Gas entrapment and microbial N 2 O reduction reduce N 2 O emissions from a biochar-amended sandy clay loam soil

Transcription

1 Gas entrapment and microbial N 2 O reduction reduce N 2 O emissions from a biochar-amended sandy clay loam soil Johannes Harter a, Ivan Guzman-Bustamante b, Stefanie Kuehfuss c, Reiner Ruser b, Reinhard Well d, Oliver Spott e, Andreas Kappler a and Sebastian Behrens a,f,g* a Geomicrobiology & Microbial Ecology, Center for Applied Geosciences, University of Tuebingen, Tuebingen, Germany b Fertilization and Soil Matter Dynamics, Institute of Crop Science, University of Hohenheim, Stuttgart, Germany c Plant Ecology and Ecotoxicology, Institute of Landscape and Plant Ecology, University of Hohenheim, Stuttgart, Germany d Institute of Climate-Smart Agriculture, Johann Heinrich von Thünen-Institut, Federal Research Institute for Rural Areas, Forestry and Fisheries, Braunschweig, Germany e Department of Soil Physics, Helmholtz Centre for Environmental Research UFZ, Halle/Saale, Germany f Department of Civil, Environmental, and Geo-Engineering, University of Minnesota, Minneapolis, MN, USA g BioTechnology Institute, University of Minnesota, St. Paul, MN, USA Supplementary Information * Corresponding author. Tel.: and address: sbehrens@umn.edu (S. Behrens.

2 . Material and Methods. Soil characterization methods Soil ph was determined in a : water suspension according to ISO 090. Soil particle size distribution was determined according to ISO 277 by sieving and sedimentation using different sieves and a Sedigraph III (Micromeritics, Norcross, GA, USA. CaCO content was determined using a Calcimeter (Eijkelkamp, Giesbeek, The Netherlands according to ISO 069. Carbon and nitrogen were quantified according to ISO 0694 and 878 using a Vario EL elemental analyser (Elementar, Hanau, Germany. For the quantification of the other elements listed in table soil samples were digested prior to analysis. Samples were acid digested by microwave pressure digestion using a MLS Start 00 microwave (MLS, Leutkirch, Germany according to the manufacturer recommendations for soil. The resulting solution was analysed by Inductively Coupled Plasma Optical Emission Spectroscopy (ICP-OES with an Optima 00 DV (PerkinElmer, Waltham, MA, USA..2 Gross nitrification and NO - consumption rates Gross nitrification and NO - consumption rates were determined using the equations ( - 2 provided by Davidson et al. 99. N = M 0 M t log(h 0 M / H M 0 log(m 0 / M ( C = M 0 M t log(h 0 / H log(m 0 / M (2 N : nitrification rate (mg N kg - dry soil d - C : NO - consumption rate (mg N kg - dry soil d - M 0 : 4+ NO - pool at first time point (mg NO - -N kg - dry soil M : 4+ NO - pool at second time point (mg NO - -N kg - dry soil H 0 : NO - pool at first time point (mg NO - -N kg - dry soil H : NO - pool at second time point (mg NO - -N kg - dry soil t : time between first and second time point (days 2

3 . Quantitative polymerase chain reaction (qpcr analyses.. Nucleic acid extraction efficiencies Nucleic acid extraction efficiencies were calculated based on the internal RNA and DNA standards using equation (. Extraction efficiency = internal standard copies quantified in the final DNA or cdna extract DNA or RNA internal standard copies added prior to extraction (..2 Quantitative polymerase chain reaction (qpcr Details about the used primers, reactions mixtures, thermal profiles and qpcr efficiencies are listed in table S and S2. Table S: Primers used for qpcrs. target gene primer name primer sequence ( - fragment size (bp reference napa V7m napa4r TGGACVATGGGYTTYAAYC ACYTCRCGHGCVGTRCCRCA 2 Bru et al. (2007 narg narg-f narg-r TCGCCSATYCCGGCSATGTC GAGTTGTACCAGTCRGCSGAYTCSG 7 Bru et al. (2007 nirk nirk876c nirk040 ATYGGCGGVCAYGGCGA GCCTCGATCAGRTTRTGGTT 64 Henry et al. (2004 (modified nirs nirscdaf nirsrcd AACGYSAAGGARACSGG GASTTCGGRTGSGTCTTSAYGAA 407 Kandeler et al. (2006 typical nosz nosz2f nosz2r CGCRACGGCAASAAGGTSMSSGT CAKRTGCAKSGCRTGGCAGAA 267 Henry et al. (2006 atypical nosz nosz-ii-f nosz-ii-r CTNGGNCCNYTKCAYAC GCNGARCARAANTCBGTRC 698 Jones et al. (20 Internal standard APA9F APA9R CGAACCTGGACTGTTATGATG AATAAACAATCCCCTGTATTTCAC 87 Thonar et al. (202 nirk876c was modified from nirk876 (Henry et al., 2004 to increase binding specificity

4 Table S2: Details about the qpcr assays performed with DNA and cdna extracts. target gene origin of standard reaction mixture volume (µl thermal profile Efficiency [%] napa Pseudomonas aeruginosa PAO V7m ( µm napa4r ( µm 98 C s C s 72 C s X 4 cycles 74 narg Pseudomonas aeruginosa PAO narg-f ( µm narg-r ( µm 98 C 0 s 62 C 20 s X 40 cycles 84 nirk Ensifer meliloti 02 nirk876c ( µm nirk040 ( µm 98 C 0 s 8 C 20 s X 40 cycles 92 nirs Ralstonia eutropha H6 nirscdaf ( µm nirsrcd ( µm 2 98 C 0 s 7 C 0 s 72 C - 0 s X 40 cycles 89 typical nosz Ensifer meliloti 02 nosz2f ( µm nosz2r ( µm 98 C s 60 C 2 s X 40 cycles 74 atypical nosz Gemmatimonas aurantiaca T-27 IQ SYBR nosz-ii-f ( µm nosz-ii-r ( µm C 0 s 4 C 0 s 72 C - 4 s 80 C 0 s X 40 cycles 86 Internal standard African cassava mosaic virus- [Nigeria-Ogo] APA9F ( µm APA9R ( µm 98 C 0 s 0 C s X cycles 89 4

5 .4 N 2 O source partitioning and rates of NO - -derived N 2 O and N 2.4. Fractions of NO - -derived N 2 O and N 2 For each gas sample collected in experiment, 2, and, the fraction of N 2 and/or N 2 O evolving from the N-labeled NO - pool ( f p, was calculated using the equations provided by (Spott et al., f p = a m a bgd a p a bgd (4 a bgd : N abundance of atmospheric background a m : measured N abundance of N 2 and N 2 O a m = 29 R R ( R + 0 R ( a p : calculated N abundance of active N-labeled NO - pool a p = 0 x m a bgd a m a m a bgd (6 0 x m : measured fraction of m/z 0 in N 2 and converted N 2 O 0 x m = 0 R + 29 R + 0 R (7 In experiment, nitrogen isotope ratios of N 2 O were determined by analysis of intact N 2 O molecules ( 4 R = ( 4 N N 6 O + N 4 N 6 O + 4 N 4 N 7 O/ 4 N 4 N 6 O; 46 R = ( N N 6 O + 4 N 4 N 8 O/ 4 N 4 N 6 O. To use the previous equations, isotope ratios ( 4 R and 46 R were oxygen-corrected according to (Bergsma et al., 200 using equations (8 and (9. 29 R = 4 R 7 R (8 0 R = 46 R 29 R 7 R 8 R (9 For 7 R and 8 R we used the values suggested by (Bergsma et al., 200: 7 R = , 8 R =

6 .4.2 Rates of NO - -derived N 2 O and N 2 Concentrations of NO - -derived N 2 O and N 2 ( c p in ppm were calculated according to equation (0: c p = f p c H (0 c H : headspace concentration (ppm of total N 2 O (GC-ECD, experiment or total N 2 (N 2 concentration of artificial gas mixture = ppm, assuming a negligible relative increase in N 2 concentration due to microbial N 2 production, experiment 2 and. In experiment 2 and, N 2 O and N 2 in the headspace was diluted during each sampling occasion due to gas exchange between the headspace and the sample vial initially filled with the artificial gas mixture. Diluted NO - -derived N 2 O and N 2 concentrations were corrected using equations (, (2, and (. No dilution correction was needed for experiment due to the different sampling strategy. cc p = c p + V S V T ( cc p = c p + V S + V S (2 V T V T cc ps = c ps + V S + V S + V Ss ( V T V T V Ts cc p,,s : corrected NO - -derived N 2 O and N 2 concentrations (ppm in samples collected after h of enrichment ( cc p, h of enrichment ( cc p, and after shaking ( cc ps c p,,s : NO - -derived N 2 O and N 2 concentrations (ppm in samples collected after h of enrichment ( c p, h of enrichment ( c p, and after shaking ( c ps V S,,s : volume of the gas samples during sampling after h of enrichment (V S, h of enrichment (V S, and after shaking (V Ss V T,,s : total volume (headspace and gas sample during sampling after h of enrichment (V T, h of enrichment (V T, and after shaking (V Ts In experiment, NO - -derived N 2 O emission rates ( ER p were calculated according to equation (4. As the concentration of NO - -derived N 2 O after 0 h of enrichment was 0, only values determined from samples collected after h ( c p were considered for emission rate calculation. For the determination of NO - -derived N 2 O and N 2 emission rates in experiment 2 and equation ( was used. 6

7 ER p = c p k V H m ( ER p = cc cc p p k V H t m (4 ( ER p : emission rates of NO - -derived N 2 O and N 2 (mg N 2 O-N kg - dry soil h - t : time (h between first (after h and second sampling (after h k : unit conversion factor calculated as k = molar mass of N in N 2 O and N 2 molar volume of gas (20 C = V H : volume of the headspace during sampling (equal after h and h of enrichment m : mass of dry soil (g in the gas enrichment container The NO - -derived N 2 O and N 2 soil entrapment/emission ratio (SE p / E p, defined as the concentration (ppm of NO - -derived N 2 O and N 2 accumulating in the headspace before and after shaking at day 2 in experiment was calculated using equation (6 SE p / E p = cc ps.d 2 cc p.d 2 cc p.d 2 (6 cc p.d 2,s.d 2 : corrected NO - -derived N 2 O and N 2 concentrations (ppm in samples collected after h of enrichment ( cc p.d 2, and after shaking ( cc ps.d 2 at day 2 NO - -derived N 2 O and N 2 soil entrapment ( SER p and total production (TPR p rates were calculated from samples collected during experiment after 2 days of incubation using equations (7 and (8, respectively. SER p = ER p.d 2 SE p / E p (7 TPR p = ER p.d 2 + SER p (8 SER p : soil entrapment rates of NO - -derived N 2 O and N 2 (mg N 2 O-N kg - dry soil h - at day 2 ER p.d 2 : emission rates of NO - -derived N 2 O and N 2 (mg N 2 O-N kg - dry soil h - at day 2 TPR p : total production rates of NO - -derived N 2 O and N 2 (mg N 2 O-N kg - dry soil h - at day 2 7

8 .4. N 2 O source partitioning The contribution of NO - -derived N 2 O to total soil-derived N 2 O emissions ( f nitrate was calculated from samples collected during experiment using equation (9. f nitrate = f p f soil (9 f nitrate : fraction of NO - -derived N 2 O of total soil-derived N 2 O f p : fraction of N 2 O evolving from the N-labeled NO - pool f soil : fraction of N 2 O evolving from soil calculated as: f soil = total N 2 O background N 2 O total N 2 O 2. Results Figure S: Contribution of NO - -derived N 2 O to total soil-derived N 2 O emissions in control (open circles and biochar (solid circles over time. 8

9 Figure S2: Gene copy numbers of functional marker genes of denitrification in control (open circles and biochar (solid circles microcosms over time. The different panels show: (A napa (B narg, (C nirk, (D nirs, (E typical nosz, and (F atypical nosz. Data points and error bars represent means and standard errors (n=, respectively. 9

10 Table S: Results from two-way ANOVAs for the gene data. The table shows F-statistics and p-values for the main effects biochar and time and their interaction biochar*time. parameter biochar time biochar * time F p F p F p napa genes narg genes nirk genes nirs genes typical nosz genes atypical nosz genes References Bergsma, T.T., Ostrom, N.E., Emmons, M., and Robertson, G.P. (200 Measuring simultaneous fluxes from soil of N 2 O and N 2 in the field using the N-gas nonequilibrium technique. Environmental Science & Technology : Bru, D., Sarr, A., and Philippot, L. (2007 Relative abundances of proteobacterial membrane-bound and periplasmic nitrate reductases in selected environments. Applied and Environmental Microbiology 7: Henry, S., Bru, D., Stres, B., Hallet, S., and Philippot, L. (2006 Quantitative detection of the nosz gene, encoding nitrous oxide reductase, and comparison of the abundances of 6S rrna, narg, nirk, and nosz genes in soils. Applied and Environmental Microbiology 72: Henry, S., Baudoin, E., Lopez-Gutierrez, J.C., Martin-Laurent, F., Baumann, A., and Philippot, L. (2004 Quantification of denitrifying bacteria in soils by nirk gene targeted real-time PCR. Journal of Microbiological Methods 9: 27-. Jones, C.M., Graf, D.R., Bru, D., Philippot, L., and Hallin, S. (20 The unaccounted yet abundant nitrous oxide-reducing microbial community: a potential nitrous oxide sink. Isme Journal 7: Kandeler, E., Deiglmayr, K., Tscherko, D., Bru, D., and Philippot, L. (2006 Abundance of narg, nirs, nirk, and nosz genes of denitrifying bacteria during primary successions of a glacier foreland. Applied and Environmental Microbiology 72: Spott, O., Russow, R., Apelt, B., and Stange, C.F. (2006 A N-aided artificial atmosphere gas flow technique for online determination of soil N 2 release using the zeolite Kostrolith SX6. Rapid Communications in Mass Spectrometry 20: Thonar, C., Erb, A., and Jansa, J. (202 Real-time PCR to quantify composition of arbuscular mycorrhizal fungal communities--marker design, verification, calibration and field validation. Molecular Ecology Resources 2: