Structural insights into bacterial flagellar hooks similarities and specificities
|
|
|
- Lester Washington
- 5 years ago
- Views:
Transcription
1 Supplementary information Structural insights into bacterial flagellar hooks similarities and specificities Young-Ho Yoon, Clive S. Barker, Paula V. Bulieris, Hideyuki Matsunami, Fadel A. Samatey* Affiliation: Trans-Membrane Trafficking Unit, Okinawa Institute of Science and Technology Graduate University, , Tancha, Onna, Kunigami, Okinawa , Japan. * Address correspondence to Fadel A. Samatey: bakary.macy.samatey@gmail.com 1
2 Table S1. Strains of bacteria and plasmids. Strain or plasmid Genotype or description Reference or source Escherichia coli NovaBlue NEB 5-alpha BL21(DE3) B834(DE3)/pRARE K-12 strain derivative for routine molecular cloning applications K-12 strain derivative used in conjunction with Gibson assembly cloning kits E. coli B T7 protein-expression strain; Lon and OmpT protease deficient E. coli B T7 protein-expression strain; OmpT protease deficient; methionine auxotroph; Rare codon expression; Cam R Novagen, USA New England Biolabs, USA Novagen, USA Novagen, USA Salmonella enterica serovar Typhimurium SJW1103 JR501 Wild-type for motility and chemotaxis; LT2 (fljb-off) Δ(hin-fljAB) For converting plasmids to Salmonella compatibility. Restriction minus, modification plus (27) (35) TT13206 LT7 phon51::tn10-11(tet R ) (36) TMTflgEtetRA flge(1-168)22591::tetra::flge( ) This study TMT233a flge(1-168)22592::flge C. jejuni NCTC (233- This study 618)::flgE( ) TMT233b flge(1-168)22593::flge C. jejuni NCTC ( :: This study )::flgE( ) Plasmid pet-28b(+) + FlgEcc32 pet-28b(+) derivative carrying codons of the Caulobacter crescentus flge gene to express FlgEcc32 This study pkd46 Bacteriophage λ Red expression plasmid, Amp R (37) 2
3 Table S2. Oligonucleotide primers. Name Sequence (5' to 3') Template Primers used to make FlgEcc32 expression vector by Xho I and BamH I restriction enzyme digestion of DNA followed by ligation using T4 DNA ligase: Fd-flgEcc32 gggcccctcgagatggccgagaagaccacccgc C. crescentus CB15 Rv-flgEcc32 gggcccggatccttagccgttggtgttcaccga C C. crescentus CB15 Primers used to make strain TMTflgEtetRA: Fd-flgE-tetRA Rv-flgE-tetRA gatcaacctgaactcaacggaccctgtaccgtc taaaacgttaagacccactttcacatt cttttttgttatacgaatccgcatcactcacgc taaagggctaagcacttgtctcctg TT13206 genomic DNA TT13206 genomic DNA Primers used to make strain TMT233a and strain TMT233b: Fd-CampyflgE233 Rv-CampyflgE619 gatcaacctgaactcaacggaccctgtaccgtc taaaacgggtgtggatgcgggatcactt cttttttgttatacgaatccgcatcactcacgc taaagggaagttgttcgctttctttgatctgat TTC C. jejuni NCTC C. jejuni NCTC Primers used to make strain TMT233b: Fd-CampyflgE439 Rv-CampyflgE262 atcttatgcagatgcaataataacagcacataa ATATATTTATAGTTCAAAC tatgtgctgttattattgcatctgcataagata CCCAAATTC C. jejuni NCTC C. jejuni NCTC
4 Supplementary Figure S1. Domain delimitation in C. crescentus and C. jejuni. Hydrophobic amino acids, represented by gray spheres, are superimposed on a cartoon representation of FlgEcc32 (cyan) (a) and of FlgEcj79 (purple) (b). Four distinct domains are identifiable: D1, D2, D3, D4. D4 can be divided into two sub-domains, D4a and D4b. 4
5 Supplementary Figure S2. Sequence alignment of full-length FlgE proteins of S. enterica, C. crescentus and C. jejuni. Salen = S. enterica serovar Typhimurium LT2 FlgE (NCBI Reference Sequence: NP_ ); Camje = C. jejuni subsp. jejuni NCTC FlgE (NCBI Reference Sequence: YP_ ); and Caucr = C. crescentus CB15 FlgE (NCBI Reference Sequence: NP_ ). Domain D0, which participates in the coiled-coil interaction, is in gray. Domains D1 and D2, found in each of these bacteria, are in yellow and green, respectively. Domain D3, found in C. jejuni and C. crescentus, is in red. Domain D4, which exists only in C. jejuni, is in cyan. Amino acid sequences of proteins were aligned using Clustal Omega 38, and secondary structure rendering used ESPript
6 Supplementary Figure S3. Structural comparison of FlgE from C. crescentus, C. jejuni, and S. enterica. Alignment of domains D1 (RMSD 1.4 Å) (a) and domains D2 (RMSD 1.6 Å) (b) of FlgE from C. jejuni (green) and S. enterica (gray). N191 and K619 indicate where the D3 and D4 domains were removed from the C. jejuni chain. Alignment of domains D2 of FlgE from C. crescentus (magenta) and S. enterica (gray) with an RMSD of 1.7 Å (c) and from C. crescentus (magenta) and C. jejuni (green) with an RMSD of 0.9 Å (d). V183 and P329 show where the D3 domain was removed from the C. crescentus chain. 6
7 Supplementary Figure S4. Structure alignment. Superimposition of structures of FlgE protein of C. crescentus in the crystal (in green) and in the hook after docking (in magenta). The alignment is based on domain D2. 7
8 Supplementary Figure S5. Construction of FlgEhyb1. The chimeric FlgE protein, FlgEhyb1, was designed by inserting domains D3 and D4 from FlgE of C. jejuni (a) between Thr167 and Pro168 located in domain D2 of FlgE of S. enterica (b). Domains D1 and D2 are common to all hook proteins. The hook protein of C. jejuni, with additional domains D3 and D4, is larger than a normal hook protein composed only of domains D1 and D2. It is surprising that domains D3 and D4 can be inserted with no disturbance to the remainder of the quaternary structure of the hook and without altering its function. 8
9 Supplementary Figure S6. Free-swimming speed of the wild-type S. enterica strain SJW1103 and the FlgE chimera mutant strain TMT233a in solutions of increasing viscosity. Solution viscosity was increased using increasing concentrations of ficoll PM400. Swimming speed was determined for more than 40 cells using a microscope fitted with dark-field optics and a video recording system. Mean swimming speeds and standard deviations are shown. Measurements were done at around 23 C. 9
10 Supplementary Figure S7. Diameter distribution of the hooks. S. enterica strain wild-type SJW1103 (a), TMT233a (b), and C. jejuni (c). The hook diameters were measured from negatively-stained images obtained by electron microscopy using software ImageJ 40. Average hook diameter sizes and the standard deviation values are shown in each panel. 10
11 Supplementary Movie S1. Motility of S. enterica wild-type and strain TMT233a. The left panel displays the motility of S. enterica strain SJW1103 (wild type). The right panel shows strain TMT233a, which has a hybrid hook made of S. enterica FlgE grafted with domains D3 and D4 of C. jejuni FlgE. 11
Optimization of the heme biosynthesis pathway for the production of. 5-aminolevulinic acid in Escherichia coli
Supplementary Information Optimization of the heme biosynthesis pathway for the production of 5-aminolevulinic acid in Escherichia coli Junli Zhang 1,2,3, Zhen Kang 1,2,3, Jian Chen 2,3 & Guocheng Du 2,4
Supporting Information
Supporting Information Sana et al. 10.1073/pnas.1608858113 Fig. S1. Representation of the SPI-6 type VI secretion system. (A) Representation of the SPI-6 genetic locus starting at STM0266 and ending at
Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier
Supplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions
Supplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions undergo endocytosis into clathrin-coated vesicles dependent
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Chemical structure of LPS and LPS biogenesis in Gram-negative bacteria. a. Chemical structure of LPS. LPS molecule consists of Lipid A, core oligosaccharide and O-antigen. The polar
GENETICS - CLUTCH CH.11 TRANSLATION.
!! www.clutchprep.com CONCEPT: GENETIC CODE Nucleotides and amino acids are translated in a 1 to 1 method The triplet code states that three nucleotides codes for one amino acid - A codon is a term for
Design of an Enterobacteriaceae Pan-genome Microarray Chip
Design of an Enterobacteriaceae Pan-genome Microarray Chip Oksana Lukjancenko and David W. Ussery DTU CBS 2010 2 Background Pan-genome complete collection of variuos genes located within populations at
Molecular Mechanisms of self-assembly and motion of the bacterial flagellum
Molecular Mechanisms of self-assembly and motion of the bacterial flagellum Mexico-Japan Workshop on Pharmacobiology and Nanobiology Universidad Nacional Autonoma de México (UNAM) Mexico City, Mexico 2009.02.25-26
SUPPLEMENTARY INFORMATION
SUPPLMTARY IFORMATIO a doi:10.108/nature10402 b 100 nm 100 nm c SAXS Model d ulers assigned to reference- Back-projected free class averages class averages Refinement against single particles Reconstructed
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON
PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter
SUPPLEMENTARY INFORMATION
Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic
ydci GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC
Table S1. DNA primers used in this study. Name ydci P1ydcIkd3 Sequence GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC Kd3ydcIp2 lacz fusion YdcIendP1 YdcItrgP2 GAC AGC
Functional expression of the entire adhesiome of Salmonella enterica. serotype Typhimurium
Supplementary information for Functional expression of the entire adhesiome of Salmonella enterica serotype Typhimurium Nicole Hansmeier 1, Katarzyna Miskiewicz 1, Laura Elpers 1, Viktoria Liss 1, Michael
Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1
Name I. Multiple Choice (1 point each) Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 B 1. Which is possessed by eukaryotes but not by prokaryotes? A. Cell wall B. Distinct nucleus
cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work
SUPPLEMENTARY INFORMATION Table S1. List of strains Strains Genotype Source B. subtilis PY79 Prototrophic derivative of B. subtilis 168 (60) RL1070 spovid::kan (12) HS176 cotz phs2 (cotz-gfp spc) (22)
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
Supplementary Figure 1 Mycobacterium tuberculosis WhiB1 expressed in Mycobacterium smegmatis possesses an O 2 -stable [4Fe-4S] cluster.
![Supplementary Figure 1 Mycobacterium tuberculosis WhiB1 expressed in Mycobacterium smegmatis possesses an O 2 -stable [4Fe-4S] cluster.](/thumbs/80/81296835.jpg "Supplementary Figure 1 Mycobacterium tuberculosis WhiB1 expressed in Mycobacterium smegmatis possesses an O 2 -stable [4Fe-4S] cluster.")
Supplementary Figure 1 Mycobacterium tuberculosis WhiB1 expressed in Mycobacterium smegmatis possesses an O 2 -stable [4Fe-4S] cluster. a, Absorbance spectra of WhiB1 isolated from recombinant M. smegmatis
Cells and the Stuff They re Made of. Indiana University P575 1
Cells and the Stuff They re Made of Indiana University P575 1 Goal: Establish hierarchy of spatial and temporal scales, and governing processes at each scale of cellular function: o Where does emergent
Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent
Acta Cryst. (2015). D71, doi:10.1107/s1399004714026595 Supporting information Volume 71 (2015) Supporting information for article: Structural insights into Aspergillus fumigatus lectin specificity - AFL
Lecture 25: Protein Synthesis Key learning goals: Be able to explain the main stuctural features of ribosomes, and know (roughly) how many DNA and
Lecture 25: Protein Synthesis Key learning goals: Be able to explain the main stuctural features of ribosomes, and know (roughly) how many DNA and protein subunits they contain. Understand the main functions
Fitness constraints on horizontal gene transfer
Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:
Supplementary Figure 3 a. Structural comparison between the two determined structures for the IL 23:MA12 complex. The overall RMSD between the two
Supplementary Figure 1. Biopanningg and clone enrichment of Alphabody binders against human IL 23. Positive clones in i phage ELISA with optical density (OD) 3 times higher than background are shown for
SUPPLEMENTARY FIGURES. Structure of the cholera toxin secretion channel in its. closed state
SUPPLEMENTARY FIGURES Structure of the cholera toxin secretion channel in its closed state Steve L. Reichow 1,3, Konstantin V. Korotkov 1,3, Wim G. J. Hol 1$ and Tamir Gonen 1,2$ 1, Department of Biochemistry
Topology. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.
Topology 1 Introduction 2 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 G+C content 7 Codon usage 27 marc.bailly-bechet@univ-lyon1.fr The big picture Eukaryota Bacteria Many linear chromosomes
SUPPLEMENTARY INFORMATION
Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1
Introduction to Molecular and Cell Biology
Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What
2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology
2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the
Microbial Genetics, Mutation and Repair. 2. State the function of Rec A proteins in homologous genetic recombination.
Answer the following questions 1. Define genetic recombination. Microbial Genetics, Mutation and Repair 2. State the function of Rec A proteins in homologous genetic recombination. 3. List 3 types of bacterial
Analysis of Escherichia coli amino acid transporters
Ph.D thesis Analysis of Escherichia coli amino acid transporters Presented by Attila Szvetnik Supervisor: Dr. Miklós Kálmán Biology Ph.D School University of Szeged Bay Zoltán Foundation for Applied Research
Supplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization
Supplementary Information Structural basis for precursor protein-directed ribosomal peptide macrocyclization Kunhua Li 1,3, Heather L. Condurso 1,3, Gengnan Li 1, Yousong Ding 2 and Steven D. Bruner 1*
What is the central dogma of biology?
Bellringer What is the central dogma of biology? A. RNA DNA Protein B. DNA Protein Gene C. DNA Gene RNA D. DNA RNA Protein Review of DNA processes Replication (7.1) Transcription(7.2) Translation(7.3)
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps
Cell Reports Supplemental Information Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps Chih-Chia Su, Jani Reddy Bolla, Nitin Kumar, Abhijith Radhakrishnan,
Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
SUPPLEMENTARY INFORMATION
Data collection Supplementary Table 1 Statistics of data collection, phasing and refinement Native Se-MAD Space group P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 50.4, 94.2, 115.4 49.8, 94.2,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
MICROBIOLOGIA GENERALE. Structure and function of prokaryotic cells 3
MICROBIOLOGIA GENERALE Structure and function of prokaryotic cells 3 Structure and function of prokaryotic cells: in the cytosol The bacterial chromosome is typically one large circular molecule of DNA
Vital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655)
We still consider the E. coli genome as a fairly typical bacterial genome, and given the extensive information available about this organism and it's lifestyle, the E. coli genome is a useful point of
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2
Three-dimensional structure of a viral genome-delivery portal vertex
Three-dimensional structure of a viral genome-delivery portal vertex Adam S. Olia 1, Peter E. Prevelige Jr. 2, John E. Johnson 3 and Gino Cingolani 4 1 Department of Biological Sciences, Purdue University,
Chapter 19. Microbial Taxonomy
Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
SULFIDE-INDOLE-MOTILITY (SIM) TEST
Microbiology Laboratory (BIOL 3702L) Page 1 of 5 Principle and Purpose SULFIDE-INDOLE-MOTILITY (SIM) TEST Using Sulfide-Indole-Motility (SIM) media, various Gram-negative enteric bacilli can be distinguished
Biology 112 Practice Midterm Questions
Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,
Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
PCR-based Restriction Fragment Length Polymorphism for Subtyping of Salmonella from Chicken Isolates
Kasetsart J. (Nat. Sci.) 44 : 79-83 (2010) PCR-based Restriction Fragment Length Polymorphism for Subtyping of Salmonella from Chicken Isolates Han Yu Jong 1, Pak Thae Su 1, Pannatee Sanpong 2, Worawidh
m1 m2 m3 m4 m5 m6 m7 m8 wt m m m m m m m m8 - + wt +
otherwise, you couldn't grow them!) You perform pairwise infections with each of your mutant bacteriophage strains and get the following results: (+) = pair of phages lysed host cells, (-) = pair of phages
Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
Acta Cryst. (2014). D70, doi: /s
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021166 Supporting information Volume 70 (2014) Supporting information for article: Elucidation of the bicarbonate binding site and insights into the carboxylation
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted
It s really this simple.
Background Light harvesting complexes exist to facilitate and maximize the absorption capacity of the reaction centers (RC) as well as PSI and PSII Purple bacteria utilize these functions by having an
SUPPLEMENTARY INFORMATION
Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature17991 Supplementary Discussion Structural comparison with E. coli EmrE The DMT superfamily includes a wide variety of transporters with 4-10 TM segments 1. Since the subfamilies of the
Protein Structure. W. M. Grogan, Ph.D. OBJECTIVES
Protein Structure W. M. Grogan, Ph.D. OBJECTIVES 1. Describe the structure and characteristic properties of typical proteins. 2. List and describe the four levels of structure found in proteins. 3. Relate
Bio Microbiology - Spring 2014 Learning Guide 04.
Bio 230 - Microbiology - Spring 2014 Learning Guide 04 http://pessimistcomic.blogspot.com/ Cell division is a part of a replication cycle that takes place throughout the life of the bacterium A septum
BACTERIA AND ARCHAEA 10/15/2012
BACTERIA AND ARCHAEA Chapter 27 KEY CONCEPTS: Structural and functional adaptations contribute to prokaryotic success Rapid reproduction, mutation, and genetic recombination promote genetic diversity in
Supplementary Information for Hurst et al.: Causes of trends of amino acid gain and loss
Supplementary Information for Hurst et al.: Causes of trends of amino acid gain and loss Methods Identification of orthologues, alignment and evolutionary distances A preliminary set of orthologues was
Supplementary Information. Autocatalytic backbone N-methylation in a family of ribosomal peptide natural products
Supplementary Information Autocatalytic backbone -methylation in a family of ribosomal peptide natural products iels S. van der Velden 1, oemi Kälin 1, Maximilian J. Helf 1, Jörn Piel 1, Michael F. Freeman
Bio Microbiology - Spring 2012 Learning Guide 04.
Bio 230 - Microbiology - Spring 2012 Learning Guide 04 http://pessimistcomic.blogspot.com/ A septum assembles at the center of the cell. This molecular "purse string" is linked to the inner surface of
The flagellar motor of Caulobacter crescentus generates more torque when a cell swims backwards
The flagellar motor of Caulobacter crescentus generates more torque when a cell swims backwards Pushkar P. Lele a1, Thibault Roland a, Abhishek Shrivastava a, Yihao Chen and Howard C. Berg a Affiliations:
Properties of amino acids in proteins
Properties of amino acids in proteins one of the primary roles of DNA (but not the only one!) is to code for proteins A typical bacterium builds thousands types of proteins, all from ~20 amino acids repeated
Time-dependence of key H-bond/electrostatic interaction distances in the sirna5-hago2 complexes... Page S14
Supporting Information Probing the Binding Interactions between Chemically Modified sirnas and Human Argonaute 2 Using Microsecond Molecular Dynamics Simulations S. Harikrishna* and P. I. Pradeepkumar*
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary
SUPPLEMENTARY INFORMATION
Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95
Genetic Basis of Variation in Bacteria
Mechanisms of Infectious Disease Fall 2009 Genetics I Jonathan Dworkin, PhD Department of Microbiology jonathan.dworkin@columbia.edu Genetic Basis of Variation in Bacteria I. Organization of genetic material
Reading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
THE THIRD GENERAL TRANSPORT SYSTEM BRANCHED-CHAIN AMINO ACIDS IN SALMONELLA T YPHIMURI UM KEIKO MATSUBARA, KUNIHARU OHNISHI, AND KAZUYOSHI KIRITANI
J. Gen. Appl. Microbiol., 34, 183-189 (1988) THE THIRD GENERAL TRANSPORT SYSTEM BRANCHED-CHAIN AMINO ACIDS IN SALMONELLA T YPHIMURI UM FOR KEIKO MATSUBARA, KUNIHARU OHNISHI, AND KAZUYOSHI KIRITANI Department
Please complete the Participant Card
Flower Forensics 1 Please complete the Participant Card 2 Put your student hat on Experience the kit Put your teacher hat on Envision classroom use Curriculum integration Support for students 3 Flower
T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp
S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S
Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein
Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08
Bacterial strains, plasmids, and growth conditions. Bacterial strains and
I Text I Materials and Methods acterial strains, plasmids, and growth conditions. acterial strains and plasmids used in this study are listed in I Table. almonella enterica serovar Typhimurium strains
SUPPLEMENTARY INFORMATION
GP2 Type I-piliated bacteria FAE M cell M cell pocket idc T cell mdc Generation of antigenspecific T cells Induction of antigen-specific mucosal immune response Supplementary Figure 1 Schematic diagram
Supplemental Data SUPPLEMENTAL FIGURES
Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de
A pentose bisphosphate pathway for nucleoside degradation in Archaea. Engineering, Kyoto University, Katsura, Nishikyo-ku, Kyoto , Japan.
SUPPLEMENTARY INFORMATION A pentose bisphosphate pathway for nucleoside degradation in Archaea Riku Aono 1,, Takaaki Sato 1,, Tadayuki Imanaka, and Haruyuki Atomi 1, * 7 8 9 10 11 1 Department of Synthetic
Supplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1)
MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) 1) Which of the following statements about the atom A) It has 12 neutrons in its nucleus. B) It
Acta Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae
Genomics and bioinformatics summary. Finding genes -- computer searches
Genomics and bioinformatics summary 1. Gene finding: computer searches, cdnas, ESTs, 2. Microarrays 3. Use BLAST to find homologous sequences 4. Multiple sequence alignments (MSAs) 5. Trees quantify sequence
of the Guanine Nucleotide Exchange Factor FARP2
Structure, Volume 21 Supplemental Information Structural Basis for Autoinhibition of the Guanine Nucleotide Exchange Factor FARP2 Xiaojing He, Yi-Chun Kuo, Tyler J. Rosche, and Xuewu Zhang Inventory of
Using Higher Calculus to Study Biologically Important Molecules Julie C. Mitchell
Using Higher Calculus to Study Biologically Important Molecules Julie C. Mitchell Mathematics and Biochemistry University of Wisconsin - Madison 0 There Are Many Kinds Of Proteins The word protein comes
Supplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins
Chemistry & Biology, Volume 22 Supplemental Information Molecular Basis of Spectral Diversity in Near-Infrared Phytochrome-Based Fluorescent Proteins Daria M. Shcherbakova, Mikhail Baloban, Sergei Pletnev,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),
MOLECULAR CELL BIOLOGY
1 Lodish Berk Kaiser Krieger scott Bretscher Ploegh Matsudaira MOLECULAR CELL BIOLOGY SEVENTH EDITION CHAPTER 13 Moving Proteins into Membranes and Organelles Copyright 2013 by W. H. Freeman and Company
MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Figure 2.1
Exam Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Figure 2.1 1) Which compound in Figure 2.1 is an ester? 1) A) a b c d e Answer: D 2) A scientist
Enzyme Evolution across Bacterial Species
University of Colorado, Boulder CU Scholar Undergraduate Honors Theses Honors Program Spring 2016 Enzyme Evolution across Bacterial Species JohnCarlo L. Kristofich University of Colorado, Boulder, jokr4044@colorado.edu
Ch 10. Classification of Microorganisms
Ch 10 Classification of Microorganisms Student Learning Outcomes Define taxonomy, taxon, and phylogeny. List the characteristics of the Bacteria, Archaea, and Eukarya domains. Differentiate among eukaryotic,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11419 Supplementary Figure 1 Schematic representation of innate immune signaling pathways induced by intracellular Salmonella in cultured macrophages. a, During the infection Salmonella
NOTE: Questions are written on both sides of the sheets of paper making up this exam booklet!
Biology 1010 Section A Midterm 1 January 30, 2008 (print): ANSWER KEY Name (signature): Student I.D. #: Time: 50 minutes Read the following instructions: 1. Do not open the examination until you are instructed
F. Piazza Center for Molecular Biophysics and University of Orléans, France. Selected topic in Physical Biology. Lecture 1
Zhou Pei-Yuan Centre for Applied Mathematics, Tsinghua University November 2013 F. Piazza Center for Molecular Biophysics and University of Orléans, France Selected topic in Physical Biology Lecture 1
Shape, Arrangement, and Size. Cocci (s., coccus) bacillus (pl., bacilli) 9/21/2013
Shape, Arrangement, and Size Cocci (s., coccus) are roughly spherical cells. The other common shape is that of a rod, sometimes called a bacillus (pl., bacilli). Spiral-shaped procaryotes can be either
Translation Part 2 of Protein Synthesis
Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation
Cloning and sequencing of hfq (host factor required for synthesis of bacteriophage Q beta RNA) gene of Salmonella Typhimurium isolated from poultry
Veterinary World, EISSN: 2231-0916 RESEARCH ARTICLE Open Access Cloning and sequencing of hfq (host factor required for synthesis of bacteriophage Q beta RNA) gene of Salmonella Typhimurium isolated from
SI Text S1 Solution Scattering Data Collection and Analysis. SI references
SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.
Denaturation and renaturation of proteins
Denaturation and renaturation of proteins Higher levels of protein structure are formed without covalent bonds. Therefore, they are not as stable as peptide covalent bonds which make protein primary structure
08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega
BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments
allosteric cis-acting DNA element coding strand dominant constitutive mutation coordinate regulation of genes denatured
A B C D E F G H I J K L M N O P Q R S T U V W X Y Z AA BB CC DD EE FF GG HH II JJ KK LL MM NN OO PP QQ RR SS TT UU VV allosteric cis-acting DNA element coding strand codominant constitutive mutation coordinate
Full-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
Supplementary Methods Protein expression and purification Full-length GlpG sequence was generated by PCR from E. coli genomic DNA (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),