Shape Based Indexing For Faster Search Of RNA Family Databases
|
|
- Jerome Patrick
- 6 years ago
- Views:
Transcription
1 For Faster Search Of RNA Family Databases Stefan Janssen Jens Reeder Robert Giegerich 26. April 2008
2 RNA homology Why? build homologous groups find new group members How? sequence & structure
3 Covariance Models used in Rfam sequence & structure analog to HMMs base pairing expensive runtime: O ( N 4), N = sequence length R = #families (607 in Rfam) One query against Rfam = O ( R N 4) 20 min.
4 Abstract shapes approach thermodynamical folding + abstraction many levels of abstraction ignore primary sequence homologue = share a common shape shapes are composed of: [ ]
5 Shape based filter families represented by shapes store shapes in a data structure calculate shape for query string use query shape to search for correct family fast: O ( N 3) Problems: several families share same shape several shapes within one family sometimes sequence matters...
6 Abstract shapes approach Arrangement of helices adjacency embedding As trees adjacency = sibling nodes embedding = parent - child relation
7 Tree representation
8 Tree representation HL Hairpin-Loop: C UAGC G
9 Tree representation IL HL Internal loop: A G x G U
10 Tree representation IL HL three stacked regions: C x G and G x C and U x A
11 Tree representation SS SS E IL HL Single stranded regions CC and A + adjacency
12 Primary sequence SS SS E IL HL primary sequence: CCCGUAGCUAGCGGUACGA
13 Shape string: [[ ]] SS SS E IL HL [ ] HL base left, region, base right = [ ]
14 Shape string: [[ ]] SS SS E IL [ ] [] IL base left, region left, structure, region right, base right = [ + +structure + + ]
15 Shape string: [[ ]] SS SS E [[]] base left, structure, base right = structure
16 Shape string: [[ ]] SS [[]] SS E SS region = E = ɛ
17 Shape string: [[ ]] [[]] structure left, structure right = [ structure left + +structure right ]
18 General workflow of an 1 compute family shape spectrum fss (f ), f Rfam 2 merge all fss (f ) into a suitable data structure I Rfam 3 compute a query shape spectrum qss (x), for a given query x 4 access I Rfam to determine the match set: M(x) = {f qss(x) fss(f ) } 5 if M(x) = end, otherwise execute cmsearch f (x) f M(x)
19 Family shape spectra fss (f ) 1 1-SS cons-shape-index: fss(f ) = {π(ss cons)} f = family, x = sequence, π(x) = shape
20 Family shape spectra fss (f ) 1 1-SS cons-shape-index: fss(f ) = {π(ss cons)} 2 1-Consensus-shape-index: fss(f ) = rankmin{ x f RNAshapes(0, π, x)} f = family, x = sequence, π(x) = shape
21 Family shape spectra fss (f ) 1 1-SS cons-shape-index: fss(f ) = {π(ss cons)} 2 1-Consensus-shape-index: fss(f ) = rankmin{ x f RNAshapes(0, π, x)} 3 1-Hybrid-shape-index: fss(f ) = {fss(f ) Consensus fss(f ) SS cons } f = family, x = sequence, π(x) = shape
22 Family shape spectra fss (f ) Union-shape-index: fss(f ) = {π (rnafold C (SS cons, x)) x f } f = family, x = sequence, π(x) = shape
23 Family shape spectra fss (f ) 1 1-SS cons-shape-index: fss(f ) = {π(ss cons)} 2 1-Consensus-shape-index: fss(f ) = rankmin{ x f RNAshapes(0, π, x)} 3 1-Hybrid-shape-index: fss(f ) = {fss(f ) Consensus fss(f ) SS cons } 4 Union-shape-index: fss(f ) = {π (rnafold C (SS cons, x)) x f } 5 k-best-shape-index: fss(f ) = x f RNAshapes(k, π, x) f = family, x = sequence, π(x) = shape
24 Query shape spectra qss (x) 1 1-shape-spectrum: qss(x) = RNAshapes(1, π, x) 2 k-best-shape-spectrum: qss(x) = RNAshapes(k, π, x) f = family, x = sequence, π(x) = shape
25 Further Improvements 1 Multilevel Abstraction [_[_[_]]_[_[_]_]]_ [[_[]][_[]_]] [[[]][[]]] [[][[]]] [[][]]
26 Further Improvements 1 Multilevel Abstraction 2 Using folding energies Coronavirus packaging signal (RF00182) UnaL2 LINE 3' element (RF00436) Hepatitis C virus stem-loop VII (RF00468) common shape for all sequences: single hairpin = [] number of sequences GC = 0.57 GC = 0.55 GC = length normalized energies
27 Further Improvements 1 Multilevel Abstraction 2 Using folding energies 3 Omitting difficult families
28 k-best-shape-index 1-SS_cons-shape-index 1-consensus-shape-index 1-hybrid-shape-index 1-union-shape-index 1-RNAalifold-shape-index k-rnalishapes-shape-index cmsearch --hmmfilter
29 Thanks for your attention is available at:
30 CGUCUUAAACUCAUCACCGUGUGGAGCUGCGACCCUUCCCUAGAUUCGAAGACGAG ((((((...(((..(((...))))))...(((..((...))..))))))))).. Shape Type 5: [[][]] Shape Type 4: [[][[]]] Shape Type 3: [[[]][[]]] Shape Type 2: [[ []][ [] ]] Shape Type 1: [ [ [ ]] [ [ ] ]] 20 C U G U G G A G G C* A* C* C* U* * C U A 10 C C 30 A * U G U G C * C * G C A A C U U C * * A G A U C C U 40 A 50 A U* A U* G C* A U* C 56 G* 1 G A C * G 1
31
32 [[[[]]]][[[]]] [[][]][][] [[[]][[[]]]] [[][[][]]] 53,116 more shapes 12,156 more shapes [][[[[]]]] [] _[_[_[]]]_ >Query: hg17_ct_rnazset190_s5031 _[_[_[_[_[]]_[_[]_]_]_]_]_[] [_[_[_[_[]]_[_[]_]_]_]_]_[] _[_[_[_[_[]]_[_[]_]]_]_]_[]_ [_[_[[_[]][_[]_]]_]_][] [[_[_[[_[]][_[]_]]_]_][]] [_[]_][_[_[[_[]_][]]_]_] [[[[[]][[]]]]][] [[[[[[]][[]]]]][]] [[]][[[[[]][]]]] 112,489 more shapes [[[_[_[]_]_]_]_] [_[[_[[]_]_]_]]_ [_[_[_[]_]_]_][_[_[]_]] 93,840 more shapes [[_[_[[_[]][_[]_]]_]_][]] [_[]_][_[_[[_[]_][]]_]_] [[[[[]][[]]]]][] 59,337 more shapes [[[[[[]][[]]]]][]] [[]][[[[[]][]]]]
33 cmsearch HMM-filter BLAST-filter
34
RNA Basics. RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U. Bases can only pair with one other base. wobble pairing. 23 Hydrogen Bonds more stable
RNA STRUCTURE RNA Basics RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U wobble pairing Bases can only pair with one other base. 23 Hydrogen Bonds more stable RNA Basics transfer RNA (trna) messenger
More information98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006
98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006 8.3.1 Simple energy minimization Maximizing the number of base pairs as described above does not lead to good structure predictions.
More informationCS681: Advanced Topics in Computational Biology
CS681: Advanced Topics in Computational Biology Can Alkan EA224 calkan@cs.bilkent.edu.tr Week 10 Lecture 1 http://www.cs.bilkent.edu.tr/~calkan/teaching/cs681/ RNA folding Prediction of secondary structure
More informationBioinformatics Advance Access published July 14, Jens Reeder, Robert Giegerich
Bioinformatics Advance Access published July 14, 2005 BIOINFORMATICS Consensus Shapes: An Alternative to the Sankoff Algorithm for RNA Consensus Structure Prediction Jens Reeder, Robert Giegerich Faculty
More informationRNA Abstract Shape Analysis
ourse: iegerich RN bstract nalysis omplete shape iegerich enter of Biotechnology Bielefeld niversity robert@techfak.ni-bielefeld.de ourse on omputational RN Biology, Tübingen, March 2006 iegerich ourse:
More informationRNA Structure Prediction and Comparison. RNA folding
RNA Structure Prediction and Comparison Session 3 RNA folding Faculty of Technology robert@techfak.uni-bielefeld.de Bielefeld, WS 2013/2014 Base Pair Maximization This was the first structure prediction
More informationRNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17
RNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17 Dr. Stefan Simm, 01.11.2016 simm@bio.uni-frankfurt.de RNA secondary structures a. hairpin loop b. stem c. bulge loop d. interior loop e. multi
More informationBIOINF 4120 Bioinforma2cs 2 - Structures and Systems -
BIOINF 4120 Bioinforma2cs 2 - Structures and Systems - Oliver Kohlbacher Summer 2014 3. RNA Structure Part II Overview RNA Folding Free energy as a criterion Folding free energy of RNA Zuker- SCegler algorithm
More informationINF2220: algorithms and data structures Series 1
Universitetet i Oslo Institutt for Informatikk I. Yu, D. Karabeg INF2220: algorithms and data structures Series 1 Topic Function growth & estimation of running time, trees (Exercises with hints for solution)
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri RNA Structure Prediction Secondary
More informationCombinatorial approaches to RNA folding Part II: Energy minimization via dynamic programming
ombinatorial approaches to RNA folding Part II: Energy minimization via dynamic programming Matthew Macauley Department of Mathematical Sciences lemson niversity http://www.math.clemson.edu/~macaule/ Math
More informationAlgebraic Dynamic Programming. Solving Satisfiability with ADP
Algebraic Dynamic Programming Session 12 Solving Satisfiability with ADP Robert Giegerich (Lecture) Stefan Janssen (Exercises) Faculty of Technology Summer 2013 http://www.techfak.uni-bielefeld.de/ags/pi/lehre/adp
More informationPredicting RNA Secondary Structure Using Profile Stochastic Context-Free Grammars and Phylogenic Analysis
Fang XY, Luo ZG, Wang ZH. Predicting RNA secondary structure using profile stochastic context-free grammars and phylogenic analysis. JOURNAL OF COMPUTER SCIENCE AND TECHNOLOGY 23(4): 582 589 July 2008
More informationPredicting RNA Secondary Structure
7.91 / 7.36 / BE.490 Lecture #6 Mar. 11, 2004 Predicting RNA Secondary Structure Chris Burge Review of Markov Models & DNA Evolution CpG Island HMM The Viterbi Algorithm Real World HMMs Markov Models for
More informationRNA Search and! Motif Discovery" Genome 541! Intro to Computational! Molecular Biology"
RNA Search and! Motif Discovery" Genome 541! Intro to Computational! Molecular Biology" Day 1" Many biologically interesting roles for RNA" RNA secondary structure prediction" 3 4 Approaches to Structure
More informationA Structure-Based Flexible Search Method for Motifs in RNA
JOURNAL OF COMPUTATIONAL BIOLOGY Volume 14, Number 7, 2007 Mary Ann Liebert, Inc. Pp. 908 926 DOI: 10.1089/cmb.2007.0061 A Structure-Based Flexible Search Method for Motifs in RNA ISANA VEKSLER-LUBLINSKY,
More information08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega
BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments
More informationCONTRAfold: RNA Secondary Structure Prediction without Physics-Based Models
Supplementary Material for CONTRAfold: RNA Secondary Structure Prediction without Physics-Based Models Chuong B Do, Daniel A Woods, and Serafim Batzoglou Stanford University, Stanford, CA 94305, USA, {chuongdo,danwoods,serafim}@csstanfordedu,
More informationCombinatorial approaches to RNA folding Part I: Basics
Combinatorial approaches to RNA folding Part I: Basics Matthew Macauley Department of Mathematical Sciences Clemson University http://www.math.clemson.edu/~macaule/ Math 4500, Spring 2015 M. Macauley (Clemson)
More informationDigital search trees JASS
Digital search trees Analysis of different digital trees with Rice s integrals. JASS Nicolai v. Hoyningen-Huene 28.3.2004 28.3.2004 JASS 04 - Digital search trees 1 content Tree Digital search tree: Definition
More informationRNA secondary structure prediction. Farhat Habib
RNA secondary structure prediction Farhat Habib RNA RNA is similar to DNA chemically. It is usually only a single strand. T(hyamine) is replaced by U(racil) Some forms of RNA can form secondary structures
More informationSnoPatrol: How many snorna genes are there? Supplementary
SnoPatrol: How many snorna genes are there? Supplementary materials. Paul P. Gardner 1, Alex G. Bateman 1 and Anthony M. Poole 2,3 1 Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton,
More informationRNA Secondary Structure Prediction
RN Secondary Structure Prediction Perry Hooker S 531: dvanced lgorithms Prof. Mike Rosulek University of Montana December 10, 2010 Introduction Ribonucleic acid (RN) is a macromolecule that is essential
More informationCOMBINATORICS OF LOCALLY OPTIMAL RNA SECONDARY STRUCTURES
COMBINATORICS OF LOCALLY OPTIMAL RNA SECONDARY STRUCTURES ÉRIC FUSY AND PETER CLOTE Abstract. It is a classical result of Stein and Waterman that the asymptotic number of RNA secondary structures is 1.104366
More informationCSE182-L7. Protein Sequence Analysis Patterns (regular expressions) Profiles HMM Gene Finding CSE182
CSE182-L7 Protein Sequence Analysis Patterns (regular expressions) Profiles HMM Gene Finding 10-07 CSE182 Bell Labs Honors Pattern matching 10-07 CSE182 Just the Facts Consider the set of all substrings
More informationProblem. Problem Given a dictionary and a word. Which page (if any) contains the given word? 3 / 26
Binary Search Introduction Problem Problem Given a dictionary and a word. Which page (if any) contains the given word? 3 / 26 Strategy 1: Random Search Randomly select a page until the page containing
More informationPattern Matching (Exact Matching) Overview
CSI/BINF 5330 Pattern Matching (Exact Matching) Young-Rae Cho Associate Professor Department of Computer Science Baylor University Overview Pattern Matching Exhaustive Search DFA Algorithm KMP Algorithm
More informationRapid Dynamic Programming Algorithms for RNA Secondary Structure
ADVANCES IN APPLIED MATHEMATICS 7,455-464 I f Rapid Dynamic Programming Algorithms for RNA Secondary Structure MICHAEL S. WATERMAN* Depurtments of Muthemutics und of Biologicul Sciences, Universitk of
More informationOECD QSAR Toolbox v.4.1. Tutorial illustrating new options for grouping with metabolism
OECD QSAR Toolbox v.4.1 Tutorial illustrating new options for grouping with metabolism Outlook Background Objectives Specific Aims The exercise Workflow 2 Background Grouping with metabolism is a procedure
More information2MHR. Protein structure classification is important because it organizes the protein structure universe that is independent of sequence similarity.
Protein structure classification is important because it organizes the protein structure universe that is independent of sequence similarity. A global picture of the protein universe will help us to understand
More informationGrundlagen der Bioinformatik Summer semester Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SS 10, D. Huson, April 12, 2010 1 1 Introduction Grundlagen der Bioinformatik Summer semester 2010 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a)
More informationSearching genomes for non-coding RNA using FastR
Searching genomes for non-coding RNA using FastR Shaojie Zhang Brian Haas Eleazar Eskin Vineet Bafna Keywords: non-coding RNA, database search, filtration, riboswitch, bacterial genome. Address for correspondence:
More informationComputational Approaches for determination of Most Probable RNA Secondary Structure Using Different Thermodynamics Parameters
Computational Approaches for determination of Most Probable RNA Secondary Structure Using Different Thermodynamics Parameters 1 Binod Kumar, Assistant Professor, Computer Sc. Dept, ISTAR, Vallabh Vidyanagar,
More informationA tutorial on RNA folding methods and resources
A tutorial on RNA folding methods and resources Alain Denise, LRI/IGM, Université Paris-Sud with invaluable help from Yann Ponty, CNRS/Ecole Polytechnique 1 Master BIBS 2014-2015 Goals To help your work
More informationClassified Dynamic Programming
Bled, Feb. 2009 Motivation Our topic: Programming methodology A trade-off in dynamic programming between search space design and evaluation of candidates A trade-off between modifying your code and adding
More informationDG/UX System. MAC Regions
DG/UX System Provides mandatory access controls MAC label identifies security level Default labels, but can define others Initially Subjects assigned MAC label of parent Initial label assigned to user,
More informationProperties of Context-Free Languages
Properties of Context-Free Languages Seungjin Choi Department of Computer Science and Engineering Pohang University of Science and Technology 77 Cheongam-ro, Nam-gu, Pohang 37673, Korea seungjin@postech.ac.kr
More informationSupporting Text 1. Comparison of GRoSS sequence alignment to HMM-HMM and GPCRDB
Structure-Based Sequence Alignment of the Transmembrane Domains of All Human GPCRs: Phylogenetic, Structural and Functional Implications, Cvicek et al. Supporting Text 1 Here we compare the GRoSS alignment
More informationLeast Random Suffix/Prefix Matches in Output-Sensitive Time
Least Random Suffix/Prefix Matches in Output-Sensitive Time Niko Välimäki Department of Computer Science University of Helsinki nvalimak@cs.helsinki.fi 23rd Annual Symposium on Combinatorial Pattern Matching
More informationCurrent; Forest Tree Theorem; Potential Functions and their Bounds
April 13, 2008 Franklin Kenter Current; Forest Tree Theorem; Potential Functions and their Bounds 1 Introduction In this section, we will continue our discussion on current and induced current. Review
More informationBio nformatics. Lecture 23. Saad Mneimneh
Bio nformatics Lecture 23 Protein folding The goal is to determine the three-dimensional structure of a protein based on its amino acid sequence Assumption: amino acid sequence completely and uniquely
More informationSequence Analysis and Databases 2: Sequences and Multiple Alignments
1 Sequence Analysis and Databases 2: Sequences and Multiple Alignments Jose María González-Izarzugaza Martínez CNIO Spanish National Cancer Research Centre (jmgonzalez@cnio.es) 2 Sequence Comparisons:
More informationComputing the partition function and sampling for saturated secondary structures of RNA, with respect to the Turner energy model
Computing the partition function and sampling for saturated secondary structures of RNA, with respect to the Turner energy model J. Waldispühl 1,3 P. Clote 1,2, 1 Department of Biology, Higgins 355, Boston
More informationFactorized Relational Databases Olteanu and Závodný, University of Oxford
November 8, 2013 Database Seminar, U Washington Factorized Relational Databases http://www.cs.ox.ac.uk/projects/fd/ Olteanu and Závodný, University of Oxford Factorized Representations of Relations Cust
More informationProtein folding. α-helix. Lecture 21. An α-helix is a simple helix having on average 10 residues (3 turns of the helix)
Computat onal Biology Lecture 21 Protein folding The goal is to determine the three-dimensional structure of a protein based on its amino acid sequence Assumption: amino acid sequence completely and uniquely
More informationA Browser for Pig Genome Data
A Browser for Pig Genome Data Thomas Mailund January 2, 2004 This report briefly describe the blast and alignment data available at http://www.daimi.au.dk/ mailund/pig-genome/ hits.html. The report describes
More informationAlgebraic Dynamic Programming
Algebraic Dynamic Programming Unit 2.b: Introduction to Bellman s GAP Robert Giegerich 1 (Lecture) Benedikt Löwes (Exercises) Faculty of Technology Bielefeld University http://www.techfak.uni-bielefeld.de/ags/pi/lehre/adp
More informationTaxonomical Classification using:
Taxonomical Classification using: Extracting ecological signal from noise: introduction to tools for the analysis of NGS data from microbial communities Bergen, April 19-20 2012 INTRODUCTION Taxonomical
More informationToday s Lecture: HMMs
Today s Lecture: HMMs Definitions Examples Probability calculations WDAG Dynamic programming algorithms: Forward Viterbi Parameter estimation Viterbi training 1 Hidden Markov Models Probability models
More informationSA-REPC - Sequence Alignment with a Regular Expression Path Constraint
SA-REPC - Sequence Alignment with a Regular Expression Path Constraint Nimrod Milo Tamar Pinhas Michal Ziv-Ukelson Ben-Gurion University of the Negev, Be er Sheva, Israel Graduate Seminar, BGU 2010 Milo,
More informationSemi-Supervised CONTRAfold for RNA Secondary Structure Prediction: A Maximum Entropy Approach
Wright State University CORE Scholar Browse all Theses and Dissertations Theses and Dissertations 2011 Semi-Supervised CONTRAfold for RNA Secondary Structure Prediction: A Maximum Entropy Approach Jianping
More informationGenomics and bioinformatics summary. Finding genes -- computer searches
Genomics and bioinformatics summary 1. Gene finding: computer searches, cdnas, ESTs, 2. Microarrays 3. Use BLAST to find homologous sequences 4. Multiple sequence alignments (MSAs) 5. Trees quantify sequence
More informationCSC 1700 Analysis of Algorithms: Warshall s and Floyd s algorithms
CSC 1700 Analysis of Algorithms: Warshall s and Floyd s algorithms Professor Henry Carter Fall 2016 Recap Space-time tradeoffs allow for faster algorithms at the cost of space complexity overhead Dynamic
More informationRNA and Protein Structure Prediction
RNA and Protein Structure Prediction Bioinformatics: Issues and Algorithms CSE 308-408 Spring 2007 Lecture 18-1- Outline Multi-Dimensional Nature of Life RNA Secondary Structure Prediction Protein Structure
More informationDNA/RNA Structure Prediction
C E N T R E F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U Master Course DNA/Protein Structurefunction Analysis and Prediction Lecture 12 DNA/RNA Structure Prediction Epigenectics Epigenomics:
More informationVariable Selection and Sensitivity Analysis via Dynamic Trees with an application to Computer Code Performance Tuning
Variable Selection and Sensitivity Analysis via Dynamic Trees with an application to Computer Code Performance Tuning Robert B. Gramacy University of Chicago Booth School of Business faculty.chicagobooth.edu/robert.gramacy
More informationChapter 5 Data Structures Algorithm Theory WS 2017/18 Fabian Kuhn
Chapter 5 Data Structures Algorithm Theory WS 2017/18 Fabian Kuhn Priority Queue / Heap Stores (key,data) pairs (like dictionary) But, different set of operations: Initialize-Heap: creates new empty heap
More informationDictionary: an abstract data type
2-3 Trees 1 Dictionary: an abstract data type A container that maps keys to values Dictionary operations Insert Search Delete Several possible implementations Balanced search trees Hash tables 2 2-3 trees
More informationWeek 10: Homology Modelling (II) - HHpred
Week 10: Homology Modelling (II) - HHpred Course: Tools for Structural Biology Fabian Glaser BKU - Technion 1 2 Identify and align related structures by sequence methods is not an easy task All comparative
More informationNon-context-Free Languages. CS215, Lecture 5 c
Non-context-Free Languages CS215, Lecture 5 c 2007 1 The Pumping Lemma Theorem. (Pumping Lemma) Let be context-free. There exists a positive integer divided into five pieces, Proof for for each, and..
More informationIntroduction to Polymer Physics
Introduction to Polymer Physics Enrico Carlon, KU Leuven, Belgium February-May, 2016 Enrico Carlon, KU Leuven, Belgium Introduction to Polymer Physics February-May, 2016 1 / 28 Polymers in Chemistry and
More informationProtein Structure Prediction and Display
Protein Structure Prediction and Display Goal Take primary structure (sequence) and, using rules derived from known structures, predict the secondary structure that is most likely to be adopted by each
More informationDetecting non-coding RNA in Genomic Sequences
Detecting non-coding RNA in Genomic Sequences I. Overview of ncrnas II. What s specific about RNA detection? III. Looking for known RNAs IV. Looking for unknown RNAs Daniel Gautheret INSERM ERM 206 & Université
More informationProtein Secondary Structure Prediction
part of Bioinformatik von RNA- und Proteinstrukturen Computational EvoDevo University Leipzig Leipzig, SS 2011 the goal is the prediction of the secondary structure conformation which is local each amino
More informationFibonacci (Min-)Heap. (I draw dashed lines in place of of circular lists.) 1 / 17
Fibonacci (Min-)Heap A forest of heap-order trees (parent priority child priority). Roots in circular doubly-linked list. Pointer to minimum-priority root. Siblings in circular doubly-linked list; parent
More informationEnhancing Active Automata Learning by a User Log Based Metric
Master Thesis Computing Science Radboud University Enhancing Active Automata Learning by a User Log Based Metric Author Petra van den Bos First Supervisor prof. dr. Frits W. Vaandrager Second Supervisor
More informationAlgebraic Dynamic Programming. Dynamic Programming, Old Country Style
Algebraic Dynamic Programming Session 2 Dynamic Programming, Old Country Style Robert Giegerich (Lecture) Stefan Janssen (Exercises) Faculty of Technology Summer 2013 http://www.techfak.uni-bielefeld.de/ags/pi/lehre/adp
More informationOECD QSAR Toolbox v.4.1. Step-by-step example for predicting skin sensitization accounting for abiotic activation of chemicals
OECD QSAR Toolbox v.4.1 Step-by-step example for predicting skin sensitization accounting for abiotic activation of chemicals Background Outlook Objectives The exercise Workflow 2 Background This is a
More informationSpeculative Parallelism in Cilk++
Speculative Parallelism in Cilk++ Ruben Perez & Gregory Malecha MIT May 11, 2010 Ruben Perez & Gregory Malecha (MIT) Speculative Parallelism in Cilk++ May 11, 2010 1 / 33 Parallelizing Embarrassingly Parallel
More informationDe novo prediction of structural noncoding RNAs
1/ 38 De novo prediction of structural noncoding RNAs Stefan Washietl 18.417 - Fall 2011 2/ 38 Outline Motivation: Biological importance of (noncoding) RNAs Algorithms to predict structural noncoding RNAs
More informationSupplementary Material
Supplementary Material Sm-I Formal Description of the Sampling Process In the sequel, given an RNA molecule r consisting of n nucleotides, we denote the corresponding sequence fragment from position i
More informationTowards a Comprehensive Annotation of Structured RNAs in Drosophila
Towards a Comprehensive Annotation of Structured RNAs in Drosophila Rebecca Kirsch 31st TBI Winterseminar, Bled 20/02/2016 Studying Non-Coding RNAs in Drosophila Why Drosophila? especially for novel molecules
More informationNotes on Logarithmic Lower Bounds in the Cell Probe Model
Notes on Logarithmic Lower Bounds in the Cell Probe Model Kevin Zatloukal November 10, 2010 1 Overview Paper is by Mihai Pâtraşcu and Erik Demaine. Both were at MIT at the time. (Mihai is now at AT&T Labs.)
More informationA Method for Aligning RNA Secondary Structures
Method for ligning RN Secondary Structures Jason T. L. Wang New Jersey Institute of Technology J Liu, JTL Wang, J Hu and B Tian, BM Bioinformatics, 2005 1 Outline Introduction Structural alignment of RN
More informationMutual Information & Genotype-Phenotype Association. Norman MacDonald January 31, 2011 CSCI 4181/6802
Mutual Information & Genotype-Phenotype Association Norman MacDonald January 31, 2011 CSCI 4181/6802 2 Overview What is information (specifically Shannon Information)? What are information entropy and
More informationTurboFold II: RNA structural alignment and secondary structure prediction informed by multiple homologs
11570 11581 Nucleic Acids Research, 2017, Vol. 45, No. 20 Published online 28 September 2017 doi: 10.1093/nar/gkx815 TurboFold II: RNA structural alignment and secondary structure prediction informed by
More informationGenome 559 Wi RNA Function, Search, Discovery
Genome 559 Wi 2009 RN Function, Search, Discovery The Message Cells make lots of RN noncoding RN Functionally important, functionally diverse Structurally complex New tools required alignment, discovery,
More informationIntroduction to Comparative Protein Modeling. Chapter 4 Part I
Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature
More informationA graph kernel approach to the identification and characterisation of structured non-coding RNAs using multiple sequence alignment information
graph kernel approach to the identification and characterisation of structured noncoding RNs using multiple sequence alignment information Mariam lshaikh lbert Ludwigs niversity Freiburg, Department of
More information13 Comparative RNA analysis
13 Comparative RNA analysis Sources for this lecture: R. Durbin, S. Eddy, A. Krogh und G. Mitchison, Biological sequence analysis, Cambridge, 1998 D.W. Mount. Bioinformatics: Sequences and Genome analysis,
More informationBCB 444/544 Fall 07 Dobbs 1
BCB 444/544 Required Reading (before lecture) Lecture 25 Mon Oct 15 - Lecture 23 Protein Tertiary Structure Prediction Chp 15 - pp 214-230 More RNA Structure Wed Oct 17 & Thurs Oct 18 - Lecture 24 & Lab
More informationEfficient Reassembling of Graphs, Part 1: The Linear Case
Efficient Reassembling of Graphs, Part 1: The Linear Case Assaf Kfoury Boston University Saber Mirzaei Boston University Abstract The reassembling of a simple connected graph G = (V, E) is an abstraction
More informationLesson 3: Networks and Matrix Arithmetic
Opening Exercise Suppose a subway line also connects the four cities. Here is the subway and bus line network. The bus routes connecting the cities are represented by solid lines, and the subway routes
More informationSUPPLEMENTARY INFORMATION
Supplementary information S3 (box) Methods Methods Genome weighting The currently available collection of archaeal and bacterial genomes has a highly biased distribution of isolates across taxa. For example,
More information3. SEQUENCE ANALYSIS BIOINFORMATICS COURSE MTAT
3. SEQUENCE ANALYSIS BIOINFORMATICS COURSE MTAT.03.239 25.09.2012 SEQUENCE ANALYSIS IS IMPORTANT FOR... Prediction of function Gene finding the process of identifying the regions of genomic DNA that encode
More informationPure Multiple RNA Secondary Structure Alignments: A Progressive Profile Approach
IEEE TRANSACTIONS ON COMPUTATIONAL BIOLOGY AND BIOINFORMATICS, VOL. 1, NO. 1, JANUARY-MARCH 2004 1 Pure Multiple RNA Secondary Structure Alignments: A Progressive Profile Approach Matthias Höchsmann, Björn
More informationBayesian Networks: Construction, Inference, Learning and Causal Interpretation. Volker Tresp Summer 2016
Bayesian Networks: Construction, Inference, Learning and Causal Interpretation Volker Tresp Summer 2016 1 Introduction So far we were mostly concerned with supervised learning: we predicted one or several
More informationPhysiochemical Properties of Residues
Physiochemical Properties of Residues Various Sources C N Cα R Slide 1 Conformational Propensities Conformational Propensity is the frequency in which a residue adopts a given conformation (in a polypeptide)
More informationOn low energy barrier folding pathways for nucleic acid sequences
On low energy barrier folding pathways for nucleic acid sequences Leigh-Anne Mathieson and Anne Condon U. British Columbia, Department of Computer Science, Vancouver, BC, Canada Abstract. Secondary structure
More informationTutorial 4. Dynamic Set: Amortized Analysis
Tutorial 4 Dynamic Set: Amortized Analysis Review Binary tree Complete binary tree Full binary tree 2-tree P115 Unlike common binary tree, the base case is not an empty tree, but a external node Heap Binary
More informationENS Lyon Camp. Day 2. Basic group. Cartesian Tree. 26 October
ENS Lyon Camp. Day 2. Basic group. Cartesian Tree. 26 October Contents 1 Cartesian Tree. Definition. 1 2 Cartesian Tree. Construction 1 3 Cartesian Tree. Operations. 2 3.1 Split............................................
More informationIntelligent Systems (AI-2)
Intelligent Systems (AI-2) Computer Science cpsc422, Lecture 11 Oct, 3, 2016 CPSC 422, Lecture 11 Slide 1 422 big picture: Where are we? Query Planning Deterministic Logics First Order Logics Ontologies
More informationBayesian Networks: Construction, Inference, Learning and Causal Interpretation. Volker Tresp Summer 2014
Bayesian Networks: Construction, Inference, Learning and Causal Interpretation Volker Tresp Summer 2014 1 Introduction So far we were mostly concerned with supervised learning: we predicted one or several
More informationStructure-Based Comparison of Biomolecules
Structure-Based Comparison of Biomolecules Benedikt Christoph Wolters Seminar Bioinformatics Algorithms RWTH AACHEN 07/17/2015 Outline 1 Introduction and Motivation Protein Structure Hierarchy Protein
More informationPrediction of RNA secondary structure including kissing hairpin motifs
Prediction of RNA secondary structure including kissing hairpin motifs Corinna Theis, Stefan Janssen, and Robert Giegerich Faculty of Technology, Bielefeld University 33501 Bielefeld, Germany robert@techfak.uni-bielefeld.de
More informationNeural Networks for Protein Structure Prediction Brown, JMB CS 466 Saurabh Sinha
Neural Networks for Protein Structure Prediction Brown, JMB 1999 CS 466 Saurabh Sinha Outline Goal is to predict secondary structure of a protein from its sequence Artificial Neural Network used for this
More informationSUPPLEMENTARY MATERIALS
SUPPLEMENTARY MATERIALS Enhanced Recognition of Transmembrane Protein Domains with Prediction-based Structural Profiles Baoqiang Cao, Aleksey Porollo, Rafal Adamczak, Mark Jarrell and Jaroslaw Meller Contact:
More informationUsing distance geomtry to generate structures
Using distance geomtry to generate structures David A. Case Genomic systems and structures, Spring, 2009 Converting distances to structures Metric Matrix Distance Geometry To describe a molecule in terms
More informationAppendix of Computational Protein Design Using AND/OR Branch and Bound Search
Appendix of Computational Protein Design Using AND/OR Branch and Bound Search Yichao Zhou 1, Yuexin Wu 1, and Jianyang Zeng 1,2, 1 Institute for Interdisciplinary Information Sciences, Tsinghua University,
More informationAlgorithms in Bioinformatics FOUR Pairwise Sequence Alignment. Pairwise Sequence Alignment. Convention: DNA Sequences 5. Sequence Alignment
Algorithms in Bioinformatics FOUR Sami Khuri Department of Computer Science San José State University Pairwise Sequence Alignment Homology Similarity Global string alignment Local string alignment Dot
More information