Supplementary Materials for

Transcription

1 advane.ienemag.org/gi/ontent/full/3/5/e /dc1 Supplementary Material for Harneing the hygroopi and biofluoreent behavior of genetially tratable mirobial ell to deign biohybrid wearable Wen Wang, Lining Yao, Chin-Yi Cheng, Teng Zhang, Hirohi Atumi, Luda Wang, Guanyun Wang, Okana Anilionyte, Helene Steiner, Jifei Ou, Kang Zhou, Chri Wawrouek, Katherine Petrea, Angela M. Belher, Rohit Karnik, Xuanhe Zhao, Daniel I. C. Wang, Hirohi Ihii The PDF file inlude: Publihed 19 May 2017, Si. Adv. 3, e (2017) DOI: /iadv note S1. Experimental data proeing. note S2. Theoretial predition. note S3. Finite-element imulation. note S4. Garment deign priniple. note S5. Flap deign baed on heat map and weat map. fig. S1. Surfae propertie of natural latex heet haraterized by SEM. fig. S2. Bioprinter working priniple. fig. S3. Cutomized humidity-ontrolled hamber. fig. S4. Single ell at different RH imaged by AFM. fig. S5. Map of plamid pet11a-egfp-laz. fig. S6. Confoal image of ell lyate ontaining egfp. fig. S7. Strain and tre of biohybrid film at different RH. fig. S8. Mehanial haraterization of a bilayer hybrid film. fig. S9. Aembly of a female running uit foued on the bak ventilation through heat pre. fig. S10. Running uit pattern deign baed heat and weat map. fig. S11. Deign of the running hoe with multifuntional fluoreent flap. fig. S12. Sample tability tet under 100 -wet yle. table S1. Sequene of the yntheti gene ued in thi tudy. Legend for movie S1 to S6 Other Supplementary Material for thi manuript inlude the following: (available at advane.ienemag.org/gi/ontent/full/3/5/e /dc1)

2 movie S1 (.avi format). Biohybrid bilayer film at different RH. movie S2 (.avi format). Single-ell volume hange when dereaing RH imaged by dark-field miroopy. movie S3 (.avi format). Fluoreene hange of biohybrid film at different RH. movie S4 (.avi format). Simulation of bilayer biofilm bending. movie S5 (.avi format). Simulation of andwih-trutured biofilm bending. movie S6 (.avi format). Flap opening for garment during exerie.

3 note S1. Experimental data proeing. Radiu of urvature an be alulated diretly from the bending angle: R = of the latex film. Strain of the ompreed urfae i given by L 2πθ/360, where L i the length ε = 2 3 t R where t i the thikne of latex, and R i the urvature of the latex on trethed ide. Fore per unit length (N/m) of the latex urfae i given by Stoney formula under plan train ondition E 2 F = υ2 t R Where E and υ are latex Young modulu (3 MPa) and Poion ratio (0.5), repetively, t i the thikne, and R i the urvature Stre on the ell layer i σ = F t w + w gap w where t i the thikne of the ell (5 μm), w and w gap are the width of the ell trip and width of the gap area (fig. S8A), repetively. note S2. Theoretial predition. The bending deformation of a bilayer biohybrid film i hown in fig. S8. A hown in fig. S8B, the ell layer ha a thikne t, and the thikne of latex i denoted a t. The hybrid film will bend and reah an equilibrium radiu R after the ontrating (ing) (fig. S8C). Aording to the Stoney formula under plane train ondition, we have E 2 t 6R F

4 where E E, E and 2 1 are the Young modulu and Poion ratio of latex ubtrate, F repreent the fore per unit length generated by the ell layer. The train of the ell layer ontain two ontributor, the ontratile train (at zero tre) due to ing 0 and the tenile train train in the top ell layer i def indued by the reitane of the latex layer due to bending. The total def 2t 3R The ell layer are ontrained by the ubtrate along x 2 diretion, and thi will alo ontribute to the ell tre through the Poion effet and lead to the following formula for the tre inide the ell layer 2t E E 1 3R E where E 2. Note that 33 inide the ell layer i aumed to be 0, a the ell layer an freely v 1 deform along x 3 diretion and the thikne of the ell layer i very mall. The thikne of the ell layer alo hange during the ing and an be expreed a t t 1 The thikne of ell layer will further hange after taking the bending deformation of the ell layer into aount, whoe effet on the tre alulation i negleted in the framework of linear elatiity. The total fore in the ell layer i 2t 1 F t Et 1 3R Comparing with the reult baed on the Stoney formula lead to

5 2 t F E 6R 2 t E E 1 6R 3R 2t 1 t where i the overage of the ell to aount for the gap between the ell line. The final bending urvature for the ingle layer i 1 R 1 t E t 6E t 3 For a given long trip (with length of L) of the bio-hybrid film, the bending angle an be expreed a L L 180 2R t 1 1 t 2 1 E 6E t (*) It hould be noted that Eq. (*) i derived in the framework of linear elatiity and the fully nonlinear analyi will be performed with finite element imulation a deribed in next etion. The overage ratio 8 Et aording to the experiment i et to be. If 1, and the bending angle an be implified 13 6E t a L 6E t t Et The above equation indiate the linear relationhip between the ell layer thikne and bending angle oberved in the experiment. Fitting the experimental data with Eq. 1 in the main text and auming 0. 3, we an obtain E 19E Note that the Poion ratio of the ell layer i an aumption.

6 note S3. Finite-element imulation. We developed a three-dimenional finite-element model to imulate the bending deformation of the biohybrid film, inluding the bilayer truture and andwih truture. The imulated bilayer truture i a retangle long trip with length a 12.0 mm and width a 9.1 mm. We did two et of imulation to tet the effet of hanging ell layer thikne and ubtrate thikne. For the firt et of imulation, the thikne of the ell layer hanged from 1 to 5 µm and the ubtrate thikne wa fixed a 0.2 mm. We alo ran imulation with the ell layer thikne fixed at 5 µm and varied the ubtrate thikne from 0.15 to 0.51 mm. The elati property of the ell layer wa modeled a linear elati material with geometry nonlinear deformation. The Young modulu and Poion ratio were taken a 70 MPa and 0.3 by fitting experimental data. The latex ubtrate i deribed a inompreible Neo-Hookean material with Young modulu a 3 MPa. All the numerial imulation were arried out with ABAQUS/Standard. The ell layer wa modeled with the C3D8R element and the latex ubtrate wa imulated with C3D8RH to deribe the inompreibility of the rubber material. The ontrating and welling behavior of the ell layer are modeled a thermal ontration and expanion in the numerial imulation. Typial bending of the bio-hybrid film from imulation an be found in movie S4. note S4. Garment deign priniple. When deigning the garment, the ize of bio-hybrid flap wa etimated baed on the body temperature profile. At low body temperature region, where kin i enitive to heat lo, maller ize of flap were applied to keep the till air layer adheive to the body, o that heat lo indued by environmental air turbulene ould be avoided. In Fig. 3D, the Y axi repreent the body temperature, and the orange olored blok area indiate the ize of the flap. It i lear that at low body temperature, the area of the blok are maller than thoe at high body temperature. Similarly, the perentage of kin expoure (or open perentage) i deigned baed on weat intenity. The open perentage indiate the total ratio of the kin expoed in a ertain defined area (it an ontain one big flap or everal mall flap, but with the ame open perentage). In Fig. 3D, the x axi depit that the weat intenity hange. The dahed line indiate the defined area under onideration, while the blok indiate the flap ize. It an be een that at a fixed weat intenity, the area perentage of the orange

7 blok inide the dahed line region i a fixed number. When inreaing the weat intenity, the open perentage inreae. note S5. Flap deign baed on heat map and weat map. The deign of the bio-flap onidered two important parameter: body temperature (repreented by unit ize) and weat intenity (repreented by open perentage). In fig. 3E, the left ide of body how how unit ize i hanging baed on different body temperature at different loation (fig. S10, A and B), and eah unit ize i different (ranging from 1.4 m to 3.5 m) with onideration of heat removal effiieny and urrent fabriation limitation. The right ide of the body repreent the relationhip between the open perentage and the weat intenity (fig. S10, C and D). The boundarie between eah defined area i highlighted, and the olor intenity indiate the ratio of the open area i adjuted (19 66%) baed on different weat rate ( g/m 2 -h). fig. S1. Surfae propertie of natural latex heet haraterized by SEM. Latex thikne: (A) 152 μm (B) 254 μm (C) 356 μm (D) 508 μm.

8 fig. S2. Bioprinter working priniple. (A) Mirodepoition bio-printer to depoit biologial ample through extruion. (B) SEM image of depoited ell thread (rak were formed due to vauum in SEM hamber). fig. S3. Cutomized humidity-ontrolled hamber. The etup inlude three main part: The firt module i the digital humidity enor that i ontained within the humidity ontrol box. The eond module i the ontrolled air oure. There are two air tream that ontain 0% RH and 100% RH repetively. The third module i the interfae and ontrol module. Through the omputer interfae, uer an input deired RH for the tet hamber. It take between 20 eond to 1 minute for the ytem to reat and reah the deired RH. The equipped digital humidity enor (HTU21D(F), Adafruit) ha a

9 typial auray of ±2% with an operating range that i optimized from 5% to 95% RH, and i onneted via I2C to the ontrol interfae. (A) (B) (C) (D) fig. S4. Single ell at different RH imaged by AFM. (A) relative volume, (B) relative length, (C) relative width, and (D) relative height.

10 fig. S5. Map of plamid pet11a-egfp-laz.

11 50 μm 50 μm 50 μm 50 μm 50 μm 50 μm fig. S6. Confoal image of ell lyate ontaining egfp. (A C) Image of a dried ample with merged hannel (A), fluoreene hannel (B), and under tranmitted light (C). (D F) Image of humidified ample with merged hannel (D), fluoreene hannel (E), and under tranmitted light (F). Some of the grey dot under tranmitted light (C and F) might be ellular oluble material. They might be partially diolved (F) at high humidity ondition, omparing imaging at low humidity (C) by hanging the refletive index.

12 152μm 254μm 356μm 508μm 152μm 254μm 356μm 508μm fig. S7. Strain and tre of biohybrid film at different RH.

13 (A) w w gap x 3 x 2 (B) x 1 t F t x 3 (C) x 1 R Neutral axi x 3 R x 1 fig. S8. Mehanial haraterization of a bilayer hybrid film. (A) Shemati of the truture of ell layer (red) and ubtrate (blue). (B) Bending deformation of a biohybrid film when welling. (C) Bending deformation of a biohybrid film when ontrating.

14 fig. S9. Aembly of a female running uit foued on the bak ventilation through heat pre. Layer from the top to the bottom (from the layer that i the loet to the kin) are meh fabri for paing, thermoplati polyurethane (TPU) for bonding with applied heat, trethy fabri, TPU for bonding, funtional bio-flap, TPU for bonding, and trethy fabri a the main bak panel.

15 (A) (B) (C)

16 (D) (E) fig. S10. Running uit pattern deign baed heat and weat map. (A) Heat map (30) of the bak. (B) Unit ize pattern deign baed on heat profile imulation. (C) Sweat map (29) of the bak. (D) Gap pattern deign baed on weat intenity imulation. (E) Optimized flap pattern deign onidering etheti.

17 fig. S11. Deign of the running hoe with multifuntional fluoreent flap. (A) Heat map of a right foot. (B) Hexagon alloation on the hoe ole. (C) Flap deign onidering heat map.

18 (A) (B) fig. S12. Sample tability tet under 100 -wet yle. Dry ondition wa performed by plaing the ample on a hotplate for 5 eond (50 C), while wet ondition wa performed by teaming for 5 eond. The two ondition were withed bak and fore every 10 eond. (A) Image of ample at repreentative -wet yle. The number indiate the yle time. (B) Quantitative meaurement of the ample bending behavior at -wet yle.

19 table S1. Sequene of the yntheti gene ued in thi tudy. Syntheti Gene Sequene egfp atgagaaggggaggagtgttaggggtggtgattggtgagtggaggga gtaaaggaaagttaggtgtgggaggggaggggatgataggaagtg atgaagttattgaaggaagtggtgtggatgtgaat gatagggtgagtgttaggtagaaatgaagagagattttaagt gatggaaggtagtaggaggaatttttaaggagaggaataaag agggaggtgaagttgaggggaatggtgaagatgagtgaagggat gattaaggaggaggaaattggggaaagtggagtaaataaaagaaa gttatatatgggaaagagaagaaggataaggtgaattaagatgaaaat gaggaggaggtgagtggaataagagaaaatgggagg gtgtgtggaaaatatgagaagtgtgagaaagaaaga gaagggataatggttgtggagttgtgagggggatattggatggag agtgtaaagtaa movie S1. Biohybrid bilayer film at different RH. movie S2. Single-ell volume hange when dereaing RH imaged by dark-field miroopy. movie S3. Fluoreene hange of biohybrid film at different RH. movie S4. Simulation of bilayer biofilm bending. movie S5. Simulation of andwih-trutured biofilm bending. movie S6. Flap opening for garment during exerie.