 100% 13 C] 2-ketobutyrate [100% α/β- 2, 100% 13 C/ 15 N] Val
Labelling strategies in the NMR structure determination of larger proteins
Labelling strategies in the NMR structure determination of larger proteins - Difficulties of studying larger proteins - The effect of deuteration on spectral complexity and relaxation rates - NMR expts
More informationPrinciples of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination
1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1
More information1. 3-hour Open book exam. No discussion among yourselves.
Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear
More informationTriple Resonance Experiments For Proteins
Triple Resonance Experiments For Proteins Limitations of homonuclear ( 1 H) experiments for proteins -the utility of homonuclear methods drops quickly with mass (~10 kda) -severe spectral degeneracy -decreased
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble
More informationConcepts on protein triple resonance experiments
2005 NMR User Training Course National Program for Genomic Medicine igh-field NMR Core Facility, The Genomic Research Center, Academia Sinica 03/30/2005 Course andout Concepts on protein triple resonance
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear
More informationMagnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A
Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy
More informationUsing NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017
Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:
More informationUse of deuterium labeling in NMR: overcoming a sizeable problem Michael Sattler and Stephen W Fesik*
Ways & Means 1245 Use of deuterium labeling in NMR: overcoming a sizeable problem Michael Sattler and Stephen W Fesik* Address: Abbott Laboratories, 47G AP10,100, Abbott Park Road, Abbott Park, IL 60064-3500,
More informationResonance assignments in proteins. Christina Redfield
Resonance assignments in proteins Christina Redfield 1. Introduction The assignment of resonances in the complex NMR spectrum of a protein is the first step in any study of protein structure, function
More informationProtein-protein interactions by NMR
Protein-protein interactions by NMR Fast k on,off >> (ν free - ν bound ) A + B k on k off AB k on,off ~ (ν free - ν bound ) Slow k on,off
More informationSequential resonance assignments in (small) proteins: homonuclear method 2º structure determination
Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield
More informationModel-Free Approach to Internal Motions in Proteins
Model-Free Approach to Internal Motions in Proteins Lipari & Szabo, JACS 104, 4546 (1982) Palmer AG. Ann. Rev. Biophys. Biomol. Struc., 30, 129-155 (2001) Palmer AG, Kroenke CD, Loria JP, Meth. Enzymol.
More informationProtein-protein interactions and NMR: G protein/effector complexes
Protein-protein interactions and NMR: G protein/effector complexes Helen Mott 5th CCPN Annual Conference, August 2005 Department of Biochemistry University of Cambridge Fast k on,off >> (ν free - ν bound
More informationNMR in Medicine and Biology
NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR
More informationSequential Assignment Strategies in Proteins
Sequential Assignment Strategies in Proteins NMR assignments in order to determine a structure by traditional, NOE-based 1 H- 1 H distance-based methods, the chemical shifts of the individual 1 H nuclei
More informationBiophysical Chemistry: NMR Spectroscopy
Relaxation & Multidimensional Spectrocopy Vrije Universiteit Brussel 9th December 2011 Outline 1 Relaxation 2 Principles 3 Outline 1 Relaxation 2 Principles 3 Establishment of Thermal Equilibrium As previously
More informationNMR in Structural Biology
NMR in Structural Biology Exercise session 2 1. a. List 3 NMR observables that report on structure. b. Also indicate whether the information they give is short/medium or long-range, or perhaps all three?
More informationQuantification of Dynamics in the Solid-State
Bernd Reif Quantification of Dynamics in the Solid-State Technische Universität München Helmholtz-Zentrum München Biomolecular Solid-State NMR Winter School Stowe, VT January 0-5, 206 Motivation. Solid
More informationIntroduction solution NMR
2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics
More informationSupporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
More informationHSQC spectra for three proteins
HSQC spectra for three proteins SH3 domain from Abp1p Kinase domain from EphB2 apo Calmodulin What do the spectra tell you about the three proteins? HSQC spectra for three proteins Small protein Big protein
More informationLecture 9. Heteronuclear 3D NMR Spectroscopy.
Lecture 9. eteronuclear 3D NMR Spectroscopy. The isotope-editing experiments discussed in the last lecture provide the conceptual framework for heteronuclear 3D NMR experiments. These experiments are the
More informationTROSY-type Triple-Resonance Experiments for Sequential NMR Assignments of Large Proteins
844 J. Am. Chem. Soc. 999, 2, 844-848 TOSY-type Triple-esonance Experiments for Sequential NM Assignments of Large Proteins Michael Salzmann,, Gerhard Wider, Konstantin Pervushin, Hans Senn, and Kurt Wuthrich*,
More information- Basic understandings: - Mapping interactions:
NMR-lecture April 6th, 2009, FMP Berlin Outline: Christian Freund - Basic understandings: Relaxation Chemical exchange - Mapping interactions: -Chemical shift mapping (fast exchange) Linewidth analysis
More informationNMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research
2 NMR journey Introduction to solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, CCMB, Hyderabad, India November 29th
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.
More informationMagic-Angle Spinning (MAS) drive bearing
Magic-Angle Spinning (MAS) magic-angle spinning is done pneumatically spinning frequency can be stabilized within a few Hz Magic-Angle Spinning (MAS) drive bearing Magic-Angle Spinning (MAS) Maximum spinning
More informationBiochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationProtein Structure Determination Using NMR Restraints BCMB/CHEM 8190
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationNMR Spectroscopy: A Quantum Phenomena
NMR Spectroscopy: A Quantum Phenomena Pascale Legault Département de Biochimie Université de Montréal Outline 1) Energy Diagrams and Vector Diagrams 2) Simple 1D Spectra 3) Beyond Simple 1D Spectra 4)
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4-5pm and SFL 229, Monday 3/5 4-5:30pm. 1. NMR
More informationPROTEIN'STRUCTURE'DETERMINATION'
PROTEIN'STRUCTURE'DETERMINATION' USING'NMR'RESTRAINTS' BCMB/CHEM'8190' Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationSUPPLEMENTARY INFORMATION
5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.
More informationProtein NMR. Bin Huang
Protein NMR Bin Huang Introduction NMR and X-ray crystallography are the only two techniques for obtain three-dimentional structure information of protein in atomic level. NMR is the only technique for
More informationSensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
More informationGuided Prediction with Sparse NMR Data
Guided Prediction with Sparse NMR Data Gaetano T. Montelione, Natalia Dennisova, G.V.T. Swapna, and Janet Y. Huang, Rutgers University Antonio Rosato CERM, University of Florance Homay Valafar Univ of
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/NCHEM.1299 Protein fold determined by paramagnetic magic-angle spinning solid-state NMR spectroscopy Ishita Sengupta 1, Philippe S. Nadaud 1, Jonathan J. Helmus 1, Charles D. Schwieters 2
More informationStructurele Biologie NMR
MR journey Structurele Biologie MR 5 /3C 3 /65 MR & Structural biology course setup lectures - Sprangers R & Kay LE ature (27) basics of MR (Klaartje ouben: k.houben@uu.nl; 4/2) from peaks to data (ans
More informationBasic principles of multidimensional NMR in solution
Basic principles of multidimensional NMR in solution 19.03.2008 The program 2/93 General aspects Basic principles Parameters in NMR spectroscopy Multidimensional NMR-spectroscopy Protein structures NMR-spectra
More informationEvaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example
Biochemistry 2000, 39, 13365-13375 13365 Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example Xuemei Huang,
More informationProtein Structure Determination Using NMR Restraints BCMB/CHEM 8190
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brunger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationAssignment of Heme Resonances and. High- and Low-Spin Nitrophorin 2 by 1 H and. Order of Heme Methyl Resonances in High- Spin Ferriheme Proteins
Supplementary Material for: Assignment of Heme Resonances and Determination of the Electronic Structures of High- and Low-Spin Nitrophorin 2 by 1 H and 13 C NMR Spectroscopy: An Explanation of the Order
More informationIntroduction to NMR for measuring structure and dynamics + = UCSF Macromolecular Interactions. John Gross, Ph.D.
Introduction to NMR for measuring structure and dynamics + = UCSF Macromolecular Interactions John Gross, Ph.D. Nuclear Spins: Microscopic Bar Magnets H µ S N N + Protein Fragment Magnetic Moment Bar Magnet
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice David Baker Autumn Quarter 2014 Slides Courtesy of Gabriele Varani Recommended NMR Textbooks Derome, A. E. (1987) Modern NMR Techniques for Chemistry Research,
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationUseful background reading
Overview of lecture * General comment on peptide bond * Discussion of backbone dihedral angles * Discussion of Ramachandran plots * Description of helix types. * Description of structures * NMR patterns
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 Helical Hairpin Structure of a potent Antimicrobial Peptide MSI-594 in Lipopolysaccharide Micelles by NMR Anirban
More informationTheory and Applications of Residual Dipolar Couplings in Biomolecular NMR
Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of
More information8.2 The Nuclear Overhauser Effect
8.2 The Nuclear Overhauser Effect Copyright Hans J. Reich 2016 All Rights Reserved University of Wisconsin An important consequence of DD relaxation is the Nuclear Overhauser Effect, which can be used
More informationHigh-Resolutio n NMR Techniques i n Organic Chemistry TIMOTHY D W CLARIDGE
High-Resolutio n NMR Techniques i n Organic Chemistry TIMOTHY D W CLARIDGE Foreword Preface Acknowledgements V VI I X Chapter 1. Introduction 1.1. The development of high-resolution NMR 1 1.2. Modern
More informationSolid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum,
Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum, 16.02.2009 Solid-state and solution NMR spectroscopy have many things in common Several concepts have been/will
More informationDipole Recoupling at High Spinning Frequencies. and. High Magnetic Fields
Dipole Recoupling at High Spinning Frequencies and High Magnetic Fields Stowe, Vermont January 2010 Francis Bitter Magnet Laboratory and Department of Chemistry Massachusetts Institute of Technology Outline
More informationIntroduction to solution NMR. Alexandre Bonvin. The NMR research group. Bijvoet Center for Biomolecular Research
Introduction to solution NMR 1 Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben Bente%Vestergaard% The NMR research group Prof. Marc Baldus Prof. Rolf Boelens
More informationMolecular Modeling lecture 2
Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography
More informationJeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07
NMR Spectroscopy Jeff Grinstead NMR Spectroscopy NMR for structural biology Challenges for determining protein structures using NMR Proteins have thousands of signals Assign the specific signal for each
More informationSolving the three-dimensional solution structures of larger
Accurate and rapid docking of protein protein complexes on the basis of intermolecular nuclear Overhauser enhancement data and dipolar couplings by rigid body minimization G. Marius Clore* Laboratory of
More informationHADDOCK: High Ambiguity
Determination of Protein-Protein complexes HADDOCK: High Ambiguity Driven DOCKing A protein-protein docking approach based on biochemical and/or biophysical data In PDB: >15000 protein structures but
More informationProtein Dynamics Relaxation techniques
Protein Dynamics Relaxation techniques Daniel Mathieu Bruker Users Meeting 2016, Karlsruhe Innovation with Integrity Proteins aren t exactly rock solid 10.11.2016 Users meeting 2016 2 Characterizing Dynamic
More informationProtein Structure Determination using NMR Spectroscopy. Cesar Trinidad
Protein Structure Determination using NMR Spectroscopy Cesar Trinidad Introduction Protein NMR Involves the analysis and calculation of data collected from multiple NMR techniques Utilizes Nuclear Magnetic
More informationResidual Dipolar Couplings BCMB/CHEM 8190
Residual Dipolar Couplings BCMB/CHEM 8190 Recent Reviews Prestegard, A-Hashimi & Tolman, Quart. Reviews Biophys. 33, 371-424 (2000). Bax, Kontaxis & Tjandra, Methods in Enzymology, 339, 127-174 (2001)
More informationFinding Bonds, H-bonds
Finding Bonds, H-bonds A hydrogen bond (HB) allows chunks of peptide relatively far away from each other to come close together. They are all over the place in globular proteins, so if we could identify
More informationPresenter: She Zhang
Presenter: She Zhang Introduction Dr. David Baker Introduction Why design proteins de novo? It is not clear how non-covalent interactions favor one specific native structure over many other non-native
More informationName: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10
Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Instructions: This is an open book, limited time, exam. You may use notes you have from class and any text book you find useful. You may also use
More informationUniversity of Groningen. Protein structure and dynamics by NMR Otten, Renee
University of Groningen Protein structure and dynamics by NMR Otten, Renee IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check
More informationDouble-Resonance Experiments
Double-Resonance Eperiments The aim - to simplify complicated spectra by eliminating J-couplings. omonuclear Decoupling A double resonance eperiment is carried out using a second rf source B 2 in addition
More informationNMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease
University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile
More informationDNP enhanced frequency-selective TEDOR experiments in bacteriorhodopsin
DNP enhanced frequency-selective TEDOR experiments in bacteriorhodopsin Journal of Magnetic Resonance 202 (2010) 9-13 Bajaj S. V., Mak-Jurkauskus, A. L., Belenky, M., Herzfeld, J. and Griffin, R. MR Seminar
More informationFiltered/edited NOESY spectra
Filtered/edited NOESY spectra NMR Seminar HS 207 Nina Ripin 22..7 Overview NMR of biomolecular complexes Problems and Solutions Filtered/edited nomenclature Experimental elements NOESY vs filtered pulse
More informationNMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins
Lecture #2 M230 NMR parameters intensity chemical shift coupling constants Juli Feigon 1D 1 H spectra of nucleic acids and proteins NMR Parameters A. Intensity (area) 1D NMR spectrum: integrated intensity
More informationSpin Relaxation and NOEs BCMB/CHEM 8190
Spin Relaxation and NOEs BCMB/CHEM 8190 T 1, T 2 (reminder), NOE T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations
More information14. Coherence Flow Networks
14. Coherence Flow Networks A popular approach to the description of NMR pulse sequences comes from a simple vector model 1,2 in which the motion of the spins subjected to RF pulses and chemical shifts
More informationPROTEIN NMR SPECTROSCOPY
List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear
More informationEffects of Chemical Exchange on NMR Spectra
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More informationEffects of Chemical Exchange on NMR Spectra
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More information3D NMR 3D NMR 3D NMR. Visualising 3D NMR spectra. strip plots. preparation mixing mixing t1 t2 t3 I S T I
3D NMR 3D NMR Chris Waudby c.waudby@ucl.ac.uk 3D NMR Visualising 3D NMR spectra preparation mixing mixing t1 t2 t3 I S T I 2 indirect dimensions, independently incremented evolution times Much longer acquisition
More informationLongitudinal-relaxation enhanced fast-pulsing techniques: New tools for biomolecular NMR spectroscopy
Longitudinal-relaxation enhanced fast-pulsing techniques: New tools for biomolecular NMR spectroscopy Bernhard Brutscher Laboratoire de Résonance Magnétique Nucléaire Institut de Biologie Structurale -
More informationProtein structure determination by solid-state NMR
Protein structure determination by solid-state NMR Birgit Habenstein Supervised by Anja Böckmann Solid state NMR proteinaceous targets Structural studies and structure determination at atomic level Membrane
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More information1. A few weeks ago you recorded one of the two NMR spectra below. Explain briefly the necessary procedure to record such beautiful spectra!
llowed aids: en/encil, eraser, ruler, calculator You may answer in English or Swedish. few weeks ago you recorded one of the two NMR sectra below. Exlain briefly the necessary rocedure to record such beautiful
More informationWhat makes a good graphene-binding peptide? Adsorption of amino acids and peptides at aqueous graphene interfaces: Electronic Supplementary
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 21 What makes a good graphene-binding peptide? Adsorption of amino acids and
More informationI690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy
I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice
More informationTransverse Relaxation-Optimized Spectroscopy (TROSY) for NMR Studies of Aromatic Spin Systems in 13 C-Labeled Proteins
6394 J. Am. Chem. Soc. 1998, 120, 6394-6400 Transverse Relaxation-Optimized Spectroscopy (TROSY) for NMR Studies of Aromatic Spin Systems in 13 C-Labeled Proteins Konstantin Pervushin, Roland Riek, Gerhard
More informationPeptides And Proteins
Kevin Burgess, May 3, 2017 1 Peptides And Proteins from chapter(s) in the recommended text A. Introduction B. omenclature And Conventions by amide bonds. on the left, right. 2 -terminal C-terminal triglycine
More informationSolid-State NMR Structural Studies of Proteins Using Paramagnetic Probes
Solid-State NMR Structural Studies of Proteins Using Paramagnetic Probes Christopher Jaroniec Department of Chemistry & Biochemistry The Ohio State University Protein Structure by MAS Solid-State NMR D
More informationAccurate Characterisation of Weak Protein- Protein Interactions by Titration of NMR Residual Dipolar Couplings
Accurate Characterisation of Weak Protein- Protein Interactions by Titration of NMR Residual Dipolar Couplings Jose Luis Ortega-Roldan, Malene Ringkjøbing Jensen*, Bernhard Brutscher, Ana I. Azuaga, Martin
More informationIntroduction to 1D and 2D NMR Spectroscopy (4) Vector Model and Relaxations
Introduction to 1D and 2D NMR Spectroscopy (4) Vector Model and Relaxations Lecturer: Weiguo Hu 7-1428 weiguoh@polysci.umass.edu October 2009 1 Approximate Description 1: Energy level model Magnetic field
More informationNMR structure determination of a peptide using the ARIA webportal
NMR observables that contain structural information: NMR structure determination of a peptide using the ARIA webportal Atom distances (Nuclear Overhauser Effect) Secondary structure, interaction Chemical
More informationNMR Assay of Purity and Folding
NMR Assay of Purity and Folding Don t Need Resonance Assignments or Labeling 1D requires only 10-50 µm protein concentration 2D Provides A More Detailed Assay 15 N- 1 H HSQC 1 H COSY 13 C HSQC also! Analyze
More informationExperimental Techniques in Protein Structure Determination
Experimental Techniques in Protein Structure Determination Homayoun Valafar Department of Computer Science and Engineering, USC Two Main Experimental Methods X-Ray crystallography Nuclear Magnetic Resonance
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin
More informationPRACTICAL ASPECTS OF NMR RELAXATION STUDIES OF BIOMOLECULAR DYNAMICS
PRACTICAL ASPECTS OF MR RELAXATIO STUDIES OF BIOMOLECULAR DYAMICS Further reading: (Can be downloaded from my web page Korzhnev D.E., Billeter M., Arseniev A.S., and Orekhov V. Y., MR Studies of Brownian
More informationProtein Structure Refinement Using 13 C α Chemical. Shift Tensors. Benjamin J. Wylie, Charles D. Schwieters, Eric Oldfield and Chad M.
Protein Structure Refinement Using 13 C α Chemical Shift Tensors Benjamin J. Wylie, Charles D. Schwieters, Eric Oldfield and Chad M. Rienstra * Department of Chemistry, University of Illinois at Urbana-Champaign,
More informationStructure determination
Structure determination NMR Structural Constraints 1. Internuclear distances (Nuclear Overhauser Effect) NOE R -6 2. Dihedral angles (J-coupling): 3 J NHα = 6.4 cos 2 (Φ -60) 1.4cos(Φ -60) + 1.9 3. C hem
More informationNMR-spectroscopy of proteins in solution. Peter Schmieder
NMR-spectroscopy of proteins in solution Basic aspects of NMR-Spektroskopie Basic aspects of NMR-spectroscopy 3/84 Prerequisite for NMR-spectroscopy is a nuclear spin that can be thought of as a mixture
More informationParamagnetic Effects BCMB/CHEM
Paramagneti Effets BCMB/CHEM 890 0 Referenes Expanding the utility of NMR restraints with paramagneti ompounds: Bakground and pratial aspets, Koehler J and Meiler J, Prog. NMR Spet. 59: 360-389 0 Paramagneti
More informationTwo-Dimensional NMR Spectroscopy
Two-Dimensional NMR Spectroscopy Applications for Chemists and Biochemists Second Edition Expanded and Updated to Include Multidimensional Work EDITED BY William R. Croasmun and Robert M. K. Carlson VCH
More informationAmino Acid Side Chain Induced Selectivity in the Hydrolysis of Peptides Catalyzed by a Zr(IV)-Substituted Wells-Dawson Type Polyoxometalate
Amino Acid Side Chain Induced Selectivity in the Hydrolysis of Peptides Catalyzed by a Zr(IV)-Substituted Wells-Dawson Type Polyoxometalate Stef Vanhaecht, Gregory Absillis, Tatjana N. Parac-Vogt* Department
More informationInterpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
More information