Supplementary Figure 1 Analysis of beige fat and cells and characteristics of exosome release, related to Figure 1
|
|
|
- Madison Shana Phelps
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Analysis of beige fat and cells and characteristics of exosome release, related to Figure 1 (a) Fold-change in UCP-1 mrna abundance in white adipocytes upon β-adrenergic stimulation (NE) or WAT depots after cold exposure in mice compared to untreated cells or control tissue from mice at room temperature (RT). (b) Qualitative Western blot analysis of CD63, Hsp70 and Tubulin positive particles released from tissues and Cyt-c as cellular negative control (n=1). The exosomes were released from mice tissues exposed to cold (4 C) compared to RT controls. (c)tissue weights of cold exposed mice and controls (RT). (d) Absolute exosome numbers released from fat tissues of cold exposed mice and RT controls (RT). (e) Clustering of exosomal mirnas. Hierarchical clustering of mirnas in exosomes isolated from serum of mice either exposed to cold (cold) or treated with the β 3 receptor agonist CL-316,243 (CL) compared to vehicle injected control mice (wt), as well as of mirnas in exosomes released from brown adipocytes (BA) treated with camp (camp) or untreated
2 control cells (wt). Values are expressed as mean ± s.e.m. (unpaired, two-tailed t-test, P* 0.05, **P 0.01, ***P 0.001, n=6 mice per group or n=3 for cells).
3 Supplementary Figure 2 Validation of mirna candidates and HFD study, related to Figure 2
4 (a and b) qpcr analysis of the mirna candidates present in exosomes(a) released from untreated (wild type) and camp-treated (200 µm) cells, as compared to the cellular mirna expression (b) without and with camp treatment (200 µm). (c) Time-course of exosomal mir-92a release from brown adipocytes after camp stimulation. (d) Relative mir-92a abundance in mouse serum and BAT mass compared to cold exposure. (e) Inverse correlation of BAT mass with exosomal mir-92a abundance in mice, (Pearson s correlation, R 2 =0.57, P=0.004, n=12). (f) H&E Staining of paraffinsections of 16 week HFD and CD mice, large lipid droplets are indicated by black arrows (Scale bar: 100 µm). (g) BAT triglyceride content after 16 week HFD and CD mice (h) Total release of exosomal mir-92a from BAT tissues or serum of 16 week HFD mice versus CD mice. Values present mean ± s.e.m. (unpaired, two-tailed t-test, *P 0.05, **P 0.01, ***P 0.001, n=5-6 mice per group or n=3 for cells).
5 Supplementary Figure 3 Detailed analysis of mir-133a and mir-92a in exosomes from human serum, related to Figure 3 (a) mir-133a expression in human serum quantified by qpcr. Data was normalized to U6, and is presented as mean ± s.e.m. (unpaired, two-tailed t-test, n.s., not significant, n=11 per group). (b) Log 10 mir-133a value is not related to BAT SUVmean value (Pearson s correlation, R 2 =0.10, P=0.15, n=22). (c) Correlation of Log 10 transformed BAT SUVmean and Log 10 mir-92a (Pearson s correlation, R 2 =0.18, P=0.047, n=22); related to Fig. 3c. (d) Log 10 BAT SUVmax and Log 10 mir-92a correlation (Pearson s correlation, R 2 =0.25, P=0.018, n=22); related to Fig. 3d. (e) Correlation of BAT SUVmean and Log 10 mir-92a of acutely cold exposed subjects (Pearson s correlation, R 2 =0.21, P=0.08, n=15)
6 Supplementary Figure 4 Full display of Western blots, related to Figure 1 and Supplementary Figure 1 (a) Complete immunoblots of CD63, Hsp70, Tubulin (Tub) and Cytochrom-C (Cyt-c) utilized in Fig. 1b. Complete immunoblots of CD63, Hsp70, Tubulin (Tub) and Cytochrom-C (Cyt-c) utilized in Supplementary Fig. 1b (b) and (c).
7 mirna candidates cold CL camp mmu-mir-27a hsa-mir hsa-mir-93# mmu-mir mmu-mir rno-mir-146b mmu-mir mmu-mir-142-3p mmu-mir-876-3p mmu-mir-199a-3p rno-mir-450a mmu-mir mmu-mir mmu-mir-200b mmu-let-7e mmu-mir mmu-mir mmu-mir-200c mmu-mir-20a mmu-let-7g mmu-mir-34c# mmu-mir mmu-mir-30d mmu-mir-296-5p rno-mir-743b mmu-mir _mat hsa-mir-493-3p rno-mir mmu-mir-26a mmu-mir-125b-3p mmu-mir-30a mmu-mir mmu-mir-193b mmu-mir mmu-mir _mat mmu-mir-106b mmu-mir-26b mmu-mir hsa-mir mmu-mir _mat mmu-mir hsa-mir mmu-mir
8 mmu-mir-19b mmu-mir mmu-mir-30e mmu-mir mmu-mir-125a-5p mmu-mir mmu-mir-1937c _mat mmu-mir-30b mmu-mir mmu-mir _mat mmu-mir mmu-mir mmu-mir mmu-mir p _mat mmu-mir-1937b _mat rno-mir-7# mmu-mir p _mat mmu-mir mmu-mir rno-mir-25# mmu-mir-532-5p mmu-mir-615-5p mmu-mir hsa-mir-423-3p mmu-mir mmu-mir mmu-mir mmu-mir _mat mmu-mir mmu-mir-30c mmu-mir-151-3p mmu-mir-339-3p mmu-mir-669m _mat mmu-mir-101b mmu-mir-302a mmu-mir-532-3p mmu-mir _mat mmu-mir-297a# mmu-mir mmu-mir-883b-3p mmu-mir-376c mmu-mir-466k _mat rno-mir mmu-mir-331-5p mmu-mir hsa-mir
9 U6 snrna mmu-mir rno-mir-196c hsa-mir rno-mir _mat mmu-mir rno-mir mmu-mir _mat mmu-mir Mamm U mmu-mir-342-3p hsa-mir mmu-mir-374-5p mmu-mir-409-3p rno-mir mmu-mir _mat mmu-mir mmu-mir-139-5p mmu-mir mmu-mir mmu-mir-467b mmu-mir-146a mmu-mir mmu-mir _mat mmu-mir-196a# mmu-mir-141# mmu-mir _mat mmu-mir _mat mmu-mir mmu-mir _mat mmu-mir mmu-mir rno-mir mmu-mir-877# hsa-mir-200c rno-mir-190b mmu-mir mmu-mir-301a mmu-mir mmu-mir-465c-5p mmu-mir-24-2# mmu-mir-467b mmu-mir-92a hsa-mir-140-3p mmu-mir mmu-mir-467f
10 mmu-mir-188-3p rno-mir mmu-mir-574-3p mmu-mir _mat mmu-mir-1274a _mat mmu-mir-106a hsa-mir mmu-mir-181a-2# ath-mir159a mmu-mir-29a mmu-mir mmu-mir mmu-mir mmu-mir-470# mmu-mir _mat mmu-mir-29c mmu-mir _mat mmu-mir hsa-mir mmu-mir-466b-3-3p mmu-mir _mat mmu-mir-133a mmu-mir-467a mmu-mir-146b mmu-mir-19a mmu-mir-126-3p mmu-mir-743a mmu-mir-29b rno-mir mmu-mir-126-5p mmu-mir mmu-mir mmu-mir _mat mmu-mir-450b-5p mmu-mir-133b mmu-mir mmu-mir-465a-5p mmu-mir mmu-mir mmu-mir mmu-mir-125b-5p rno-mir mmu-let-7d mmu-mir hsa-mir mmu-mir-188-5p
11 mmu-mir-331-3p mmu-mir-130a hsa-mir-30e-3p mmu-mir hsa-mir-30a-3p mmu-mir _mat mmu-mir Supplementary Table 1 Changes in mirnas patterns in exosomes from mice or BA after activation, related to Figure 2 Serum exosomal mirnas up- or down-regulated more than 2-fold in either CL316,243-treated (CL) or in cold-exposed mice (cold) (versus wild type controls) and exosomal mirnas up- or downregulated more than in camp-treated BA (versus untreated BA controls). mirnas up-regulated are indicated in red; down-regulated in blue; undetected mirnas are listed in black. Investigated candidates are highlighted in white.
12 Serum-exo in vivo BA-exo in vitro CL Cold camp mir-34c* mir-339-3p mir mir-93* mir-409-3p mir-92a mir-133a Supplementary Table 2 Expression of the seven deregulated mirna candidates in mice, related to Figure 2 Seven mirna candidates found in serum of mice with active BAT (CL or cold) and in brown adipocytes treated with camp respective to wild type mice and untreated brown adipocytes. Given are Fold Changes (FC) of Relative Quantitation (RQ) compared to wild type mice and untreated brown adipocytes.
13 ID AGE BMI SEX Fat Glucose Uptake Rate BAT SUVmax Pre-BSm Post-BSm ΔBsm Predicted ΔBsm Pre-LgmiR92 Post-LgmiR92 ΔLgmiR x x x x x x Supplementary Table 3 Cohort 1 subject characteristics for participants in the 10 day cold acclimation study, related to Figure 3 Acute cold sample Shown are age, BMI in kg m - ², sex (0, female; 1, male), Fat in kg, Glucose Uptake Rate in µmol 100g -1 min -1, BAT SUVmax, BAT SUVmean before (Pre-BSm) and after cold acclimation (Post- BSm), delta BAT SUVmean (ΔBsm), the predicted BAT SUVmean (Predicted ΔBsm; Fig. 3d), Log 10 mir-92a (Pre-LgmiR92 or Post-LgmiR92) and Log 10 mir-92a, respectively. Additionally it is listed whether an acute cold sample was taken utilized for Supplemental Fig. 3e.
14 ID AGE BMI SEX Fat GlucoseUptakeRate BAT SUVmean BAT SUVmax Log 10miR-92a Acute cold sample x x x x x x x x x Supplemementary Table 4 Cohort 1 subject characteristics for 12 lean participants in the thermoneutral study, related to Figure 3 Shown are age, BMI in kg m - ², sex (0, female; 1, male), Fat in kg, Glucose Uptake Rate in µmol 100g - 1 min -1, BAT SUVmean, BAT SUVmax, Log 10 mir-92a. Additionally it is listed whether an acute cold sample was taken utilized for Supplemental Fig. 3e
15 ID AGE BMI SEX Fat GlucoseUptakeRate Log 10miR-92a Supplementary Table 5 Cohort 2 subject characteristics for 19 lean participants in the second thermoneutral study, related to Figure 3 Shown are age, BMI in kg m - ², sex (0, female; 1, male), Fat in kg, Glucose Uptake Rate in µmol 100g - 1 min -1, and Log 10 mir-92a.
16 Correlation Cohort1 AGE BMI Sex Fat GlucoseUptakeRateBAT SUVmean BAT SUVmaxLog 10 mir-92alog 10 mir-133a AGE Pearson t-test (2-tail) BMI Pearson t-test (2-tail) Sex Pearson **.509 * t-test (2-tail) Fat Pearson ** * t-test (2-tail) GlucoseUptakeRate Pearson * * **.883 ** * t-test (2-tail) BAT SUVmean Pearson ** ** * t-test (2-tail) BAT SUVmax Pearson **.858 ** * t-test (2-tail) Log 10 mir-92a Pearson * * * * t-test (2-tail) Log 10 mir-133a Pearson * 1 t-test (2-tail) Supplementary Table 6 Pearson Correlation for 22 lean participants of the thermoneutral study, related to Figure 3 Shown are age, BMI in kg m - ², sex (0, female; 1, male), Fat in kg, Glucose Uptake Rate in µmol 100g - 1 min -1, BAT SUVmean, BAT SUVmax, Log 10 mir-92a and the respective Log 10 mir-133a. Values are Pearson correlation coefficients (P* 0.05, **P 0.01).
17 Correlation Cohort2 AGE BMI Sex Fat GlucoseUptakeRate Log 10 mir-92a AGE Pearson * *.354 t-test (2-tail) N BMI Pearson t-test (2-tail) N Sex Pearson ** t-test (2-tail) N Fat Pearson.560 * ** t-test (2-tail) N GlucoseUptakeRate Pearson * ** t-test (2-tail) N Log 10 mir-92a Pearson ** 1 t-test (2-tail) N Supplementary Table 7 Pearson Correlation for 19 lean participants of a second thermoneutral study, related to Figure 3 Pearson Correlation for 19 lean participants of a second thermoneutral study. Shown are age, BMI in kg m - ², sex (0, female; 1, male), Fat in kg, C-reactive Protein in mgl -1, Glucose Uptake Rate in µmol 100g -1 min -1 and Log 10 mir-92a. Values are Pearson correlation coefficients (P* 0.05, **P 0.01).
Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1
Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1 F/F ;mir-17~92 F/F (Pkd1-miR-17~92KO) mice. (A) Q-PCR
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. NAD + -related genes expression in mouse tissues and in cells overexpressing NRK1. mrna (a) and protein (b) levels of NRK1, NRK2 and other enzymes involved
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11419 Supplementary Figure 1 Schematic representation of innate immune signaling pathways induced by intracellular Salmonella in cultured macrophages. a, During the infection Salmonella
FSC-W FSC-H CD4 CD62-L
Supplementary Fig. 1 a SSC-A FSC-A FSC-W FSC-H SSC-W SSC-H CD4 CD62-L b SSC-A FSC-A FSC-W FSC-A FSC-A 7-AAD FSC-A CD4 IL-9 CD4 c SSC-A FSC-A FSC-W FSC-H SSC-W SSC-H 7-AAD KI67 Annexin-V 7-AAD d I L -5
Mitochondrial Dynamics Is a Distinguishing Feature of Skeletal Muscle Fiber Types and Regulates Organellar Compartmentalization
Cell Metabolism Supplemental Information Mitochondrial Dynamics Is a Distinguishing Feature of Skeletal Muscle Fiber Types and Regulates Organellar Compartmentalization Prashant Mishra, Grigor Varuzhanyan,
Supplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Mourier et al., http://www.jcb.org/cgi/content/full/jcb.201411100/dc1 Figure S1. Size and mitochondrial content in Mfn1 and Mfn2 knockout hearts. (A) Body
Supplementary Figure 1. Nature Genetics: doi: /ng.3848
Supplementary Figure 1 Phenotypes and epigenetic properties of Fab2L flies. A- Phenotypic classification based on eye pigment levels in Fab2L male (orange bars) and female (yellow bars) flies (n>150).
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin
Loss of mitochondrial protease OMA1 alters processing of the GTPase OPA1 and causes obesity and defective thermogenesis in mice
Manuscript EMBO-2011-79558 Loss of mitochondrial protease OMA1 alters processing of the GTPase OPA1 and causes obesity and defective thermogenesis in mice Pedro M. Quirós, Andrew J. Ramsay, David Sala,
SUPPLEMENTARY INFORMATION
GP2 Type I-piliated bacteria FAE M cell M cell pocket idc T cell mdc Generation of antigenspecific T cells Induction of antigen-specific mucosal immune response Supplementary Figure 1 Schematic diagram
Waithe et al Supplementary Figures
Waithe et al Supplementary Figures Supplementary Figure 1 Expression and properties of WT and W391A mutant YFP- Ca V 2.2. A Immunoblot using Ca V 2.2 Ab for untransfected cells (UT, lane 1), YFP-Ca V 2.2
EFFECT OF TEMPERATURE ON OXYGEN CONSUMPTION OF THE MOUSE, Mus musculus
EFFECT OF TEMPERATURE ON OXYGEN CONSUMPTION OF THE MOUSE, Mus musculus Lena Sundaram Introduction Animals that are capable of physiological regulation, in which they can maintain a constant body temperature
Nature Neuroscience: doi: /nn Supplementary Figure 1. Amygdaloid complex and evoked synaptic currents recorded in CeM amygdala neurons.
Supplementary Figure 1 Amygdaloid complex and evoked synaptic currents recorded in CeM amygdala neurons. (a) Left: Schematic representation (modified from: Allen Brain Atlas) of coronal sections containing
DOI: 10.1038/ncb2819 Gαi3 / Actin / Acetylated Tubulin Gαi3 / Actin / Acetylated Tubulin a a Gαi3 a Actin Gαi3 WT Gαi3 WT Gαi3 WT b b Gαi3 b Actin Gαi3 KO Gαi3 KO Gαi3 KO # # Figure S1 Loss of protein
Supporting Information
Supporting Information Cao et al. 10.1073/pnas.1306220110 Gram - bacteria Hemolymph Cytoplasm PGRP-LC TAK1 signalosome Imd dfadd Dredd Dnr1 Ikk signalosome P Relish Nucleus AMP and effector genes Fig.
Supplementary Figure 1.
Supplementary Figure 1. Characterisation of IHG-1 overexpressing and knockdown cell lines. (A) Total cellular RNA was prepared from HeLa cells stably overexpressing IHG-1 or mts-ihg-1. IHG-1 mrna was quantified
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
Actinobacteria Relative abundance (%) Co-housed CD300f WT. CD300f KO. Colon length (cm) Day 9. Microscopic inflammation score
y groups y individuals 9 Actinobacteria Relative abundance (%) acteroidetes Cyanobacteria Deferribacteres Firmicutes Proteobacteria TM Tenericutes Unclassified CDf CDf Co-housed CDf Co-housed CDf CDf CDf
The Longer Life Foundation Pilot/Feasibility Grant Application FINAL REPORT
The Longer Life Foundation Pilot/Feasibility Grant Application FINAL REPORT Diagnostic and therapeutic applications of a novel plasma metabolite, nicotinamide mononucleotide (NMN), for age-associated metabolic
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2362 Figure S1 CYLD and CASPASE 8 genes are co-regulated. Analysis of gene expression across 79 tissues was carried out as described previously [Ref: PMID: 18636086]. Briefly, microarray
Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2.
Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice. Percentage of marginal zone B cells in the spleen of wild-type mice (+/+), mice homozygous for cpm or pri
Ethylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis
Ethylene is critical to the maintenance of primary root growth and Fe homeostasis under Fe stress in Arabidopsis Guangjie Li, Weifeng Xu, Herbert J. Kronzucker, Weiming Shi * Supplementary Data Supplementary
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/345/ra91/dc1 Supplementary Materials for TGF-β induced epithelial-to-mesenchymal transition proceeds through stepwise activation of multiple feedback loops Jingyu
Supplementary Figure 1. AnnexinV FITC and Sytox orange staining in wild type, Nlrp3 /, ASC / and casp1/11 / TEC treated with TNF /CHX.
Supplementary Figure 1. AnnexinV FITC and Sytox orange staining in wild type, Nlrp3 /, ASC / and casp1/11 / TEC treated with TNF /CHX. Phase contrast and widefield fluorescence microscopy (20x magnification).
SUPPLEMENTARY INFORMATION
DOI:.38/ncb97 P ( μm, hours) 1 2 4 P DMSO Figure S1 unningham et al. E 97 65 27 MFN1 GFP-Parkin Opa1 ctin GPDH HEK293 GFP-Parkin 19 115 97 65 27 Mitochondrial Fraction SH-SY5Y GFP-Parkin Mito DMSO Mito
. Supplementary Information
. Supplementary Information Supplementary Figure S1. Mature embryo sac observations. Supplementary Figure S2. STT observations. Supplementary Figure S3. Comparison of the PTB1 cdna with that of the mutant.
Supplemental Data. Perrella et al. (2013). Plant Cell /tpc
Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization
SUPPLEMENTARY INFORMATION
Supplementary Discussion Rationale for using maternal ythdf2 -/- mutants as study subject To study the genetic basis of the embryonic developmental delay that we observed, we crossed fish with different
Frequency (Hz) Amplitude (pa) D1 WT D1 KO D2 WT D2 KO D1 WT D1 KO D2 WT D2 KO
A D1 MSNs B D2 MSNs C Frequency (Hz) 4 3 2 1 D Amplitude (pa) 5 4 3 2 1 D1 D1 D2 D2 D1 D1 D2 D2 Supplemental Figure 1. B deletion did not alter GABA-mIPSCs in D1 or D2 MSNs. (A,B) Representative recording
Supplementary Materials for
www.sciencemag.org/cgi/content/full/science.1243417/dc1 Supplementary Materials for Circadian Clock Cycle Drives Mitochondrial Oxidative Metabolism in Mice Clara Bien Peek, Alison H. Affinati, Kathryn
Supplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
SUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Figure S1. Mitochondrial morphology in Fis1-null, Mff-null and Fis1/Mff-null MEF cells. (A) Western blotting of lysates from Fis1-null, Mff-null and Fis1/Mff-null cells. Lysates were
Nature Methods: doi: /nmeth Supplementary Figure 1. In vitro screening of recombinant R-CaMP2 variants.
Supplementary Figure 1 In vitro screening of recombinant R-CaMP2 variants. Baseline fluorescence compared to R-CaMP1.07 at nominally zero calcium plotted versus dynamic range ( F/F) for 150 recombinant
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/301/ra98/dc1 Supplementary Materials for Regulation of Epithelial Morphogenesis by the G Protein Coupled Receptor Mist and Its Ligand Fog Alyssa J. Manning,
TRANSCRIPTOMICS. (or the analysis of the transcriptome) Mario Cáceres. Main objectives of genomics. Determine the entire DNA sequence of an organism
TRANSCRIPTOMICS (or the analysis of the transcriptome) Mario Cáceres Main objectives of genomics Determine the entire DNA sequence of an organism Identify and annotate the complete set of genes encoded
Supplementary Methods
Supplementary Methods Modeling of magnetic field In this study, the magnetic field was generated with N52 grade nickel-plated neodymium block magnets (K&J Magnetics). The residual flux density of the magnets
Supplementary Figure 1. Fullerence has poor solubility in water while the C60S and LC60S nanoparticles can be stably dispersed in water.
Supplementary Figure 1. Fullerence has poor solubility in water while the C60S and LC60S nanoparticles can be stably dispersed in water. (a) A typical photograph of fullerence (C60), C60S nanoparticles,
Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering
Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering by Valverde et. Al Published in Science 2004 Presented by Boyana Grigorova CBMG 688R Feb. 12, 2007 Circadian Rhythms: The Clock Within
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/281/ra51/dc1 Supplementary Materials for Rapgef2 Connects GPCR-Mediated camp Signals to ERK Activation in Neuronal and Endocrine Cells Andrew C. Emery, Maribeth
LOS AMMOS SCIENTIFIC LABORATORY
INKI-AWFIEJI LOS AMMOS SCIENTIFIC LABORATORY OF THE UNIVERSITY OF CALIFORNIA LOS ALAMOS, NEW MEXICO CONTRACTW-7405-ENG36 WITH THE US ATOMIC ENERGY COMMISSION IJNCA5SIHED LOS ALAMOS SCIENTIFIC LABORATORY
Solid State LightBurst New PET Technology GE PET/CT and PET/MR
Solid State LightBurst New PET Technology GE PET/CT and PET/MR Osama Mawlawi PhD. Dept. of Imaging Physics MD Anderson Cancer Center Disclosures SIEMENS Research grant GE research grant Discovery MI LYSO
Supplementary Information
Supplementary Information Supplementary Figure 1. JAK/STAT in early wing development (a-f) Wing primordia of second instar larvae of the indicated genotypes labeled to visualize expression of upd mrna
Supplemental Data. Hou et al. (2016). Plant Cell /tpc
Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc.16.295 A Distance to 1 st nt of start codon Distance to 1 st nt of stop codon B Normalized PARE abundance 8 14 nt 17 nt Frame1 Arabidopsis inflorescence
Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing
Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing 0.1% SDS without boiling. The gel was analyzed by a fluorescent
microrna Studies Chen-Hanson Ting SVFIG June 23, 2018
microrna Studies Chen-Hanson Ting SVFIG June 23, 2018 Summary MicroRNA (mirna) Species and organisms studied mirna in mitocondria Huge genome files mirna in human Chromosome 1 mirna in bacteria Tools used
Supplementary Figure 1-10 with Figure legends
332 coordinates mechanotransduction and growth cone bifurcation in sensory neurons Li Yang Chiang 1, Kate Poole, Beatriz E. Oliveira, Neuza Duarte,Yinth Andrea Bernal Sierra, Leena Bruckner Tuderman, Manuel
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Breker et al., http://www.jcb.org/cgi/content/full/jcb.201301120/dc1 Figure S1. Single-cell proteomics of stress responses. (a) Using
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2647 Figure S1 Other Rab GTPases do not co-localize with the ER. a, Cos-7 cells cotransfected with an ER luminal marker (either KDEL-venus or mch-kdel) and mch-tagged human Rab5 (mch-rab5,
CELL REPLICATION. Fluorescent light microscopy showing mitosis, especially immunolabelled cytoskeleton and tubulin
CELL REPLICATION Fluorescent light microscopy showing mitosis, especially immunolabelled cytoskeleton and tubulin Cell REPLICATION PROLIFERATION MUTIPLICATION DIVISION CELL REPLICATION Fluorescent light
Table of contents Appendix Figure S1 Appendix Figure S2 Appendix Figure S3 Appendix Table S1 Appendix Table S2
Table of contents Appendix Figure S1 Appendix Figure S2 Appendix Figure S3 Appendix Table S1 Appendix Table S2 1 Appendix Figure S1 Fig. S1. Proteome analysis of the CPE-derived EVs and the choroid plexus
Biology EOC Review Study Questions
Biology EOC Review Study Questions Microscopes and Characteristics of Life 1. How do you calculate total magnification on a compound light microscope? 2. What is the basic building block of all living
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09414 Supplementary Figure 1 FACS-isolated 8c hepatocytes are highly pure. a, Gating strategy for identifying hepatocyte populations based on DNA content. b, Detection of mchry and mchr9
Nature Neuroscience: doi: /nn.2662
Supplementary Figure 1 Atlastin phylogeny and homology. (a) Maximum likelihood phylogenetic tree based on 18 Atlastin-1 sequences using the program Quicktree. Numbers at internal nodes correspond to bootstrap
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of paraxial mesoderm from the H7 hesc line.
Supplementary Figure 1 Generation of paraxial mesoderm from the H7 hesc line. H7 hescs were differentiated as shown in Figure 1a. (a) Flow cytometric analyses of the proportion of CD56+, PDGFRα+, and KDR+
microrna pseudo-targets
microrna pseudo-targets Natalia Pinzón Restrepo Institut de Génétique Humaine (CNRS), Montpellier, France August, 2012 microrna target identification mir: target: 2 7 5 N NNNNNNNNNNNNNN NNNNNN 3 the seed
Geert Geeven. April 14, 2010
iction of Gene Regulatory Interactions NDNS+ Workshop April 14, 2010 Today s talk - Outline Outline Biological Background Construction of Predictors The main aim of my project is to better understand the
Cardiolipin Remodeling by ALCAT1 Regulates Dilated Cardiomyopathy Through Oxidative Stress and Mitophagy. Yuguang (Roger) Shi
Cardiolipin Remodeling by ALCAT1 Regulates Dilated Cardiomyopathy Through xidative Stress and Mitophagy Yuguang (Roger) Shi yus11@psu.eud Cardiolipin Biosynthetic and Remodeling Pathways Phosphatidic Acid
robustness: revisting the significance of mirna-mediated regulation
: revisting the significance of mirna-mediated regulation Hervé Seitz IGH (CNRS), Montpellier, France October 13, 2012 microrna target identification .. microrna target identification mir: target: 2 7
Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2
Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2 IRT1, FRO2 and FIT expression levels in roots of the wild-type, nas4x- 1 and nas4x-2, showing that in both nas mutants
Supplementary Figure 1
Supplementary Figure 1 Single-cell RNA sequencing reveals unique sets of neuropeptides, transcription factors and receptors in specific types of sympathetic neurons (a) Dissection of paravertebral SGs
Theoretical Model and Characteristics of Mitochondrial Thermogenesis. Jian-Sheng Kang #
Theoretical Model and Characteristics of Mitochondrial Thermogenesis Jian-Sheng Kang # The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan, 450052, P. R. China Text: 1697 # Correspondence
Supplementary material: Orbitofrontal and striatal circuits dynamically encode the shift. between goal-directed and habitual actions
Supplementary material: Orbitofrontal and striatal circuits dynamically encode the shift between goal-directed and habitual actions Christina M. Gremel 1 & Rui M. Costa 1,2 1 Laboratory for Integrative
TAC1 TAC4 TAC7 TAC14 TAC21
Table S1 Gene qrt-pcr primer sequence Amplification efficiency α-sma (FW) 5 - GCCAGTCGCTGTCAGGAACCC -3 (RV) 5 - AGCCGGCCTAGAGCCCA -3 Procollagen-I (FW) 5 - AAGACGGGAGGGCGAGTGCT -3 (RV) 5 - AACGGGTCCCCTTGGGCCTT
** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.
Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *
AP Biology Gene Regulation and Development Review
AP Biology Gene Regulation and Development Review 1. What does the regulatory gene code for? 2. Is the repressor by default active/inactive? 3. What changes the repressor activity? 4. What does repressor
targets. clustering show that different complex pathway
Supplementary Figure 1. CLICR allows clustering and activation of cytoplasmic protein targets. (a, b) Upon light activation, the Cry2 (red) and LRP6c (green) components co-cluster due to the heterodimeric
Chapter 6 Chemistry in Biology
Section 1: Atoms, Elements, and Compounds Section 2: Chemical Reactions Section 3: Water and Solutions Section 4: The Building Blocks of Life Click on a lesson name to select. 6.1 Atoms, Elements, and
Supplementary Figure 1 The number of differentially expressed genes for uniparental males (green), uniparental females (yellow), biparental males
Supplementary Figure 1 The number of differentially expressed genes for males (green), females (yellow), males (red), and females (blue) in caring vs. control comparisons in the caring gene set and the
PLASMA-POLYMER MODIFICATION OF BASAL PLANE GRAPHITE SURFACES FOR IMPROVED BIOCOMPATIBILITY
PLASMA-POLYMER MODIFICATION OF BASAL PLANE GRAPHITE SURFACES FOR IMPROVED BIOCOMPATIBILITY Anca Orăşanu, Marcus R. Davidson, Robert H. Bradley Advanced Materials & Biomaterials Research Centre, School
Table S1. Sequence of primers used in RT-qPCR
Table S1. Sequence of primers used in RT-qPCR Primer Name P16Ink4a-F P16Ink4a-R P15Ink4b-F P15Ink4b-R P19Arf-F P19Arf-R P53-F P53-R P21cip1-F P21cip1-R P27kip1-F P27kip1-R P18Ink4c-F P18Ink4c-R P19Ink4d-F
SUPPLEMENTARY INFORMATION
reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative
Hole s Human Anatomy and Physiology Tenth Edition. Chapter 2
PowerPoint Lecture Outlines to accompany Hole s Human Anatomy and Physiology Tenth Edition Shier w Butler w Lewis Chapter 2 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction
Nature Medicine: doi: /nm.3776
C terminal Hsp90 inhibitors restore glucocorticoid sensitivity and relieve a mouse allograft model of Cushing s disease Mathias Riebold, Christian Kozany, Lee Freiburger, Michael Sattler, Michael Buchfelder,
Photosynthesis. Lab Exercise 9. Contents. Introduction. Objectives
Lab Exercise Photosynthesis Contents Objectives 1 Introduction 1 Activity.1 Action Spectrum 2 Activity.2 Effects of Temperature 4 Activity.3 Photosynthesis Experiment 4 Resutls Section 5 Objectives - Quantify
Supplemental Data. Yamamoto et al. (2016). Plant Cell /tpc WT + HCO 3. slac1-4/δnc #5 + HCO 3 WT + ABA. slac1-4/δnc #5 + ABA
I (pa) I (pa) A WT + HCO 3 B 2 V (mv) 15 1 5 5 2 slac14/δnc #5 + HCO 3 4 6 WT (n = 6) 8 WT + HCO 3 (n = 7) slac14/δnc #5 (n = 6) slac14/δnc #5 + HCO 3 (n = 1) C WT + ABA D 2 V (mv) 15 1 5 5 2 slac14/δnc
Supplementary material
Supplementary material Phosphorylation of the mitochondrial autophagy receptor Nix enhances its interaction with LC3 proteins Vladimir V. Rogov 1,*, Hironori Suzuki 2,3,*, Mija Marinković 4, Verena Lang
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3267 Supplementary Figure 1 A group of genes required for formation or orientation of annular F-actin bundles and aecm ridges: RNAi phenotypes and their validation by standard mutations.
Supplemental Figures S1 S5
Beyond reduction of atherosclerosis: PON2 provides apoptosis resistance and stabilizes tumor cells Ines Witte (1), Sebastian Altenhöfer (1), Petra Wilgenbus (1), Julianna Amort (1), Albrecht M. Clement
BIOSTATISTICS. Lecture 4 Sampling and Sampling Distribution. dr. Petr Nazarov
Genomics Research Unit BIOSTATISTICS Lecture 4 Sampling and Sampling Distribution dr. Petr Nazarov 4-03-2016 petr.nazarov@lih.lu Lecture 4. Sampling and sampling distribution OUTLINE Lecture 4 Sampling
12 Week Implantation Test. Femur Defect in. Rabbit DirectOss. (Small Granules)
12 Week Implantation Test Femur Defect in Rabbit DirectOss (Small Granules) Implant Direct 1 1. Test Sample 27030 Malibu Hills Rd 1) Test: Bovine bone graft material-directoss (small granule, 250-1000
Chemistry in Biology. Section 1. Atoms, Elements, and Compounds
Section 1 Atoms, Elements, and Compounds Atoms! Chemistry is the study of matter.! Atoms are the building blocks of matter.! Neutrons and protons are located at the center of the atom.! Protons are positively
Supplementary Tables and Figures
Supplementary Tables Supplementary Tables and Figures Supplementary Table 1: Tumor types and samples analyzed. Supplementary Table 2: Genes analyzed here. Supplementary Table 3: Statistically significant
downstream (0.8 kb) homologous sequences to the genomic locus of DIC. A DIC mutant strain (ro- 6
A B C D ts Figure S1 Generation of DIC- mcherry expressing N.crassa strain. A. N. crassa colony morphology. When a cot1 (top, left panel) strain is grown at permissive temperature (25 C), it exhibits straight
2: CHEMICAL COMPOSITION OF THE BODY
1 2: CHEMICAL COMPOSITION OF THE BODY Although most students of human physiology have had at least some chemistry, this chapter serves very well as a review and as a glossary of chemical terms. In particular,
Lipid transfer proteins confer resistance to trichothecenes
Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance
Nature Neuroscience: doi: /nn.2717
Supplementary Fig. 1. Dendrite length is not secondary to body length. Dendrite growth proceeds independently of the rate of body growth and decreases in rate in adults. n 20 on dendrite measurement, n
Nitroaromatic detection and infrared communication from wild-type plants using plant nanobionics
Nitroaromatic detection and infrared communication from wild-type plants using plant nanobionics Min Hao Wong 1 *, Juan P. Giraldo 1,2 *, Seon-Yeong Kwak 1, Volodymyr B. Koman 1, Rosalie Sinclair 1, Tedrick
Advanced Fluorescence Microscopy I: Fluorescence (Foster) Resonance Energy Transfer
Advanced Fluorescence Microscopy I: Fluorescence (Foster) Resonance Energy Transfer 3.0 Pax 2.5 2.0 1200 800 400 GFP- Pax GFP-Pax + FATmCherry FAT FAT 1.5 Lifetime (ns) 0 1500 2000 2500 3000 Average lifetime
Supplementary Information
Supplementary Information MAP2/Hoechst Hyp.-AP ph 6.5 Hyp.-SD ph 7.2 Norm.-SD ph 7.2 Supplementary Figure 1. Mitochondrial elongation in cortical neurons by acidosis. Representative images of neuronal
Quantification of NS1 dengue biomarker in serum via optomagnetic nanocluster detection
Supplementary Information Quantification of NS1 dengue biomarker in serum via optomagnetic nanocluster detection Paula Antunes 1, Daniel Watterson 3, Mattias Parmvi 1, Robert Burger 1, Anja Boisen 1, Paul
Hairpin Database: Why and How?
Hairpin Database: Why and How? Clark Jeffries Research Professor Renaissance Computing Institute and School of Pharmacy University of North Carolina at Chapel Hill, United States Why should a database
This presentation contains forward-looking statements within the meaning of the "safe harbor" provisions of the Private Securities Litigation Reform
This presentation contains forward-looking statements within the meaning of the "safe harbor" provisions of the Private Securities Litigation Reform Act of 1995, as amended. These forward-looking statements
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA
Food consumption of rats. Two-way vs one-way vs nested ANOVA
Food consumption of rats Lard Gender Fresh Rancid 709 592 Male 679 538 699 476 657 508 Female 594 505 677 539 Two-way vs one-way vs nested NOV T 1 2 * * M * * * * * * F * * * * T M1 M2 F1 F2 * * * * *
Instructions to Candidates
SECONDARY SCHOOL ANNUAL EXAMINATIONS 2009 Directorate for Quality and Standards in Education Educational Assessment Unit A FORM 1 MATHEMATICS SCHEME A TIME: 30 minutes Non-Calculator Paper Name: _ Class:
23-. Shoot and root development depend on ratio of IAA/CK
Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal
Conclusions. The experimental studies presented in this thesis provide the first molecular insights
C h a p t e r 5 Conclusions 5.1 Summary The experimental studies presented in this thesis provide the first molecular insights into the cellular processes of assembly, and aggregation of neural crest and
AP Biology Summer Assignment 2018/19 Mrs. Altergott, Modified from Kimberly Simons/Paul Picard LHS downloaded June 2017
1 AP Biology Summer Assignment 2018/19 Mrs. Altergott, jaltergott@stbernardhs.org Modified from Kimberly Simons/Paul Picard LHS downloaded June 2017 Welcome to AP Biology! Thank you for agreeing to take
The Developmental Transcriptome of the Mosquito Aedes aegypti, an invasive species and major arbovirus vector.
The Developmental Transcriptome of the Mosquito Aedes aegypti, an invasive species and major arbovirus vector. Omar S. Akbari*, Igor Antoshechkin*, Henry Amrhein, Brian Williams, Race Diloreto, Jeremy
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/3/5/e1602426/dc1 Supplementary Materials for In vivo mapping of tissue- and subcellular-specific proteomes in Caenorhabditis elegans The PDF file includes: Aaron