A Comparison and Combination of Plastid atpb and rbcl Gene Sequences for Inferring Phylogenetic Relationships within Orchidaceae

Transcription

1 Aliso: A Journal of Systematic and Evolutionary Botany Volume 22 Issue 1 Article A Comparison and Combination of Plastid atpb and rbcl Gene Sequences for Inferring Phylogenetic Relationships within Orchidaceae Kenneth M. Cameron New York Botanical Garden Follow this and additional works at: Part of the Botany Commons Recommended Citation Cameron, Kenneth M. (26) "A Comparison and Combination of Plastid atpb and rbcl Gene Sequences for Inferring Phylogenetic Relationships within Orchidaceae," Aliso: A Journal of Systematic and Evolutionary Botany: Vol. 22: Iss. 1, Article 36. Available at:

2 MONOCOTS Comparative Biology and Evolution Excluding Poales

3 Aliso 22, pp , Rancho Santa Ana Botanic Garden A COMPARISON AND COMBINATION OF PLASTID atpb AND rbcl GENE SEQUENCES FOR INFERRING PHYLOGENETIC RELATIONSHIPS WITHIN ORCHIDACEAE KENNETH M. CAMERON The Lewis B. and Dorothy Cullman Program for Molecular Systematics Studies, The New York Botanical Garden, Bronx, New York , USA (kcameron@nybg.org) ABSTRACT Parsimony analyses of DNA sequences from the plastid genes atpb and rbcl were completed for 173 species of Orchidaceae (representing 15 different genera) and nine genera from outgroup families in Asparagales. The atpb tree topology is similar to the rbcl tree, although the atpb data contain less homoplasy and provide greater jackknife support than rbcl alone. In combination, the two-gene tree recovers five monophyletic clades corresponding to subfamilies within Orchidaceae, and fully resolves them with moderate to high jackknife support as follows: Epidendroideae are sister to Orchidoideae, followed by Cypripedioideae, then Vanilloideae, and with Apostasioideae sister to the entire family. Although this two-gene hypothesis of orchid phylogeny is an improvement over all single-gene studies published to date, there is still no consensus as to how all the tribes of Epidendroideae are related to one another. Nevertheless, these new topologies help to clarify some of the anomalous results recovered when rbcl was previously analyzed alone, and demonstrate the value of continued plastid gene sequencing within Orchidaceae. Key words: atpb, DNA, evolution, molecular, Orchidaceae, phylogeny, plastid, rbcl, systematics. INTRODUCTION Orchidaceae are distributed throughout the world, and are by far the largest family of monocotyledons, with more than 75 genera and 3, species currently recognized. This immense diversity of taxa coupled with the complexity of orchid flowers presents a great challenge to plant systematists concerned with phylogeny reconstruction and classification (Atwood 1986). For this reason, molecular sequence data have been a boon to orchidologists, since it allows for large amounts of data to be generated for many taxa, and with relatively minimal cost, time expenditure, and difficulty. The first published molecular phylogeny for Orchidaceae employed plastid rbcl sequences from 33 orchids plus 62 other lilioid monocots (Chase et al. 1994). Although limited in taxon sampling, that study showed that the neottioid orchids are polyphyletic, and thus implied that the orchids might be divided best into five subfamilial lineages: the apostasioid and cypripedioid orchids (each sometimes treated as distinct families), orchidoids (including the diurid and spiranthoid orchids), and epidendroids (including the neottioid and vandoid orchids). Only Vanilla Plum. ex Mill. and Pogonia Andrews were sampled to represent the vanilloid orchids, but this lineage showed itself to most likely represent a distinct subfamilial clade (Vanilloideae) as well. The rbcl matrix used by Chase et al. (1994) was expanded substantially by Cameron et a!. (1999) to include 158 ingroup and 13 outgroup taxa. Since that study contains the greatest genus and species level sampling to date, it has remained a standard to which most subsequent molecular phylogenetic studies of orchids have been compared (e.g., van den Berg et al. 25). A handful of additional phylogenetic studies focused on the entire Orchidaceae have been published using genes other than rbcl (e.g., ndhf by Neyland and Urbatsch 1995, 1996; 18S by Cameron and Chase 2; matk by Freudenstein et al. 24), but only the mitochondrial nadl b-e intron published by Freudenstein et a!. (2) and Freudenstein and Chase (2 1) have considered enough taxa (ca. 1) to adequately depict higher level orchid relationships. Unfortunately, the level of sequence variation exhibited in the mitochondrial nadlb-c intron was also insufficient for addressing relationships much below the rank of subfamily or tribe. Since no clear consensus has been reached regarding relationships among the subfamilies, tribes, or subtribes of Orchidaceae, a return to the plastid genome as a source of new phylogenetic information is warranted and justified given the well-known advantages of working with chloroplast DNA. These have been discussed previously by Palmer et al. (1988), Clegg and Zurawski ( 1992), Olmstead and Palmer (1994 ), among others, and include unilateral inheritance, numerous copies per cell, ease of amplification and sequencing, absence in animals and fungi, etc. Although there are a number of plastid loci that could have been chosen, atpb was sequenced to complement the previously published rbcl data of Cameron et a!. ( 1999) since its utility for family level systematics studies has been documented for a number of other plant groups (Hoot et al. 1995; Savolainen et al. 2). This gene is located downstream from rbcl in the large single copy region, and encodes one of the subunits of ATP synthase, an enzyme that couples proton translocation across membranes during the synthesis of ATP. Furthermore, a coding region was desired for sequencing so that issues of alignment (i.e., character homology assessment) would be minimized for this diverse assemblage of taxa. MATERIALS AND METHODS Taxon Sampling and Gene Sequencing Nearly complete DNA sequences for atpb (ca. 15 basepairs [bp]) were obtained from 173 species of Orchidaceae

4 448 Cameron ALISO (representing I 5 different genera) and nine genera from Asteliaceae, Blandfordiaceae, Boryaceae, Hypoxidaceae, and Lanariaceae to serve as outgroup taxa. In order to fill in taxonomic gaps and to compare these data with the published rbcl phylogeny of Orchidaceae (Cameron et al. 1999), an additional 3 new sequences of rbcl were also completed; the remaining rbcl sequences were downloaded from GenBank as indicated in Table 1. This resulted in completely congruent matrices for all 182 taxa at the generic level. An effort was made to sequence atpb from the same species as previously done for rbcl (in many cases the same DNA aliquot was used), but this was not always possible (see Table 1). The entire data matrix is available from the author upon request or can be downloaded from The New York Botanical Garden website at res/cullb/dna.html (May 25). All of the newly generated sequences were produced by automated methods, briefly described as follows. Most of the total DNA was extracted using the FastPrep l (Qbiogene, Inc., Carlsbad, California, USA) and glassmilk method from approximately.5 cm 2 dried leaf tissue, as described by Struwe et al. (1998). In some cases, DNA aliquots were obtained from the Royal Botanic Gardens, Kew DNA bank (see Table I). Target loci were amplified in 5 f.ll volumes using standard polymerase chain reaction (PCR) protocols that typically included the addition of bovine serum albumin (BSA) and betaine, which may or may not have been necessary. The annealing temperature used to amplify both genes was 55 C. For atpb, primers originally published by Hoot et al. (1995), herein designated "nyl72": TATGA GAATCAATCCTACTACTTCT and "nyl73": TCAGTA CACAAAGATTTAAGGTCAT, were used for amplification. Both of these together with "nyl74": AACGTACTCGTGA AGGAAATGATCT and "nyl75": TAACATCTCGGAAA T A TTCCGCCAT were used for sequencing. For rbcl, primers "ny35": CTTCACAAGCAGCAGCTAGTTC and "nyl49": ATGTCACCACAAACAGAAAC were used for amplification together with "ny23": GCGTTGGAGAGAT CGTTTCT and "ny28": TCGCATGTACCYGCAGTTGC for sequencing. In all cases, resulting PCR products were purified using QIAquick l spin columns (QIAGEN, Inc., Valencia, California, USA) according to the manufacturer's protocols. Cycle sequencing reactions were performed using a combination of purified PCR template, primer, and BigDye Reaction mix (Applied Biosystems, Inc., Foster City, California, USA) for 2 cycles. These reactions resulted in complete forward and reverse strands of the genes for nearly all sequences. Centri-SepG5ll sephadex columns (Princeton Separations, Inc., Adelphia, New Jersey, USA) were used according to the manufacturer's instructions to remove excess dye terminators and primer from the cycle sequencing products. These were subsequently dehydrated, resuspended in a mixture of formamide and loading dye, and loaded onto a 5% denaturing polyacrylamide gel. Samples were analyzed on an Applied Biosystems ABI 377XL automated DNA sequencer, and resulting electropherograms were edited using Sequencher vers. 3. software (Gene Codes Corporation, Ann Arbor, Michigan, USA). Phylogenetic Analyses The individual atpb and rbcl matrices, as well as the combined two-gene matrix, were analyzed using the parsimony criterion in PAUP* vers. 4.b1 (Swofford 22) with gaps treated as missing data, characters weighted equally, and with DELTRAN optimization of characters onto resulting trees. The sequenced genera from Asteliaceae, Blandfordiaceae, Boryaceae, Hypoxidaceae, and Lanariaceae were specified as a monophyletic outgroup based on topologies uncovered in broader phylogenetic studies of monocots (Chase et al. 1995, 2). Equally parsimonious trees were found by executing a heuristic search of 1 random addition replicates using tree bisection and reconnection (TBR) branch swapping, but saving only five trees per replicate in order to discover possible "islands" of maximum parsimony (MP) (Maddison 1991 ). All trees obtained in the first round of searching were then used as starting trees for a second heuristic search using the same parameters, but this time saving all shortest trees (MULTREES option in effect) until a MAXTREE limit of 1, trees was reached. Support values for the relationships discovered by analysis of each matrix were calculated by performing jackknife (jck) analyses of 5 heuristic search replicates using the TBR branching swapping algorithm and the following settings: 37% deletion, emulate "jac" resampling, one random addition per replicate, holding one tree, and saving two trees per replicate. Finally, a partition homogeneity test ( = incongruence length difference [ILD] test) was conducted in PAUP* to test for incongruence between the atpb and rbcl matrices. Analysis of atpb RESULTS The strict consensus of all equally parsimonious trees discovered by independent analysis of the atpb data is presented as Fig. 1-2 with jackknife values >5% indicated. The atpb matrix contains 154 characters of which 668 ( 44%) are variable and 459 (31% of total) parsimony informative. Analysis of these data resulted in more than 1, trees of maximum parsimony (length of 2499 steps, CI of.389, and RI of.73). A single atpb tree is presented as a phylogram in Fig. 3 to highlight variation in branch lengths. Overall, the strict consensus of these trees is similar to published phylogenetic reconstructions for Orchidaceae (e.g., Kores et al. 1997; Cameron et al. 1999; Freudenstein and Chase 21). The five subfamilies recognized by Pridgeon et al. (1999) are monophyletic and each is supported by high jackknife support ranging from 87-1%. Epidendroideae are supported as sister to Orchidoideae s.l. (94% jck), and Cypripedioideae are sister to this pair (84% jck). The positions of Apostasioideae and Vanilloideae among the subfamilies are unresolved. In total, 8 clades receive jackknife support >5% (64 of these '275%). Analysis of rbcl A strict consensus topology similar to that obtained with atpb and with comparable resolution and jackknife support resulted from independent analysis of the rbcl matrix (tree not shown). In this case, the matrix consists of 133 characters; 65 (46%) of these are variable and 373 (28% of total) are parsimony informative. Again, the analysis yielded more than 1, equally parsimonious trees with a length of 2217 steps, CI of.368, and RI of.687. The trees are

5 Table I. Species analyzed. Arranged by family, subfamily, tribe, subtribe, and genus where applicable (Orchidaceae sensu Dressler 1993). < 1:"' GenBank c Family, subfamily, tribe, subtribe, accession- genus, and species Voucher-rbcL rbcl' Species-atpB Voucher-atpB ti1 N ASTELIACEAE N Astelia alpina R. Br. Chase 113 (K)h Z77261 Astelia menziesiana Sm. Cameron I I29 (NY) Milligania stylosa F. Muell. ex Benth. Chase 5 I I (K) Z73693 BLANDFORDIACEAE Blandfordia punicea Sweet Chase 5I9 (K) Z73694 BORYACEAE Borya septentrionalis F. Muell. Chase 225 (K) Yl4985 Curculigo capitulata Kuntze Chase 25 (NCU) Z7371 same species Cameron I I I 8 (NY) Hypoxis hirsuta L. Chase 18 (NCU) Z7372 same species Cameron 2I32 (NY) Pauridia longituba M. E. Thompson Snijman s.n. (WBG) Yl4991 Rhodohypoxis milloides (Baker) Hilliard & B. L. Burtt Chase 479 (K) Z7728 same species Cameron I I 2 (NY) LANARIACEAE Lanaria lanata Druce Goldblatt 941 (MO) Z77313 same species Chase 458 (K) ORCHIDACEAE!::) APOSTASIOIDEAE "S ttl Apostasia stylidioides Rchb. f. Clements 4823 (CBG) Z7375 same species Cameron 2229 (NY) Neuwiedia veratrifolia Blume Clements 591 (CBG) AF742 same species Cameron I 1 (NY).., n ;:r CYPRIPEDIOIDEAE.:!:>) n Cypripedium passerinum Richards Albert 48 (NCU) AF74142 Cypripedium pubescens Willd. NYBG-living (')!:>) Mexipedium xerophyticum V. A. Albert & M. W. Hegedus s.n. (AMO) AF74193 same species Cameron 2I4I (NY) (') Chase ;:r Paphiopedilum sukhakulii Schoser & Senghas Albert IOO (NCU) AF7429 Paphiopedilum philippinense Cameron I I 34 (NY) '< "' Phragmipedium longifolium (Rchb. f. & Warsc.) Rolfe Albert I 8 (NCU) AF74212 same species Cameron 1 I7 (NY) Cl'> Selenipedium chica Rchb. f. Albert I67 (NCU) AF74227 Selenipedium aequinoctiale Garay NYBG-living s.n. (') ::; '< SPIRANTHOIDEAE CRANICHIDEAE CRANICHIDINAE Cranichis fertilis Schltr. Chase -4I (K) AF74137 Cranichis Sw. sp. Ponthieva racemosa (Walter) Mohr Chase -398 (K) AF74223 Ponthieva R. Br. sp. ML 341 (NY) Pterichis Lind!. sp. Weigend (NY) AY Weigend (NY) GOODYERINAE Gonatostylis veillardii (Reich. f.) Schltr. Cameron 1174 (NY) AY Goodyera pubescens (Willd.) R. Br. Chase -2I2 (K) AF74174 same species Cameron I64 (NY) Platythelys querceticola (Lind!.) Garay Chase -378 (K) AF74216 Pristiglottis montana (Schltr.) Cretz. & J. J. Sm. Cameron 2I5I (NY) AY PACHYPLECTRONINAE Pachyplectron arifolium Schltr. Ziesing 22 (CBG) AF7425 same species Cameron I I 7 I (NY) PRESCOTTIINAE Aa paleacea Kunth Chase -535 (K) AF7415 Prescottia Lind!. sp. Christenson s.n. AY SPIRANTHINAE Spiranthes cernua (L.) Richard Chase -42 (K) AF74229 Spiranthes romanzo.ffiana Cham. Grant 3757 (NEU)... '{) Stenorrhynchos speciosum (Jacq.) Rich. ex Spreng. NYBG-living b AY381135

6 -!'- Table I. Continued. u, GenBank Family, subfamily, tribe, subtribe, accessiongenus, and species Voucher-rbcL rbcl" Species-atpB Voucher-atpB TROPIDIEAE Corymborkis Thouars sp. Chase -542 (K) AF74136 Corymborkis veratrifolia (Reinw.) Bl. Motley 2231 (NY) Tropidia Lind!. sp. Chase -211 (K) AF74237 Tropidia effusa Rchb. f. Motley 2234 (NY) DISEAE DISINAE Disa tripetaloides (L. F.) N. E. Br. Cameron 147 (NCU) AF74151 same species Cameron 2143 (NY) SATYRIINAE Satyrium nepalense D. Don Chase -539 (K) AF74226 DIURIDEAE ACIANTHINAE Acianthus exsertus R. Br. Chase -565 (K) AF7411 Corybas diemenicus (Lind!.) Rupp Chase -564 (K) AF74135 Corybas trilobus Rchb. f. Cameron 111 (NY) CALADENIINAE Adenochilus nortonii Fitzg. Chase -567 (K) AY38118 Aporostylis bifolia (Hook. f.) Rupp & Hatch Cameron 1144 (NY) AY38119 Caladenia cf. caerulea R. Br. Chase -487 (K) AF74116 Caladenia lyallii Hook. f. Cameron 113 (NY) Cyanicula gemmata (Lind!.) S. D. Hopper & A. P. Chase -83 (K) AY n Brown Eriochilus cucullatus (Labill.) Rchb. Chase -566 (K) AF74166 "' 3 Glossodia major R. Br. Chase -568 (K) AF74173 "... ;:l Leporella fimbriata (Lind!.) George Chase -835 (K) AY Lyperanthus nigricans R. Br. Chase -836 (K) AF74187 Chase -567 (K) Rimacola elliptica (R. Br.) Rupp Chase (K) AY CHLORAEINAE Chloraea Rchb. f. sp. Chase -551 (K) AF74125 Weigend (NY) Codonorchis lessonii Lind!. Sobel & Strudwick 2626 (NY) AY Megastylis glandulosus Schltr. Ziesing 29 (CBG) AF74191 same species Cameron 9814 (NY) Megastylis latissima (Schltr.) Schltr. Motley 2149 (NY) AY Megastylis rara (Schltr.) Schltr. Cameron 23 (NY) AY CRYPTOSTYLIDINAE Coilochilus neocaledonicus Schltr. Cameron 2117 (NY) AY Cryptostylis subulata (Labill.) Rchb. Chase -332 (K) AF7414 Cryptostylis arachnites Bl. Cameron 115 (NY) DIURIDINAE Diuris sulphurea R. Br. Chase -554 (K) AF74152 Orthoceras strictum R. Br. Chase -571 (K) AF7424 same species Cameron 1161 (NY) DRACAENINAE Chiloglottis trapeziformis Fitzg. Chase -569 (K) AF74124 Chiloglottis cornuta Hook. f. Cameron 114 (NY) PRASOPHYLLINAE Microtis parviflora R. Br. Chase -553 (K) AF74194 Microtis unifolia Rchb. f. Cameron 1152 (NY) PTEROSTYLIDINAE > t"" Pterostylis nutans R. Br. Chase -533 (K) AF74224 Pterostylis oliveri Petrie Cameron ll2 (NY) til THEL YMITRINAE Calochilus robertsonii Benth. Chase -57 (K) AF74118 Calochilus R. Br. sp. Chase -488 (K)

7 Table I. Continued. < t"" e GenBank Family. subfamily, tribe, subtribe, accession- m genus, and species Voucher-rbcL rbcl' Species-atpB Voucher-atpB N N Thelymitra J. R. Forst. & G. Forst. sp. Chase -489 (K) AF74232 Thelymitra longifolia J. R. Forst. & Cameron 989 (NY) G. Forst. ORCHIDEAE HABENARIINAE Cynorkis fastigiata Thou. Motley 2273 (NY) AY Habenaria repens Nutt. Chase -381 (K) AF74177 Habenaria Willd. sp. Alves 2165 CORYCIINAE Corycium carnosum Rolfe Chase -692 (K) AY Disperis capensis Sw. Chase -123 (K) AY38112 ORCHIDINAE Galearis spectabilis (L.) Raf. Cameron 196 (NY) AY Ophrys apifera Hudson Chase -536 (K) AF7422 Orchis quadripunctata Cyrillo ex Tenore Chase -911 (K) AF7423 Platanthera ciliaris (L.) Lind!. Albert 54 (NCU) AF74215 Platanthera obtusata Lind!. Grant 3758 (NEU)., EPIDENDROIDEAE '6' t!l NEOTTIEAE LIMODORINAE (l ;:l" Cephalanthera damasonianum (Miller) Druce Chase -575 (K) AF74123 Cephalanthera longifolia Fritsch Cameron s.n..: I" Epipactis helleborine (L.) Crantz Chase -199 (K) Z7377 Cameron 197 (NY) (') (1) LISTERINAE Listera smallii Wiegand Cameron 11 (NCU) AF74184 Listera ovata R. Br. Paris-living s.n. '1:l ;:l" '< NERVILIEAE (1Q Nervilia bicarinata Schltr. Chase -58 (K) AF74199 (1) ::> '< PALMORCHIDEAE Palmorchis trilobulata L.. Williams Chase -462 (K) AF7426 TRIPHOREAE Monophyllorchis Schltr. sp. Chase -435 (K) AF74195 Monophyllorchis maculata Garay Cameron 2142 (NY) Triphora trianthophora (Swartz) Rydb. Chase -379 (K) AF74236 VANILLEAE GALEOLINAE Cyrtosia septentrionalis (Rchb. f.) L. A. Garay Chase -793 (K) AY Erythrorchis altissima (Bi.) Bl. Cameron 129 (NCU) AF74168 Erythrorchis cassythoides (Cunn. ex Lind!.) Garay Weston 1831 (NCU) AF74169 Pseudovanilla foliata (E Muell.) Garay Chase -79 AY38113 Pseudovanilla ponapensis (Kaneh. & Yamam.) Cameron 1114 (NY) AY L.A. Garay VANILLINAE Clematepistephium smilacifolium Halle Ziesing 33 (CBG) AF74131 Epistephium Humbert sp. Chase -432 (K) AF74159 Epistephium sp. Chase -433 (K) AF7416 Epistephium cf. lucidum Cogn. Chase -795 (K) AF Vl Epistephium parv(fiorum Lind!. Chase -794 (K) AF74162 I" (1)

8 Table l. Continued. u. N """ GenBank Family, subfamily, tribe, subtribe, accessiongenus, and species Voucher-rbcL rbcl' Species-atpB Voucher-atpB Epistephium subrepens Hoehne Chase -815 (K) AF74163 Eriaxis rigida Rchb. f. Ziesing 5 (CBG) AF74165 same species Vanilla africana Lind!. Chase -584 (K) AF74239 Vanilla aphylla Bl. Chase -578 (K) AF74238 Vanilla cf. barbellata Rchb. f. Chase -591 (K) AF7424 Vanilla imperialis Kraenzlin Chase -587 (K) AF7424l Vanilla inodora Schiede McCartney s.n. AY38ll36 Vanilla palmarum Lind!. Santo s.n. AY Vanilla cf. planifolia Andrews Chase -17 (K) AF74242 Vanilla roscheri Rchb. f. Chase -54 (K) AF74243 CYMBIDIOID PHYLAD CALYPSOEAE Aplectrum hyemale Nutt. Chase -14 (K) AF7418 same species Cameron 2144 (NY) Calypso bulbosa (L.) Oakes Grant (US) AF7412 same species Grant 3763 (NEU) Tipularia discolor (Pursh) Nutt. Freudenstein s.n. AF74234 same species Cameron 2145 (NY) CYMBIDIEAE CATASETINAE Catasetum expansum Rchb. f. Chase -224 (K) AF7412l Catasetum Rich. ex Kunth sp. NYBG-living c Dressleria eburnea (Rolfe) Dodson Chase -313 (K) AF74153 (j l'l CYRTOPODIINAE a (1) Ansellia gigantea Rchb. f. Chase -429 (K) AF7417 Ansellia africana Lind!. NYBG-living 3199 "' ::; Cymbidium ensifolium (L.) Sw. Chase -29 (K) AF74141 Cymbidium goeringii (Rchb. f.) Rchb. f. Cameron 198 (NY) Cyrtopodium andersonii (Lamb. ex Andrews) Chase -341 (K) AF74143 NYBG-living 246 R. Br. Galeandra devoniana Schomb. ex. Lind!. Chase -382 (K) AF74171 Grammatophyllum speciosum Blume Chase -89 (K) AF74176 Grammatophyllum scriptum Bl. NYBG-living s.n. EULOPHIINAE Eulophia nuda Lind!. Chase -292 (K) AF7417 Eulophia petersii Rchb. f. NYBG-living 142 GOVENIINAE Govenia Lind!. sp. Chase -146 (K) AF74175 Govenia superba Lind!. ex Lodd. Cameron 2153 (NY) MALAXIDEAE Liparis liliifolia (L.) L. C. M. Rich. ex Lind!. Chase -214 (K) AF74183 Liparis viridifiora Lind!. NYBG-Iiving 225 Malaxis spicata Sw. Chase -377 (K) AF74188 same species McCartney s.n. MAXILLARIEAE CRYPTARRHENINAE Cryptarrhena Lind!. sp. Chase -37 (K) AF74138 Cryptarrhena lunata R. Br. FLAS-living 98 LYCASTINAE Lycaste cruenta Lind!. unknown AF74185 Lycaste aromatica Lindl. NYBG-living MAXILLARIINAE Bifrenaria harrisoniae (Hook.) Rchb. f. Chase -95 (K) AF74112 same species Chase 8686 (K) Cryptocentrum peruvianum (Cogn.) C. Schweinf. Chase -115 (K) AF74139 Cryptocentrum Benth sp. FLAS-living s.n. ;p Maxillaria cucullata Lindl. Chase -85 (K) AF7419 Maxillaria nasuta Rchb. f. Cameron 171 (NY) c [JJ

9 Table I. Continued. < r c GenBank 2::: Family. subfamily. tribe. subtribe. accession- tr1 genus, and species Voucher-rbcL rbcl" Species-atpB Voucher-atpB N N Xylobium Lind!. sp. unknown AF74245 Xylobium variegatum (Ruiz & Pav.) NYBG-living 314 Garay & Dunst. ONCIDIINAE Oncidium excavatum (Rchb. f.) Lind!. Chase -86 (K) AF7421 Oncidium ornithorhynchum H. B. & K. Cameron lf24 (NY) STANHOPEINAE Acineta chrysantha Lind!. & Paxt. Chase -251 (K) AF7412 same species NYBG-living 2291 Coryanthes verrucolineata G. Gerlach Chase -51 (K) AF74134 Coryanthes mastersiana F. C. Lehm. NYBG-living s.n. Houlletia sanderi Rolfe Chase -5 (K) AF74178 FLAS-living 9379 Kegeliella kupperi Mansf. Chase -495 (K) AF74181 Kegeliella atropilosa L.. Williams & Chase (K) A. H. Heller Lycomormium squalidum Rchb. f. Chase -273 (K) AF74186 Lycomormium Rchb. f. sp. FLAS-living 8756 Stanhopea ecornuta Lemaire Chase -255 (K) AF7423 Stanhopea Frost ex Hook. sp. Cameron 1126 (NY) TELIPOGONINAE Stellilabium pogonostalix (Rchb. f.) Garay Chase -123 (K) AF74231 & Dunst. "B " ttl ZYGOPETALINAE... Dichaea riopalenquensis Dodson Chase -114 (K) AF74149 Dichaea Lind!. sp. Cameron 1127 (NY) n ::r Huntleya heteroclita (Poepp. & End!.) Garay Whitten 8823 (FLAS) AF74179 : Zygopetalum intermedium Hort. Petrop. ex Regel Chase -16 (K) AF74246 Zygopetalum mackaii Hook. NYBG-living 232 n "" EPIDENDROID PHYLAD ARETHUSEAE ARETHUSINAE Arethusa bulbosa L. Chase -88 (K) AF7419 BLETIINAE Acanthephippium mantinianum Lind!. & Cogn. Chase -397 (K) AF741 Bletia cf. purpurea (Lam.) DC. Chase -581 (K) AF74113 Bletia Rufz & Pav. sp. FLAS-living s.n. Bletilla striata (Thunb.) Rchb. f. Chase -556 (K) AF74114 same species NYBG-Iiving s.n. Calanthe triplicata (Willemet) Ames Chase -27 (K) AF74117 same species Motley 2291 (NY) Calopogon tuberosus (L.) Britton. Sterns Chase -876 (K) AF74119 Calopogon pallidus Chapm. Cameron 161 (NY) & Poggenb. Phaius minor Blume Chase -325 (K) AF7421 Phaius tankervilleae (Aiton) Blume NYBG-living Spathoglottis pacifica Rchb. f. Motley 2277 (NY) AY CHYSIINAE Chysis bractescens Lind!. Chase -436 (K) AF74126 same species NYBG-living 1129 COELOGYNEAE COELOGYNINAE Coelogyne cristata Lind!. Chase -491 (K) AF74133 same species NYBG-living 325 Dendrochilum cobbianum Rchb. f. Cameron 1116 (NY) AY THUNIINAE Thunia alba Rchb. f. Chase -589 (K) AF74233 Thunia marshalliana Rchb. f. NYBG-living 3481 EPIDENDREAE I ARPOPHYLLINAE Arpophyllum giganteum Hartweg ex Lind!. Chase -586 (K) AF7411 same species NYBG-living 323,.,,., "" '" ::r '< (fq,., ::l '< u, w

10 Table 1. Continued. GenBank Family. subfamily. tribe. subtribe, accessiongenus, and species Voucher-rbcL rbcl" Species-atpB Voucher-atpB +- Ul +- COELIINAE Coelia triptera (Smith) G. Don ex Steud. Chase -324 (K) AF74132 Coelia bella Rchb. f. FLAS-living s.n. LAELIINAE Cattleya dowiana Batem. & Rchb. f. Chase -282 (K) AF74122 Cattleya percivaliana Hort. NYBG-living 352 Dilomilis montana (Sw.) Summerh. Chase -26 (K) AF7415 Encyclia Hook. sp. unknown AF74157 Encyclia cochleata (L.) Dressler Cameron 1115 (NY) Epidendrum L. sp. unknown AF74158 Epidendrum ciliare Linn. NYBG-living 217 MEIRACYLLIINAE Meiracyllium trinasutum Rchb. f. Chase -22 (K) AF74192 same species NYBG-living 5178 PLEUROTHALLIDINAE Masdevallia infracta Lind!. Chase -294 (K) AF74189 same species NYBG-living 5377 Pleurothallis endotrachys Rchb. f. Chase -36 (K) AF74217 Pleurothallis restrepioides Lind!. Cameron 1128 (NY) Restrepia Kunth sp. unknown AF74225 Restrepia sanguinea Rolfe NYBG-living a SOBRALIINAE Elleanthus Pres! sp. Chase -374 (K) AF74156 Elleanthus caravata Rchb. f. NYBG-living 1437 Sobralia macrantha Lind!. Chase -2 (K) AF74228 same species NYBG-living 3557 EPIDENDREAE II n GLOMERINAE "' 3 (1) Earina autumnalis Hook. f. Chase -298 (K) AF74155 Earina deplanchei Rchb. f. Cameron 981 (NY) a Glomera Blume sp. Chase -555 (NCU) AF74172 Glomera macdonaldii (Schltr.) Ames Motley 22 (NY) ::> POL YSTACHYINAE Polystachya pubescens (Lind!.) Rchb. f. Chase -152 (K) AF74222 Polystachya Hook. sp. NYBG-living a PODOCHILEAE BULBOPHYLLINAE Bulbophyllum lobbii Lind!. Chase -474 (K) AF74115 DENDROBIINAE Cadetia taylori (F. Muell.) Schltr. Shiraishi 132 c D5846 same species NYBG-living a Dendrobium kingianum Bidw. Chase -164 (K) AF74146 same species NYBG-living 4527 Epigeneium acuminatum (Rolfe) Summerh. Shiraishi 84c D5841 Epigeneium cymbidioides (Bl.) NYBG-living 4549 Summerh. ERIINAE Eria ferruginea Teijsm. & Binn. Chase -59 (K) AF74164 Eria javanica (Swartz) Bl. NYBG-living 2816 Trichotosia ferox Blume Chase -396 (K) AF74235 PODOCHILINAE Podochilus cultratus Lind!. Chase -559 (K) AF74218 THELASIINAE Phreatia Lind!. sp Chase -23 (K) AF74214 Phreatia sp. Cameron 248 (NY) VANDEAE AERIDINAE ;p... t"" Cleisostoma rolfeanum (King & Pantling) Garay Jarrell s.n. AF7413 Cleisostoma arietinum (Rchb. f.) Garay NYBG-living 4592 Cll Neofinetia falcata (Thunb.) S. Y. Hu Jarrell s.n. AF74197 same species NYBG-living 597

11 Table I. Continued. <?2 c::: ttl N N Family, subfamily, tribe, subtribe, genus, and species Voucher-rbcL GenBank accessionrbcl" Species-atpB Voucher-atpB Phalaenopsis equestris (Schauer) Rchb. f. ANGRAECINAE Aeranthes ramosa Rolfe Angraecum sesquipedale Thouars AERANGIDINAE Aerangis calligera (Rchb. f.) Garay Diaphananthe rutila (Rchb. f.) Summerh. ANOMALOUS EPIDENDROIDEAE ARUNDINAE Arundina graminifolia (D. Don) Roehr. POGONIINAE Cleistes L. C. Richard sp. Cleistes sp. 2 Cleistes sp. 3 Cleistes cipoana Hoehne Cleistes divaricata (L.) Ames Cleistes rosea Lind!. Duckeella adolphii Porto & Brade!sotria medeoloides Rafin.!sotria verticillata (Muhl. ex Willd.) Raf. Po gonia japonica Rchb. f. Pogonia minor (Makino) Makino Pogonia ophioglossoides (L.) Jussieu Jarrell s.n. Jarrell s.n. Jarrell s.n. Jarrell s.n. Jarrell s.n. Chase -395 (K) Chase -43 (K) Jardim 2579 (NY) Thomas!2975 (NY) Thomas (NY) Chase -376 (K) Cameron 138 (NCU) Romero 313 (AMES) Keenan s.n. Cameron 13 (NCU) Cameron 134 (NCU) Cameron 133 (NCU) Chase -437 (K) AF74211 AF7414 AF7416 AF7413 AF74147 AF74111 AF74129 AY38111 AY AY AF74127 AF74128 AF74154 AY AF7418 AF74219 AF7422 AF74221 same species Aeranthes grandifiorus Lind!. Angraecum comorense Finet Aerangis ugandensis Summerh. same species same species same species NYBG-living s.n. FLAS-living s.n. Cameron 2129 (NY) NYBG-living NYBG-living 543 Motley 2289 (NY) Cameron 162 (NY) ;:, " ttl (l ::r 5: (1) ;)! '< CTQ (1) ::s '< ANOMALOUS Eriopsis biloba Lind!. Neomoorea irrorata (Rolfe) Rolfe Nephelaphyllum pulchrum Bl. Xerorchis amazonica Schltr. Chase -52 (K) Chase -53 (K) Cameron 116 (NY) Romero 314 (AMES) AF74167 AF74198 AY AF74244 same species Neomoorea wallisii Schltr. FLAS-living s.n. FLAS-living 91 Accession numbers prefixed by AF, Y, or Z are from GenBank and those with D are DNA Data Bank of Japan (DDBJ). b Chase vouchers represent orchid DNA collection numbers from the Kew (K) DNA bank. New atpb sequences for this study will be made available in GenBank at a future time. Ul Ul ""'"

12 456 Cameron ALISO 87 EPIDENDROIDEAE continued as Fig r---'9:..:6' Spiranthes ' Stenorrhynchos 85 Cranichis Ponthieva Pefexia Aa ' Prescottia 7 Pristiglottis Pfatythefys f Gonatostyfis L Goodyera r L {======Pachyplectron L Pterostyfis Megasty/is glandulosa.. "' " "' :c u ;: E u "' " "' " w <( w c 5:.. "' " "' :c!::! I CYPRIPEDIOIDEAE "' ;: "' 'l w <( w...j...j z > APOSTASIOIDEAE outgroup families Fig. ].-Genera from outgroup families and orchid subfamilies Apostasioideae, VaniJJoideae, Cypripedioideae, and Orchidoideae representing half of the strict consensus tree resulting from analysis of atpb sequences for Orchidaceae. Subfamilies and tribes sensu Chase, Freudenstein, and Cameron (23) are indicated in boldface where applicable, and jackknife values >5% are given for supported clades. The tree continues in Fig. 2.

13 VOLUME 22 atpb Orchidaceae Phylogeny I ;-- 87 r--- ;-- ;-- 87, I 63.r-- I ; Coryanthes Stanhopea Acineta Houlfetia Kegelielfa Dichaea Huntleya Zygopetalum Cryptarrhena Cryptocentrum Maxil/aria Bifrenaria Lycaste Eriopsis Neomoorea Stelfilabium Lycomormium Xylobium 87 Oressleria 91.r--L---- Galeandra Catasetum Cyrlopodium Oncidium Eulophia Ansellia 93 Cymbidium Grammatophylfum Calypso - Tipularia Aplectrum Govenia Coelia Chysis Bletia Masdevallia 5 Pleurothallis Restrepia Dilomilis Arpophylfum Cattleya Encyc/ia Epidendrum Meiracyllium Calanthe 2 Phaius Nephelaphylfum Acanthephippium Spathoglottis Aerangis 3 Diaphananthe Aeranthes Angraecum Cleisostoma.--- Neofinetia 7 96 L 1..._ I 7 r---r--c= ::...r r--L---- Phalaenopsis Polystachya Cadetia Dendrobium Epigeneium Bulbophylfum Liparis Malaxis Eria Trichotosia Podochilus Phreatia Earina Arethusa Calopogon Arundina Bletilla Coelogyne Dendrochilum Glomera Thunia Elfeanthus Sobralia Corymborkis Tropidia Monophylforchis Triphora Palmorchis Epipactis List era Cephalanthera Nervilia Xerorchis Orchidoideae Cypripedioideae Vanilloideae Apostasioideae Outgroup families Cymbidieae I Calypsoeae Epidendreae Vandeae Dendrobieae > Malaxideae Podochileae Arethuseae > Sobralieae > Tropidieae > Triphoreae Neottieae > Nervilieae Fig. 2.-Genera from Epidendroideae (including neottioid and vandoid orchids) representing half of the strict consensus tree resulting from analysis of atpb sequences for Orchidaceae. Continued from Fig. 1. Tribes (in boldface) sensu Chase, Freudenstein, and Cameron (23) are indicated where applicable, and jackknife values >5% are given for supported clades.

14 458 Cameron ALISO w c 5 c s: (.) a:: w c 5 iii 1/) 11. <( w c 5...I...I z outgroup families changes

15 VOLUME 22 atpb Orchidaceae Phylogeny 459 Table 2. Matrix and tree statistics for the separate and combined gene analyses of Orchidaceae rbcl and atpb. No. taxa No. characters No. variable characters (% of total) 65 (45.49%) 668 (44.1%) 1273 (44.92%) No. informative characters (% of total) 373 (28.5%) 459 (3.52%) 832 (29.36%) No. trees >1, >1, >1, Tree length steps CI/CI excluding uninformative.368/ / /.32 RI.687 No. clades with >5%/>75% bootstrap support 66/ /64 112/75 based on ca. 1% greater taxon sampling than the rbcl consensus tree for Orchidaceae published by Cameron et al. (1999), but differ only slightly. Although there is no jackknife support for the relationships among the five subfamilies, they are fully resolved as follows: Epidendroideae are sister to Orchidoideae, Vanilloideae are sister to this pair, followed by Cypripedioideae, and with Apostasioideae sister to all the remaining orchids. Overall support within the family (66 clades >5%; only 47 of these :?:75%) is considerably less than found with atpb alone. Combined Two-Gene Analysis Using P <.1 as a significance threshold for the partition homogeneity test (Cunningham 1997), the rbcl and atpb data sets cannot be considered incongruent (P =.2). Moreover, there are no strongly supported clades in conflict between the rbcl and atpb trees. For these reasons, the two matrices were combined to create a matrix of 2834 total characters. Once again, the MAXTREE limit of 1, trees was reached, at which point the analysis was aborted. The CI and RI values (.374 and.75, respectively) are comparable and intermediate to those obtained by the individual gene analyses, but overall resolution and the number of clades supported by the jackknife (especially :?:75%) increased considerably when the data were combined. The two-gene tree is based on 1273 variable characters, of which 832 are phylogenetically informative. Table 2 shows a comparison of all data matrix and tree statistics. The atpb + rbcl strict consensus tree with jackknife values is presented as Fig. 4-5 and shows strong support for each of the five subfamilies. Epidendroideae are sister to Orchidoideae, Cypripedioideae are sister to this pair, followed by Vanilloideae, and with Apostasioideae sister to the entire Orchidaceae. These intersubfamilial relationships are supported by the jackknife analysis, but the placements of Cypripedioideae and Vanilloideae are only weakly so (67-68% jck). DISCUSSION Chase, Freudenstein, and Cameron (23) recently proposed a new classification system for Orchidaceae based on a variety of molecular phylogenetic studies focused at the subtribe, tribe, and family level (including the data presented here). No fewer than five subfamilies and 17 tribes were recognized (2 in Vanilloideae, 4 in Orchidoideae, and 11 in Epidendroideae). Four tribes of the latter (Cymbidieae, Epidendreae, Podochileae, and Vandeae) were subdivided further into 26 subtribes. Within Orchidoideae, there were at least 15 subtribes recognized. For the purpose of this discussion, their new classification system will be followed with only slight modifications where noted. In many ways, the combined atpb + rbcl tree presented here is not greatly different from the rbcl tree published by Cameron et al. (1999). The two studies are difficult to compare, however, in that successive weighting was used to reduce the total number of equally parsimonious trees and increase resolution in the rbcl consensus tree. Nevertheless, it is obvious that the addition of these new atpb data to the rbcl matrix gives a much clearer picture of orchid phylogeny. The atpb sequence is 174 bp longer than rbcl and consequently provides 86 more phylogenetically informative characters. The atpb data also contains less homoplasy than the rbcl (CI of.324 vs..285 when uninformative characters are excluded), and the tree receives greater jackknife support (8 vs. 66 clades >5%). The possibility exists that part of the inequity between these two matrices is due to the fact that these rbcl sequences were completed nearly 1 years ago by less precise manual methods that were more prone to human error than the automated methods of today. atpb Sequence Anomalies Length differences were encountered for atpb sequences in select orchids. The particular insertions/deletions (indels) were few and not coded separately since most appear to be isolated events of no phylogenetic significance. Species of Vanilla are an exception as they all share a six bp insertion at the 3 '-end of the gene. The most dramatic cases of sequence anomaly are seen in Earina Lindl., which has a divergent atpb sequence ca. 12 bp shorter than in other taxa. Near the 5' -end there is a gap of 16 bp, but this is followed downstream by a seven bp insertion, then a nine bp deletion. The gaps resulting from these indels (treated as missing data) may explain the instability of Earina in the resulting trees. Fig. 3.-ne of> 1, equally parsimonious atpb trees chosen at random and presented as a phylogram to highlight relative branch lengths (DELTRAN optimization) among subfamilies and genera of Orchidaceae. Note that whereas Cypripedioideae and especially most of Epidendroideae have relatively low levels of sequence divergence, all members of Vanilloideae have accelerated rates of substitution compared to other orchids.

16 46 Cameron ALISO 95 EPIDENDROIDEAE continued as Fig > Spiranthinae > Prescottiinae Cranichidinae I Goodyerinae Chloraeinae Pterostylid i nae Chloraeinae Thelymitrinae > Cryptostylidinae > Diuridinae I Caladeniinae > Acianthinae Prasophyllinae.. " :;: u ;: I!! LJ.J <l: LJ.J I u a::: Orchidinae Disinae Brownleeinae Codonorchideae 1 I CYPRIPEDIOIDEAE a: ;: ) a. LJ.J -' ::::! z :g; > APOSTASIOIDEAE outgroup families Fig. 4.-Strict consensus tree obtained when atpb and rbcl sequence data for Orchidaceae are analyzed together. Genera from outgroup families and orchid subfamilies Apostasioideae, Vanilloideae, Cypripedioideae, and Orchidoideae are shown; the tree continues in Fig. 5. Subfamilies, tribes, and subtribes sensu Chase, Freudenstein, and Cameron (23) are indicated in boldface where applicable, and jackknife values >5% are given for supported clades.

17 VOLUME 22 atpb Orchidaceae Phylogeny 461 The sequence of Spathoglottis Blume is also an extreme in that it is ca. 12 bp longer than other taxa; it contains one insertion of five bp and another of seven bp. In contrast, full length atpb sequences were amplified from the mycoheterotrophic and mostly achlorophyllous vanilloid genera Cyrtosia Blume, Erythrorchis Blume, and Pseudovanilla Garay. A sequence from the genus Galeola Lour. was not included in this analysis because of missing data for rbcl, but even that taxon yielded an intact atpb sequence that placed it sister to Cyrtosia, as expected based on morphology. Such has not been the case for rbcl or psab in which pseudogenes have been documented for Cyrtosia (Cameron 24), and for which Galeola has resisted amplification. Whether or not ATP synthase is functional in these nonphotosynthetic orchids is uncertain. Overall, atpb sequence divergence is predictably low among genera of Epidendroideae, but extremely high among genera of Vanilloideae, as documented for nuclear (Cameron and Chase 2), mitochondrial (Freudenstein and Chase 21), and other plastid genes (Cameron et al. 1999; Cameron 24) as well. Subfamily Relationships One significant difference between the rbcl tree and the atpb tree is the position of Cypripedioideae relative to the other subfamilies. In the case of rbcl, this monophyletic subfamily of diandrous orchids is sister to all other orchids except Apostasioideae. Both the atpb tree and the combined tree (Fig. 2) place Cypripedioideae as sister to the Epidendroideae + Orchidoideae clade. Cameron and Chase (2) also recovered this arrangement with l8s data. Most orchid systematists have considered Cypripedioideae to be only slightly less "primitive" than Apostasioideae on account of their terrestrial habit, two fertile anthers, abscission layer between perianth and ovary, pollen monads, and crustose seeds enclosed within fleshy trilocular fruits in Selenipedium Rchb. f., a supposedly relictual genus. However, Atwood (1984) argued against this view of their "primitiveness" and Dressler (1986) at one time felt very strongly that Cypripedioideae was the sister group to what was then treated as subfamily Neottioideae (i.e., Epipactis Zinn, Listera Adans., and their relatives, which are now considered "lower" Epidendroideae). He cited evidence in the form of shared seed structure, cytology, and habit between these groups. It is worth pointing out (Fig. 1) that Cypripedium L., not Selenipedium, is sister to all other taxa of Cypripedioideae (94% jck) according to the atpb and combined data (its position is unresolved with rbcl alone). Some of the presumably plesiomorphic characters of Selenipedium may in fact be secondary gains. Moreover, members of Vanilloideae exhibit just as many, or even more, plesiomorphic characters as Cypripedioideae, and their single anther is developmentally not homologous with that observed in Epidendroideae/Orchidoideae (Freudenstein et al. 22). Hence, the reversed positions of Cypripedioideae and Vanilloideae may not be so surprising as they seem at first glance. Relationships of Problematic Taxa Within each subfamily there are one or more genera whose position in the orchid phylogeny continues to be unstable. For example, the relationships among the four major lineages of Vanilleae are fully resolved and supported by atpb, but not in the two-gene tree. Moreover, the relationships of Cleistes divaricata and Isotria Raf. to the other genera of Pogonieae in the atpb tree are unlike any other topology seen before (e.g., Cameron and Chase 1999). Sequence divergence among all these vanilloid orchids is very high, and the possibility is real that long-branch attraction may be a factor in this clade. The positions of Chloraea, Codonorchis Lindl., Megastylis glandulosa, and Pterostylis R. Br. of Orchidoideae are ambiguous in these trees as well. These genera exhibit a number of plesiomorphic characters, and are possible descendents of an ancient ancestor(s) distributed across Gondwana. Today they are isolated relicts of disjunct lineages distributed in Chile, New Caledonia, and Australia. The other species of Megastylis Schltr. are firmly embedded within Diurideae, making the genus polyphyletic, but M. glandulosa shows an unexpected affinity with Pachyplectron Schltr. (both endemic to New Caledonia) according to the atpb data (Fig. 4). With rbcl (Cameron et al. 1999) and psab (Cameron 24) Megastylis glandulosa is sister to Chloraea, whereas Pachyplectron is allied to Goodyerinae-a more logical arrangement based on column morphology, pollen structure, and other floral features. The atpb tree places Chloraea sister to all other genera of Orchideae, whereas the combined tree relocates the genus to the base of Cranichideae (Fig. 4). Neither position is supported by the jackknife. Likewise, Codonorchis is either sister to all Orchideae or unresolved among the tribal branches of Orchidoideae. Recognition of Codonorchideae, in either case, is probably justified since this monotypic genus with whorled leaves is morphologically unique in the family. Greater character and taxon sampling may help to settle these mobile taxa in future analyses. It is difficult to make firm conclusions regarding relationships among the major lineages of Epidendroideae since resolution and jackknife support is poor in this group. Nevertheless, a few sister relationships in the subfamily are worth pointing out (Fig. 2). An alliance between Malaxideae and Dendrobieae (both with naked pollinia) continues to hold in these trees, just as it did with rbcl (Cameron et al. 1999). Podochileae may also be closely related to them. Polystachya seems firmly positioned now as sister to Vandeae (72% jck). Cameron et al. (1999) expressed concern for the placement of Polystachya near Laeliinae in their rbcl tree, and felt that it might represent a spurious result of incomplete taxon sampling. The rbcl sequence of Polystachya contains some 3 bp of missing data, and is one of the most divergent in Epidendroideae. It is probably of dubious quality and should be resequenced. Chase, Freudenstein, and Cameron (23) proposed Collabiinae as a subtribe to encompass several genera typically classified as part of Arethuseae (Fig. 5). The two-gene tree shows that this subtribe is monophyletic and clearly unrelated to the core Arethuseae. It may or may not be part of Epidendreae, but the monophyly of that tribe is not resolved here. More sampling is needed in the form of genera such as /sochilus R. Br. or Ponera Lindl., which may help to bring these groups together, since van den Berg et al. (2) identified them as basal members of the Laeliinae clade. Likewise, it may be wise to sequence Cremastra Lindl. and/or other members of Calypsoeae for

18 462 Cameron ALISO 95 Acineta Kegeliella 93 Coryanthes Stanhopea Houlletia Stanhopeinae I Bifrenaria 63 Cryptocentrum Lycaste Xylobium Maxillariinae Maxillaria Neomoorea Lycomormium Coeliopsidinae Dichaea.. Huntleya '5 Cryptarrhena Zygopetalinae : Zygopetalum E Eriopsis >- Eriopsidinae () Oncidium Stellilabium > Oncidiinae Catasetum Dressleria Catasetinae Galeandra Cyrtopodium Cyrtopodiinae Ansellia Eulophia > Eulophiinae Cymbidium Grammatophyllum > Cymbidiinae Cadetia Dendrobium Epigeneium Dendrobieae Bu/bophyl/um Uparis > Malaxideae Malaxis.. Eria > Eriinae.s! :E Trichotosia u Podochilus Podochilinae 'C Phreatia Thelasiinae Q. Aerangis Diaphananthe > Aerangidinae Aeranthes > Angraecum.. Angraecinae Cleisostoma 'C 72 Aeridinae <: Neofinetia Phalaenopsis Polystachya Polystachyinae Calypso npularia Ap/ectrum Calypsoeae Govenia Earina Agrostophyllinae Cattleya Epidendrum Meiracyllium Laeliinae 95 Encyclia Arpophyl/um Masdeva/Jia Pleurothallis Restrepia Dilomilis Pleurothallidinae.. Ca/anthe 'C Phaius <:.. Acanthephippium 'C Collabiinae Nephelaphyl/um a Spathoglottis Coelia Bletia Chysis > > Coeliinae Bletiinae Arethusa Arethusinae.. 67 "' ::I.s::. Coelogyne Coelogyninae 1! Dendrochilum < Glomera Thunia Epipactis 99 Listera Cephalanthera Neottieae Palmorchis 62 Corymborkis 98 Tropidia > Tropidieae 1 E/leanthus Sobra/ia > Sobralieae 1 Monophyllorchis Triphora > Triphoreae 64 Nervilia > Nervilieae Xerorchis 99 Orchidoideae 1 Cypripedioideae 99 Vanilloideae 1 Apostasioideae Outgroup families w

19 VOLUME 22 atpb Orchidaceae Phylogeny 463 future studies, because that tribe continues to be polyphyletic. Conclusions and Future Directions The addition of these new atpb characters to the rbcl matrix of Cameron eta!. (1999) gives a much clearer picture of phylogenetic relationships within Orchidaceae since the overall two-gene tree's resolution and jackknife support levels are increased substantially over either individual gene tree. Perhaps the greatest value of these new data is in documenting that although they are relatively conserved, collecting additional plastid gene sequences for Orchidaceae is worth the effort. They are easy to sequence and avoid many of the pitfalls encountered with sequencing nuclear, mitochondrial, or more variable plastid regions (especially issues of alignment). Certainly, other plant systematists have found the combination of several plastid genes to be a profitable strategy for improving hypotheses of phylogeny (Graham and Olmstead 2; Reeves eta!. 21; Sytsma eta!. 22), and so the next step in this program of research will be to combine the rbcl and atpb data with a third plastid gene (psab) for the same set of taxa. Ultimately, the fundamental issues of orchid origins, speciation, and coevolution with animals, fungi, and other plants can be addressed more objectively when a robust phylogeny for the family is in hand. ACKNOWLEDGMENTS Special thanks are extended to Ken Wurdack and Susan Pel! for their assistance with DNA extraction and gene sequencing. Mark Chase, Harold Koopowitz, Barry Glick, Mark Whitten, Tomohisa Yukawa, Eric Christenson, and others who generously shared plant material and DNA samples. The Lewis B. and Dorothy Cullman Foundation as well as the USA National Science Foundation (grant DEB- 181) are acknowledged for their financial support. LITERATURE CITED ATWOOD, J. T The relationships of the slipper orchids (subfamily Cypripedioideae). Selbyana 7: The size of the Orchidaceae and the systematic distribution of epiphytic orchids. Selbyana 9: CAMERON, K. M. 24. Utility of psab plastid gene sequences for investigating intrafamilial relationships within Orchidaceae. Malec. Phylogen. Evol. 31: ,AND M. W. CHASE Phylogenetic relationships of Pogoniinae (Vanilloideae, Orchidaceae): an herbaceous example of the eastern North America-eastern Asia phytogeographic disjunction. J. Pl. Res. 112: , AND Nuclear 18S rona sequences of Orchidaceae confirm the subfamilial status and circumscription of Vanilloideae, pp In K. L. Wilson and D. A. Morrison [eds.], Monocots: systematics and evolution, CSIRO, Collingwood, Victoria, Australia. ---, ---, M. WHITTEN, P. KORES,. JARRELL, V. ALBERT, T. YUKAWA, H. HILLS, AND D. GOLDMAN A phylogenetic analysis of the Orchidaceae: evidence from rbcl nucleotide sequences. Amer. J. Bot. 86: CHASE, M., K. CAMERON, H. HILLS, AND. JARRELL DNA sequences and phylogenetics of the Orchidaceae and other lilioid monocots, pp In A. Pridgeon [ed.], Proceedings of the fourteenth world orchid conference. Her Majesty's Stationary Office, Glasgow, UK. ---, M. DUVALL, H. HILLS, J. CONRAN, A. Cox, L. EGUIARTE, J. HARTWELL, M. F. FAY, L. CADDICK, K. CAMERON, AND S. HooT Molecular phylogenetics of Lilianae, pp In P. Rudall, P. Cribb, D. Cutler, and C. Humphries [eds.], Monocotyledons: systematics and evolution. Royal Botanic Gardens, Kew, Richmond, Surrey, UK. ---, J. FREUDENSTEIN, AND K. CAMERON. 23. DNA data and Orchidaceae systematics: a new phylogenetic classification, pp In K. W. Dixon, S. P. Kell, R. L. Barrett, and P. J. Cribb [eds.], Orchid conservation. Natural History Publications, Kota Kinabalu, Sabah, Malaysia. ---,D. E. SOLTIS, P. S. SoLTIS, P. J. RUDALL, M. F. FAY, W. H. HAHN, S. SULLIVAN, J. JOSEPH, T. J. GIVNISH, K. J. SYTSMA, AND J. C. PIRES. 2. Higher-level systematics of the monocotyledons: an assessment of current knowledge and a new classification, pp InK. L. Wilson and D. A. Morrison [eds.], Monocots: systematics and evolution, CSIRO, Collingwood, Victoria, Australia. CLEGG, M., AND G. ZURAWSKI Chloroplast DNA and the study of plant phylogeny: present status and future prospects, pp In P. S. Soltis, D. E. Soltis, and J. J. Doyle [eds.], Molecular systematics of plants. Chapman & Hall, New York, USA. CUNNINGHAM, C Can three incongruence tests predict when data should be combined Molec. Biol. Evol. 14: DRESSLER, R. L Recent advances in orchid phylogeny. Lindleyana 1: Phylogeny and classification of the orchid family. Dioscorides Press, Portland, Oregon, USA. FREUDENSTEIN, J., AND M. W. CHASE. 21. Analysis of mitochondrial nadl b-e intron sequences in Orchidaceae: utility and coding of length-change characters. Syst. Bot. 26: , E. HARRIS, AND F. RASMUSSEN. 22. The evolution of anther morphology in orchids: incumbent anthers, superposed pollinia, and the vandoid complex. Amer. J. Bot. 89: , D. SENYO, AND M. W. CHASE. 2. Mitochondrial DNA and relationships in the Orchidaceae, pp InK. L. Wilson and D. A. Morrison [eds.], Monocots: systematics and evolution, CSIRO, Collingwood, Victoria, Australia. ---,C. VAN DEN BERG, D. H. GoLDMAN, P. J. KoRES, M. MoL VRAY, AND M. W. CHASE. 24. An expanded plastid DNA phylogeny of Orchidaceae and analysis of jackknife branch support strategy. Amer. J. Bot. 91: GRAHAM, S. W., AND R. G. OLMSTEAD. 2. Utility of 17 chloroplast genes for inferring the phylogeny of the basal angiosperms. Amer. J. Bot. 87: HooT, S. B., A. CULHAM, AND P.R. CRANE The utility of atpb gene sequences in resolving phylogenetic relationships: comparisons with rbcl and 18S ribosomal DNA sequences in the Lardizabalaceae. Ann. Missouri Bot. Gard. 82: KORES, P. J., K. M. CAMERON, M. MOLVRAY, AND M. W. CHASE The phylogenetic relationships of Orchidoideae and Spiranthoideae (Orchidaceae) as inferred from rbcl plastid sequences. Lindleyana 12: Fig. 5.-Strict consensus tree obtained when atpb and rbcl sequence data for Orchidaceae are analyzed together. Genera from Epidendroideae are shown as a continuation from the previous figure. Tribes and subtribes sensu Chase, Freudenstein, and Cameron (23) are indicated in boldface where applicable, and jackknife values >5% are given for supported clades.