Protein-protein interactions and NMR: G protein/effector complexes
|
|
- Clarissa Hutchinson
- 5 years ago
- Views:
Transcription
1 Protein-protein interactions and NMR: G protein/effector complexes Helen Mott 5th CCPN Annual Conference, August 2005 Department of Biochemistry University of Cambridge
2 Fast k on,off >> (ν free - ν bound ) A + B k on k off AB k on,off ~ (ν free - ν bound ) Slow k on,off << (ν free - ν bound ) να free να bound
3 15 N-HSQC: Titration of Unlabelled Peptide into Labelled Protein 1:0 1:0.1 Fast 1:0.3 Intermediate Slow? 1:0.5 1:1.0 Fast/ Intermediate
4 15 N-HSQC: Titration of Unlabelled Peptide into Labelled Protein 1:0 1:0.1 Fast 1:0.3 Intermediate Slow? 1:0.5 1:1.0 Fast/ Intermediate 1:1.2
5 Measure K d e.g. fluorescence, ITC, Biacore, NMR Minimize interacting region, if necessary e.g. limited proteolysis Find conditions where both components are stable and interaction still occurs (e.g. salt, ph dependence) and exchange regime is favourable Add unlabelled component in excess to saturate the other component Department of Biochemistry University of Cambridge
6 Information attainable depends on the strength of the complex Structures of protein complexes Dynamics of interactions Mapping interactions e.g. for mutagenesis studies Extracting distance information (transferred NOE) Docking strong strong weak or strong weak or strong weak or strong Department of Biochemistry University of Cambridge
7 Differential Labelling Schemes Labelled with 13 C, 15 N Unlabelled 12 C, 14 N 13 C H H 12 C Simplification of spectra 13 C H H 12 C Department of Biochemistry University of Cambridge
8 Cdc42 + Cdc42/ACK Complex ACK Free 15N-labelled ACK 15N-ACK + unlabelled Cdc
9 Tight Complexes: Slow Exchange (the ideal case) Chemical Shift Assignments 1. Backbone experiments: HSQC, HNCA, HN(CO)CA, HNCACB, CBCA(CO)NH recorded on each component of complex 2. Sidechain experiments: 15 N-separated TOCSY, HCCH-TOCSY CC(CO)NH, H(CCCO)NH, HBHA(CBCA)(CO)NH on each component of the complex 3. Coupling constant experiments: HNHA on each component of the complex
10 Tight Complexes: Slow Exchange (the non-ideal case) Chemical Shift Assignments 1. Backbone experiments require full deuteration and TROSY: HSQC, HNCA, HN(CO)CA, HNCACB, HN(CO)CACB, HNCO, HNCACO 2. Sidechain experiments: CC(CO)NH (on deuterated sample) On protonated sample: HCCH-TOCSY, 15 N-separated NOESY (to guess shifts of sidechain 1 H) 3. Coupling constants: experiments do not work, use all shifts (including CO) to put into Talos. Full set of assignments of the free protein(s) is necessary
11 NOE Data (in all cases) 2 types of experiment: Edited or separated: keep 1 H attached to nucleus X 13 C and 15 N-separated NOESYs NOEs between 13 C-attached protons and NOEs between 13 C-attached and 12 C- attached protons Filtered or rejected: keep 1 H NOT attached to nucleus X X-filtered NOESY NOEs between 13 C- 1 H and 12 C- 1 H, 14 N- 1 H Doubly-rejected NOESY/TOCSY 12 C- 1 H/ 14 N- 1 H
12 X-filtered Experiments Two basic types: a) Schemes where X-attached 1 H are removed directly 1 H 1/2J X e.g. generate MQC b) Schemes where interleaved experiments are recorded and have to be added or subtracted to keep or discard X-attached 1 H 1 H X X-pulse present or absent in alternating experiments
13 All 13 C-filtered experiments suffer because 1 J CH varies: Hz aliphatic CH; Hz aromatic CH 1 delays are inevitably only tuned to one J coupling J CH (Hz) aliphatic His Tyr, Phe, Trp δ 13 C (ppm) 1 J CH = (0.365 ± 0.01 Hz/ppm) δc ± 0.5 Hz 1 J CH = A δc + B Zwahlen et al (1997) JACS
14 Adiabatic pulses Trajectory of 13 C magnetization follows effective field for duration of the pulse Carrier frequency of the pulse starts far upfield, sweeps through resonance, then downfield 13 C resonate at different frequencies so they are all inverted at different times, depending on their frequency and the sweep rate and duration of the inversion pulse
15 Purge scheme with adiabatic pulse 1 H 13 C G a Hy + Iy G1 1 /2 1 /2 From a to b: t G1 b G2 13 C spin inverted at time t (t 0) after 1 H 180 pulse 1 J CH evolution occurs for a time 1-2t 1 J CH and t vary for each 13 C nucleus Hy + IycosπJ IS ( 1-2t) - 2IxSzsinπJ IS ( 1-2t) 90 ( 1 H) Hz + IzcosπJ IS ( 1-2t) - 2IxSzsinπJ IS ( 1-2t) IzcosπJ IS ( 1-2t) = 0 for all spins 1-2t = 1/(2 1 J CH ) (i) removed by G2 Since t 0 and 1 J CH is smallest for upfield 13 C (i.e. methyls), these must be inverted first. 1 is set close to 1/2 1 J CH (methyl) 1 J CH = Aδ C + B (ii) (A=0.365 Hz/ppm; B = Hz) Frequency of the transmitter δ RF (t) = δc. Substitute for 1 J CH in (i) 1-2t = 1/[2(Aδ RF + B)] time derivative to get sweep rate during WURST Zwahlen et al (1997) JACS
16 3D 13 C-filtered, 13 C-edited NOESY-HSQC ( X-filter ) Two of these modules at the start of the sequence Suppression factors are fold Putting filter modules at the start of the sequence makes H 2 O suppression easier No decoupling during T1 ( 1 H evolution) to detect breakthrough 15 N filter at the same time as the 13 C filter
17 2 Issues with the X-filter experiment 1. It has to be referenced in both proton dimensions 2. It has to be calibrated for structure calculation and there are no reference distances Department of Biochemistry University of Cambridge
18 Structure calculation strategies (1) Assignment of intra-molecular NOEs in 13 C- and 15 N-separated spectra: check that they do not have any inter-molecular possibility (they may not appear in X-filter if they are weak) Ambiguous NOEs that appear in 13 C-edited NOESY as well as X-filter, 13 C-edited NOESY should be treated in the same way as other ambiguous NOEs as they may contain intra-molecular contribution to the intensity Check for the other things that appear in the X-filter experiment: Thr/Ser-OH ~ 5ppm Tyr-OH ~9ppm Cys-SH ~1ppm! In larger proteins, X-filter only really works for methyl groups Watch out for the artefacts..
19 Structure calculation strategies (2) Dealing with all the data - generation of restraints minimum 5-6 NOESY datasets all with different contributing atoms: the possibilities must be edited for the different experiment types e.g. 13 C-edited NOESY: F1/F3 = 13 CH only; F2 = any 1 H Starting from two extended chains with ideal geometry not lying on top of each other (bias starting structures) Starting from the free structures do not bias initial intermolecular possibilities with orientation.
20 Cdc42-21 kda small G protein of the Rho family GTP cofactor replaced by GMPPNP PAK - 5kDa fragment - can be expressed as GST-fusion K d ~ 30nM Samples: 15 N Cdc42 + unlabelled PAK 15 N, 13 C Cdc42 + unlabelled PAK 15 N PAK + unlabelled Cdc42 15 N, 13 C PAK + unlabelled Cdc42 no deuteration required - all experiments worked 3D X-filtered, 13 C-edited NOESY ran on 13 C, 15 N PAK, unlabelled Cdc42
21 13 C-separated NOESY (intra- and intermolecular) 13 C-filtered, 13 C-separated NOESY (inter-molecular only)
22 Summary of Cdc42/PAK Intermolecular NOEs Unambiguous Ambiguous 13 C-filter/ 13 C-edited C-NOESY (PAK) C-NOESY (Cdc42) N-NOESY (PAK) N-NOESY (Cdc42) 7 12 Total Intermolecular Total number of NOEs = 4,000
23
24 HR1b domain of PRK1 complexed with Rac1 small GTPase HR1b Rac1
25 Hr1b/Rac1 (30 kda) Correlation time ~20 nsec 100% deuteration for backbone assignment of Rac (methyl protonation too expensive) HR1b 13 C/ 15 N labelling only Department of Biochemistry University of Cambridge
26 Methyl group intermolecular NOEs Department of Biochemistry University of Cambridge
27 X-filter artifacts -dispersive diagonal Department of Biochemistry University of Cambridge
28 0 0 Arg Cδ/Hδ 1 1 Hγ Hδ Hδ X-filter artifacts water exchange peaks - incomplete suppression of strong crosspeaks H 2 O Department of Biochemistry University of Cambridge
29 HR1b/Rac Very few NOEs in X-filter experiments on HR1b side (9 out of 62) HR1b proton shifts overlapped No aromatics in interface Only 2 Rac residues in the interface have methyl groups Interaction between two helices - no intermolecular NOEs in 15 N- separated NOESY ( 2 H Rac/ 1 H HR1b) Department of Biochemistry University of Cambridge
30 X-filter experiments work best for hydrophobic interfaces, with methyl groups and aromatics For larger complexes, -CH3 and flexible residues give NOEs (ILV approaches should help) For interfaces dominated by salt bridges the NOEs in the 13 C-separated X-filter experiment will be extremely sparse Intermolecular β-sheet interfaces - 15 N-separated NOESY on 100% 2 H/ 15 N labelled protein mixed with unlabelled partner Department of Biochemistry University of Cambridge
31 Cross-saturation Takahashi et al (2000) Nat. Struc. Biol Protein II Protein I Strong binding case R.F. -NH -CH - 15 NH -C 2 H Band-selective proton saturation, followed by TROSY-HSQC cross-saturation Saturate the aliphatics of protein II - magnetization transferred by spin diffusion to the aromatics and amides. Cross-saturation to the 15 NH in the interface on protein I Measure intensity in HSQC vs time of saturation to find residues in interface More precise than chemical shift mapping Drawbacks Cys-SH also saturated, transferred within protein I Spin diffusion between NH in protein I Department of Biochemistry University of Cambridge
32 Using NMR data for docking Structures of components are known Use NMR data to map binding contacts or determine relative orientation of components
33 Sec5 NMR Structure ~0.5Å RMSD C N
34 Sec5/Ral Titration - all slow exchange 1:0 1:0.5 1:1.0
35 Definition of Residues in the Contact Site Pick all the peaks in free and bound and calculate combined shift difference in 15 N and 1 H shifts, often defined as: [( 15 N) ( 1 H) 2 ] 1/2 Define significant chemical shift perturbation (>1 SD from average shift change) - add in the ones that have disappeared completely Check for solvent accessibility (e.g. NACCESS): NHs that are completely buried are unlikely to be involved in the interaction but are experiencing secondary effects, unless there is a significant structural change (should be obvious from the HSQC). NACCESS cutoff: if the residue is more than 50% exposed it is available for interaction.
36 Shift changes after accessibility filtering
37 Using Chemical Shift Mapping Data for Docking (HADDOCK) Take significant shift changes, screened by solvent accessibility Active residues Take residues close to active residues on the surface Passive residues Ambiguous interactive restraint (AIR) N atoms N res B N atoms ( ) (-1/6) d iab = Σ Σ Σ 1 d 6 m ia =1 k=1 n kb =1 m ia n kb between any atom m of active residue i in protein A (m ia ) and any atom n of both active and passive residues k (N res total) of protein B (n kb ) and inversely for protein B. For each active residue (i) in A, restraint to any active or passive residue (k) in B, over all atoms and vice versa. Dominguez et al (2003) J Am Chem Soc
38 HADDOCK calculation strategy (i) Randomization of orientations and rigid body energy minimization (ii) Semi-rigid simulated annealing (iii) Refinement with explicit solvent Models clustered by interaction energies (E elec, E vdw, E AIR ) and average buried surface area Lowest energy cluster with the highest buried surface area assumed to be correct Can also add RDCs, inter-molecular NOEs and radius of gyration term to prevent expansion at the interface (Clore(2003) JACS )
39 Sec5: chemical shift mapping data (active) and nearest neighbours (passive) Ral: 3 mutations published (active) switch regions (passive) Ral: model based on Ras Lowest energy/highest buried SA cluster Second lowest was 180 rotation Ral Sec5
40 Haddock-derived model 2.1Å Crystal Structure Ral Sec5 Ral Sec5
41 Acknowledgements Darerca Owen Louise Hopkins HR1b/Rac complex Rakhee Modha Daniel Nietlispach Ernest Laue Cdc42/PAK Angela Morreale Meenakshi Venkatesan Sec5 Jacques Camonis Medical Research Council NMR Facility: BBSRC Wellcome Trust
Protein-protein interactions by NMR
Protein-protein interactions by NMR Fast k on,off >> (ν free - ν bound ) A + B k on k off AB k on,off ~ (ν free - ν bound ) Slow k on,off
More informationPROTEIN NMR SPECTROSCOPY
List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear
More informationPrinciples of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination
1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1
More informationDeuteration: Structural Studies of Larger Proteins
Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated
More informationResonance assignments in proteins. Christina Redfield
Resonance assignments in proteins Christina Redfield 1. Introduction The assignment of resonances in the complex NMR spectrum of a protein is the first step in any study of protein structure, function
More informationLabelling strategies in the NMR structure determination of larger proteins
Labelling strategies in the NMR structure determination of larger proteins - Difficulties of studying larger proteins - The effect of deuteration on spectral complexity and relaxation rates - NMR expts
More informationUsing NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017
Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:
More informationNMR in Medicine and Biology
NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR
More informationTriple Resonance Experiments For Proteins
Triple Resonance Experiments For Proteins Limitations of homonuclear ( 1 H) experiments for proteins -the utility of homonuclear methods drops quickly with mass (~10 kda) -severe spectral degeneracy -decreased
More information3D NMR 3D NMR 3D NMR. Visualising 3D NMR spectra. strip plots. preparation mixing mixing t1 t2 t3 I S T I
3D NMR 3D NMR Chris Waudby c.waudby@ucl.ac.uk 3D NMR Visualising 3D NMR spectra preparation mixing mixing t1 t2 t3 I S T I 2 indirect dimensions, independently incremented evolution times Much longer acquisition
More informationProtein NMR. Bin Huang
Protein NMR Bin Huang Introduction NMR and X-ray crystallography are the only two techniques for obtain three-dimentional structure information of protein in atomic level. NMR is the only technique for
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.
More informationHADDOCK: High Ambiguity
Determination of Protein-Protein complexes HADDOCK: High Ambiguity Driven DOCKing A protein-protein docking approach based on biochemical and/or biophysical data In PDB: >15000 protein structures but
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear
More informationProtein NMR. Part III. (let s start by reviewing some of the things we have learned already)
Protein NMR Part III (let s start by reviewing some of the things we have learned already) 1. Magnetization Transfer Magnetization transfer through space > NOE Magnetization transfer through bonds > J-coupling
More informationFiltered/edited NOESY spectra
Filtered/edited NOESY spectra NMR Seminar HS 207 Nina Ripin 22..7 Overview NMR of biomolecular complexes Problems and Solutions Filtered/edited nomenclature Experimental elements NOESY vs filtered pulse
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble
More informationFinding Bonds, H-bonds
Finding Bonds, H-bonds A hydrogen bond (HB) allows chunks of peptide relatively far away from each other to come close together. They are all over the place in globular proteins, so if we could identify
More information- Basic understandings: - Mapping interactions:
NMR-lecture April 6th, 2009, FMP Berlin Outline: Christian Freund - Basic understandings: Relaxation Chemical exchange - Mapping interactions: -Chemical shift mapping (fast exchange) Linewidth analysis
More informationSUPPLEMENTARY INFORMATION
5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.
More informationIntroduction solution NMR
2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics
More informationNMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins
Lecture #2 M230 NMR parameters intensity chemical shift coupling constants Juli Feigon 1D 1 H spectra of nucleic acids and proteins NMR Parameters A. Intensity (area) 1D NMR spectrum: integrated intensity
More informationAccurate Characterisation of Weak Protein- Protein Interactions by Titration of NMR Residual Dipolar Couplings
Accurate Characterisation of Weak Protein- Protein Interactions by Titration of NMR Residual Dipolar Couplings Jose Luis Ortega-Roldan, Malene Ringkjøbing Jensen*, Bernhard Brutscher, Ana I. Azuaga, Martin
More informationNMR in Structural Biology
NMR in Structural Biology Exercise session 2 1. a. List 3 NMR observables that report on structure. b. Also indicate whether the information they give is short/medium or long-range, or perhaps all three?
More information1. 3-hour Open book exam. No discussion among yourselves.
Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear
More informationBiochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationSequential resonance assignments in (small) proteins: homonuclear method 2º structure determination
Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield
More informationSequential Assignment Strategies in Proteins
Sequential Assignment Strategies in Proteins NMR assignments in order to determine a structure by traditional, NOE-based 1 H- 1 H distance-based methods, the chemical shifts of the individual 1 H nuclei
More informationName: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10
Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Instructions: This is an open book, limited time, exam. You may use notes you have from class and any text book you find useful. You may also use
More informationSensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
More informationInterpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
More informationSupplementary Figure 1.
a b c d e f g 1 Supplementary Figure 1. Identification of unfolded regions in the Chz1-H2A.Z-H2B complex and structure and dynamics of Chz.core-sH2B_H2A.Z. (a) 1 H- 15 N HSQC spectrum of Chz1. All backbone
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationHSQC spectra for three proteins
HSQC spectra for three proteins SH3 domain from Abp1p Kinase domain from EphB2 apo Calmodulin What do the spectra tell you about the three proteins? HSQC spectra for three proteins Small protein Big protein
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationLongitudinal-relaxation enhanced fast-pulsing techniques: New tools for biomolecular NMR spectroscopy
Longitudinal-relaxation enhanced fast-pulsing techniques: New tools for biomolecular NMR spectroscopy Bernhard Brutscher Laboratoire de Résonance Magnétique Nucléaire Institut de Biologie Structurale -
More informationI690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy
I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice
More informationJeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07
NMR Spectroscopy Jeff Grinstead NMR Spectroscopy NMR for structural biology Challenges for determining protein structures using NMR Proteins have thousands of signals Assign the specific signal for each
More informationHow to study the structure and dynamics of protein-rna complexes by NMR spectroscopy
Biomolecular NMR Spectroscopy A.J. Dingley and S.M. Pascal (Eds.) IOS Press, 2011 2011 The authors and IOS Press. All rights reserved. doi:10.3233/978-1-60750-695-9-249 249 How to study the structure and
More informationProtein Structure Determination using NMR Spectroscopy. Cesar Trinidad
Protein Structure Determination using NMR Spectroscopy Cesar Trinidad Introduction Protein NMR Involves the analysis and calculation of data collected from multiple NMR techniques Utilizes Nuclear Magnetic
More informationBasic principles of multidimensional NMR in solution
Basic principles of multidimensional NMR in solution 19.03.2008 The program 2/93 General aspects Basic principles Parameters in NMR spectroscopy Multidimensional NMR-spectroscopy Protein structures NMR-spectra
More information1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )
Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,
More informationProtein dynamics from NMR Relaxation data
Protein dynamics from NMR Relaxation data Clubb 3/15/17 (S f2 ) ( e ) Nitrogen-15 relaxation ZZ-exchange R 1 = 1/T 1 Longitudinal relaxation (decay back to z-axis) R 2 = 1/T 2 Spin-spin relaxation (dephasing
More informationNMR-spectroscopy in solution - an introduction. Peter Schmieder
NMR-spectroscopy in solution - an introduction 2/92 Advanced Bioanalytics NMR-Spectroscopy Introductory session (11:00 12:30) Basic aspects of NMR-spectroscopy NMR parameter Multidimensional NMR-spectroscopy
More informationProtein-protein interactions (PPIs) via NMR. Paola Turano
Protein-protein interactions (PPIs) via NMR Paola Turano turano@cerm.unifi.it The magnetic field at the The chemical shift nucleus (the effective field) is generally less than the applied field by a fraction
More informationA.D.J. van Dijk "Modelling of biomolecular complexes by data-driven docking"
Chapter 3. Various strategies of using Residual Dipolar Couplings in NMRdriven protein docking: application to Lys48-linked di-ubiquitin and validation against 15 N-relaxation data. Aalt D.J. van Dijk,
More informationBasics of NMR Spectroscopy. Mark Maciejewski Nov 29, 2016
Basics of NMR Spectroscopy Mark Maciejewski markm@uchc.edu Nov 29, 2016 What is Spectroscopy? Spectroscopy is the study of the interaction of electromagnetic radiation (light) with matter. NMR uses electromagnetic
More informationTheory and Applications of Residual Dipolar Couplings in Biomolecular NMR
Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of
More informationUsing cryoprobes to decrease acquisition times of triple-resonance experiments used for protein resonance assignments
Spectroscopy 17 (2003) 161 167 161 IOS Press Using cryoprobes to decrease acquisition times of triple-resonance experiments used for protein resonance assignments Michael J. Goger a,, James M. McDonnell
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin
More informationEasy, Robust and Accurate NMR Analysis of Biomolecules using BioPack
Easy, Robust and Accurate NMR Analysis of Biomolecules using BioPack Technical Overview Author George Gray Agilent Technologies Santa Rosa, CA USA Introduction In the last fi fteen years, scientists have
More informationProtein-protein interactions (PPIs) via NMR. Paola Turano
Protein-protein interactions (PPIs) via NMR Paola Turano turano@cerm.unifi.it The magnetic field at the The chemical shift nucleus (the effective field) is generally less than the applied field by a fraction
More informationStructural determination of biomolecular interfaces by nuclear magnetic resonance of proteins with reduced proton density
J Biomol NMR (2010) 47:41 54 DOI 10.1007/s10858-010-9409-9 ARTICLE Structural determination of biomolecular interfaces by nuclear magnetic resonance of proteins with reduced proton density Fabien Ferrage
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/NCHEM.1299 Protein fold determined by paramagnetic magic-angle spinning solid-state NMR spectroscopy Ishita Sengupta 1, Philippe S. Nadaud 1, Jonathan J. Helmus 1, Charles D. Schwieters 2
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 Helical Hairpin Structure of a potent Antimicrobial Peptide MSI-594 in Lipopolysaccharide Micelles by NMR Anirban
More informationExperimental Techniques in Protein Structure Determination
Experimental Techniques in Protein Structure Determination Homayoun Valafar Department of Computer Science and Engineering, USC Two Main Experimental Methods X-Ray crystallography Nuclear Magnetic Resonance
More informationSupporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
More informationChemical Exchange and Ligand Binding
Chemical Exchange and Ligand Binding NMR time scale Fast exchange for binding constants Slow exchange for tight binding Single vs. multiple binding mode Calcium binding process of calcium binding proteins
More informationStructural characterization of complexes using NOESY experiments
Structural characterization of complexes using NOESY experiments Isotope labeling ( 3 C, 5 N) allows observation of individual components of a (binary) complex) H, 3 C, 5 N H, 3 C, 5 N 2 H/ H, 2 C, 4 N
More informationNMR Resonance Assignment Assisted by Mass Spectrometry
NMR Resonance Assignment Assisted by Mass Spectrometry This lecture talked about a NMR resonance assignment assisted by mass spectrometry [1, 2]. 1 Motivation Nuclear magnetic resonance (NMR) provides
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice David Baker Autumn Quarter 2014 Slides Courtesy of Gabriele Varani Recommended NMR Textbooks Derome, A. E. (1987) Modern NMR Techniques for Chemistry Research,
More informationEffects of Chemical Exchange on NMR Spectra
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More informationActa Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural basis of the heterodimerization of the MST and RASSF SARAH domains in the Hippo signalling
More informationMagic-Angle Spinning (MAS) drive bearing
Magic-Angle Spinning (MAS) magic-angle spinning is done pneumatically spinning frequency can be stabilized within a few Hz Magic-Angle Spinning (MAS) drive bearing Magic-Angle Spinning (MAS) Maximum spinning
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4-5pm and SFL 229, Monday 3/5 4-5:30pm. 1. NMR
More informationNMR Assay of Purity and Folding
NMR Assay of Purity and Folding Don t Need Resonance Assignments or Labeling 1D requires only 10-50 µm protein concentration 2D Provides A More Detailed Assay 15 N- 1 H HSQC 1 H COSY 13 C HSQC also! Analyze
More information8.2 The Nuclear Overhauser Effect
8.2 The Nuclear Overhauser Effect Copyright Hans J. Reich 2016 All Rights Reserved University of Wisconsin An important consequence of DD relaxation is the Nuclear Overhauser Effect, which can be used
More informationNMR-spectroscopy of proteins in solution. Peter Schmieder
NMR-spectroscopy of proteins in solution Basic aspects of NMR-Spektroskopie Basic aspects of NMR-spectroscopy 3/84 Prerequisite for NMR-spectroscopy is a nuclear spin that can be thought of as a mixture
More informationSupporting Information
Supporting Information Ellena et al. 10.1073/pnas.0908317106 SI Experimental Procedures Protein Expression and Sample Preparation. Syb(1 96) and Syb(1 116) from Rattus norvegicus were expressed in BL21(DE3)
More informationAssignment of Heme Resonances and. High- and Low-Spin Nitrophorin 2 by 1 H and. Order of Heme Methyl Resonances in High- Spin Ferriheme Proteins
Supplementary Material for: Assignment of Heme Resonances and Determination of the Electronic Structures of High- and Low-Spin Nitrophorin 2 by 1 H and 13 C NMR Spectroscopy: An Explanation of the Order
More informationBiochemistry,530:,, Introduc5on,to,Structural,Biology, Autumn,Quarter,2015,
Biochemistry,530:,, Introduc5on,to,Structural,Biology, Autumn,Quarter,2015, Course,Informa5on, BIOC%530% GraduateAlevel,discussion,of,the,structure,,func5on,,and,chemistry,of,proteins,and, nucleic,acids,,control,of,enzyma5c,reac5ons.,please,see,the,course,syllabus,and,
More informationEffects of Chemical Exchange on NMR Spectra
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More informationMagnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A
Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy
More informationThe wonderful world of NUCLEIC ACID NMR!
Lecture 12 M230 Feigon Sequential resonance assignments in DNA (and RNA): homonuclear method 2 structure determination Reading resources Evans Chap 9 The wonderful world of NUCLEIC ACID NMR! Catalytically
More informationNMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease
University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile
More informationNuclear Magnetic Resonance Spectrum of Deamino-Lysine-Vasopressin in Aqueous Solution and Its Structural Implications
Proc. Nat. Acad. Sci. USA Vol. 69, No. 11, pp. 3322-3326, November 1972 Nuclear Magnetic Resonance Spectrum of Deamino-Lysine-Vasopressin in Aqueous Solution and Its Structural Implications P. H. VON DREELE,
More informationTHE NUCLEAR OVERHAUSER EFFECT IN STRUCTURAL AND CONFORMATIONAL ANALYSIS
THE NUCLEAR OVERHAUSER EFFECT IN STRUCTURAL AND CONFORMATIONAL ANALYSIS David Neuhaus and Michael P. Williamson VCH CONTENTS Preface v Acknowledgments vii Symbols, Abbreviations, and Units xvii Introduction
More informationCOSY type experiments exploring through-bond homonuclear correlations
COSY type experiments exploring through-bond homonuclear correlations Assistant Professor Kenneth Kongstad Bioanalytical Chemistry and Metabolomics Research Group Section for Natural Products and Peptides
More informationSolid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum,
Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum, 16.02.2009 Solid-state and solution NMR spectroscopy have many things in common Several concepts have been/will
More informationBiophysical Journal, Volume 96. Supporting Material
Biophysical Journal, Volume 96 Supporting Material NMR dynamics of PSE-4 β-lactamase: an interplay of ps-ns order and μs-ms motions in the active site Sébastien Morin and Stéphane M. Gagné NMR dynamics
More informationMolecular Modeling lecture 2
Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography
More informationProtein Structure Determination Using NMR Restraints BCMB/CHEM 8190
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationNuclear Magnetic Resonance (NMR)
Nuclear Magnetic Resonance (NMR) E E increases with increasing magnetic field strength Boltzmann distribution at thermal equilibrium: N (m=-1/2) /N (m=+1/2) = e ( E/kT) with E = γ(h/2π)b o NMR Physical
More informationMacromolecular X-ray Crystallography
Protein Structural Models for CHEM 641 Fall 07 Brian Bahnson Department of Chemistry & Biochemistry University of Delaware Macromolecular X-ray Crystallography Purified Protein X-ray Diffraction Data collection
More informationSolving the three-dimensional solution structures of larger
Accurate and rapid docking of protein protein complexes on the basis of intermolecular nuclear Overhauser enhancement data and dipolar couplings by rigid body minimization G. Marius Clore* Laboratory of
More informationNMR Spectroscopy: A Quantum Phenomena
NMR Spectroscopy: A Quantum Phenomena Pascale Legault Département de Biochimie Université de Montréal Outline 1) Energy Diagrams and Vector Diagrams 2) Simple 1D Spectra 3) Beyond Simple 1D Spectra 4)
More informationTips & Tricks around temperature
Tips & Tricks around temperature 40. NMR Benutzertagung 2016 Karlsruhe Frank Schumann Bruker BioSpin AG, Schweiz Innovation with Integrity Temperature in NMR NMR experiments are sensitive to small changes
More informationApplications of the NOE in Molecular Biology
CHAPTER 3 Applications of the NOE in Molecular Biology Mike P. Williamson Contents 1. Introduction 78 2. The Basics 78 2.1. NOE theory 78 2.2. Macromolecular structure determination 83 2.3. Dynamics from
More informationResidual Dipolar Couplings BCMB/CHEM 8190
Residual Dipolar Couplings BCMB/CHEM 8190 Recent Reviews Prestegard, A-Hashimi & Tolman, Quart. Reviews Biophys. 33, 371-424 (2000). Bax, Kontaxis & Tjandra, Methods in Enzymology, 339, 127-174 (2001)
More informationGuided Prediction with Sparse NMR Data
Guided Prediction with Sparse NMR Data Gaetano T. Montelione, Natalia Dennisova, G.V.T. Swapna, and Janet Y. Huang, Rutgers University Antonio Rosato CERM, University of Florance Homay Valafar Univ of
More informationChapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR
The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain
More informationEvaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example
Biochemistry 2000, 39, 13365-13375 13365 Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example Xuemei Huang,
More informationPROTEIN'STRUCTURE'DETERMINATION'
PROTEIN'STRUCTURE'DETERMINATION' USING'NMR'RESTRAINTS' BCMB/CHEM'8190' Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationAutomated Projection Spectroscopy and Its Applications
Top Curr Chem (2012) 316: 21 48 DOI: 10.1007/128_2011_189 # Springer-Verlag Berlin Heidelberg 2011 Published online: 28 June 2011 Automated Projection Spectroscopy and Its Applications Sebastian Hiller
More informationUse of deuterium labeling in NMR: overcoming a sizeable problem Michael Sattler and Stephen W Fesik*
Ways & Means 1245 Use of deuterium labeling in NMR: overcoming a sizeable problem Michael Sattler and Stephen W Fesik* Address: Abbott Laboratories, 47G AP10,100, Abbott Park Road, Abbott Park, IL 60064-3500,
More informationSpectroscopy in Organic Chemistry. Types of Spectroscopy in Organic
Spectroscopy in Organic Chemistry Spectroscopy Spectrum dealing with light, or more specifically, radiation Scope to see Organic Spectroscopy therefore deals with examining how organic molecules interact
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/3/4/e1600663/dc1 Supplementary Materials for A dynamic hydrophobic core orchestrates allostery in protein kinases Jonggul Kim, Lalima G. Ahuja, Fa-An Chao, Youlin
More informationSolution Structure of Syrian Hamster Prion Protein rprp(90-231)
5362 Biochemistry 1999, 38, 5362-5377 Solution Structure of Syrian Hamster Prion Protein rprp(90-231) He Liu, Shauna Farr-Jones, Nikolai B. Ulyanov, Manuel Llinas, Susan Marqusee, Darlene Groth, Fred E.
More informationAlgorithms for analysis of NMR projections: Design, implementation and applications
Thesis for the degree of doctor of Philosophy Algorithms for analysis of NMR projections: Design, implementation and applications Jonas Fredriksson Department of Chemistry University of Gothenburg Sweden
More informationStructural basis for catalytically restrictive dynamics of a high-energy enzyme state
Supplementary Material Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Michael Kovermann, Jörgen Ådén, Christin Grundström, A. Elisabeth Sauer-Eriksson, Uwe H. Sauer
More information