What examples can you think of?
|
|
- Dominic Snow
- 5 years ago
- Views:
Transcription
1
2 What examples can you think of? Geocentrism Alchemy Heliocentrism: Copernicus, Kepler, Newton, Galileo Nature of the chemical bond (Rutherford, Pauling ) Aristotelian view of the biosphere Woese/Pace (subject of today!) Can you think of others? This is a dynamic process! - Some of these ideas were known and lost, then found again. - We are not done. We can only work with what we understand at the time.
3 Woese and Fox, 1977 All cellular life falls into one of 3 large groups: -Eukaryotes, Eubacteria, Archeabacteria Used 16S rrna sequencing to classify life. This choice of a molecular chronometer was very thoughtful. Why? All life is phylogenetically related on the molecular level! Evolutionary and microbiology connected, microbes are central to studying biosphere
4 Pace, PNAS 2012
5 Technology has changed the way we ask questions in science 16S rrna sequencing in 1977 vs. now are very different. Ribosome: 50% RNA, 50% protein. Small subunit 16S rrna is in all organisms because it s involved in essential function inside cell. It is a marker for relating organisms through evolutionary history, and has changed how evolutionary trees were viewed.
6 What is S? Answer = a unit for sedimentaaon rate
7 Discuss: 1. Why is 16S a good molecule to use for relating organisms? What other molecules can be used for this purpose? 2. Claim: fundamental concepts in biology are rapidly evolving, unlike in physics and chemistry. Do you agree? 3. How to root the tree of life? Universal common ancestor? What do you think of the progenote?
8 Introducing David and Alm paper Summary: The authors analyze distribution of gene families in modern species Gene family: a set of genes which arose from duplication of one gene. Usually code for similar functions. To do this, the authors developed a mathematical/computational model that uses modern genomes to mimic evolution of ancient organisms.
9 Introducing David and Alm paper Conclusions: Ancient environmental change billion years ago caused huge expansion in diversity of genes: 27% of genes today are a result of the evolution that happened during the Archaean expansion. Those genes allowed microbes to make energy from photosynthesis through electron transport. They released a lot of oxygen into the atmosphere, an event for which there is evidence today. Horizontal gene transfer played a big role let s talk about that.
10 Video hhp://glencoe.mcgraw- hill.com/sites/ /student_view0/chapter24/ horizontal_gene_transfer.html
11 Conceptual tree of life with and without extinct lineages Through HORIZONTAL GENE TRANSFER (HGT), molecules from now- exanct lineages might have survived in today's organism. Does this mean anything for 16S RNA sequencing- based tree- making? Zhaxybayeva and Gogarten (2004) Trends in GeneAcs 20 (4)
12 Earth forms ~4.6 bya Oldest evidence for life PhotosyntheAc microbial mats Evidence for oxygen in atmosphere First Eukaryotes Cambrian radiaaon [Time (bya)] PHANEROZOIC Paleozoic Mesozoic Cenozoic 0.6 Ediacaran oldest definite mulacellular life Let s put geological history into perspecave More detailed Ameline: hhp://exploringorigins.org/ameline.html
13 Sketch a geological timeline on a clock 4.6 bya + Today Include the Following: 1. FormaAon of Earth 2. Oldest Evidence for Life 3. PhotosyntheAc Microbial Mats 4. Oxygen in the Atmosphere 5. First Eukaryotes 6. Cambrian RadiaAon Approximate Time: bya bya bya bya bya bya
14 Final questions The difference between two strains of microorganisms is superficially much more subtle than the obvious difference between a person and a flower, but the evolutionary distance between two microbes is often much larger than the distance between humans and plants. What do you think about this? Many questions remain about the best way in which living things can be classified according to their relationships with one another. For example, should the molecular diversity exhibited by microbes be compared on an equal plane with the much more apparent morphological differences found in eukaryotes? What type of classification system do you think makes sense?
15 Pace, PNAS 2012
16 Video and Website Summary of Woese and Pace contributions on the creation of the phylogenetic tree of life option=com_content&view=category&layout=blog&i d=54&itemid=195 Puzzle.html Tree of life with extinct lineages some sequences survive through HGT
Chapter 19. History of Life on Earth
Chapter 19 History of Life on Earth Adapted from Holt Biology 2008 Chapter 19 Section 3: Evolution of Life Key Vocabulary Terms Adapted from Holt Biology 2008 Cyanobacteria Photosynthetic prokaryotes Adapted
More informationA. Incorrect! In the binomial naming convention the Kingdom is not part of the name.
Microbiology Problem Drill 08: Classification of Microorganisms No. 1 of 10 1. In the binomial system of naming which term is always written in lowercase? (A) Kingdom (B) Domain (C) Genus (D) Specific
More informationChapter 19. Microbial Taxonomy
Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)
More informationOrigin and Evolution of Life
Origin and Evolution of Life OCN 201 Science of the Sea Biology Lecture 2 The Handfish -BBC Blue Planet!1!1 Evolution Nothing in biology makes sense except in the light of evolution I am a creationist
More information4) Outline the major developments that allowed life to exist on Earth.
Objectives 4) Outline the major developments that allowed life to exist on Earth. 5) Describe the types of organisms that arose during the four major divisions of the geologic time scale. Each layer of
More informationMicrobial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More information2 Eras of the Geologic Time Scale
CHAPTER 8 2 Eras of the Geologic Time Scale SECTION The History of Life on Earth BEFORE YOU READ After you read this section, you should be able to answer these questions: What kinds of organisms evolved
More informationEarth s history can be broken up into 4 time periods: Precambrian Paleozoic Era Mesozoic Era Cenozoic Era
Earth s History Video Clip Earth s History Earth s history can be broken up into 4 time periods: Precambrian Paleozoic Era Mesozoic Era Cenozoic Era Scientists have put together a timeline of Earth s history
More informationCHAPTER 19 THE HISTORY OF LIFE. Dr. Bertolotti
CHAPTER 19 THE HISTORY OF LIFE Dr. Bertolotti Essential Question: HOW DO FOSSILS HELP BIOLOGISTS UNDERSTAND THE HISTORY OF LIFE ON EARTH? WHAT DO FOSSILS REVEAL ABOUT ANCIENT LIFE? FOSSILS AND ANCIENT
More informationChapter Study Guide Section 17-1 The Fossil Record (pages )
Name Class Date Chapter Study Guide Section 17-1 The Fossil Record (pages 417-422) Key Concepts What is the fossil record? What information do relative dating and radioactive dating provide about fossils?
More informationThe History of Life. Fossils and Ancient Life (page 417) How Fossils Form (page 418) Interpreting Fossil Evidence (pages ) Chapter 17
Chapter 17 The History of Life Section 17 1 The Fossil Record (pages 417 422) This section explains how fossils form and how they can be interpreted. It also describes the geologic time scale that is used
More informationName Class Date. Crossword Puzzle Use the clues below to complete the puzzle.
Chapter 17 The History of Life Chapter Vocabulary Review Crossword Puzzle Use the clues below to complete the puzzle. 1 2 3 4 5 6 7 8 9 10 11 Across 2. time span shorter than an era, such as Quaternary
More informationSection 17 1 The Fossil Record (pages )
Chapter 17 The History of Life Section 17 1 The Fossil Record (pages 417 422) Key Concepts What is the fossil record? What information do relative dating and radioactive dating provide about fossils? What
More informationMicrobial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B
Microbial Diversity and Assessment (II) Spring, 007 Guangyi Wang, Ph.D. POST03B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm General introduction and overview Taxonomy [Greek
More informationOrigins of Life. Fundamental Properties of Life. Conditions on Early Earth. Evolution of Cells. The Tree of Life
The Tree of Life Chapter 26 Origins of Life The Earth formed as a hot mass of molten rock about 4.5 billion years ago (BYA) -As it cooled, chemically-rich oceans were formed from water condensation Life
More informationMiGA: The Microbial Genome Atlas
December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From
More informationRevision Based on Chapter 19 Grade 11
Revision Based on Chapter 19 Grade 11 Biology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Most fossils are found in rusty water. volcanic rock. sedimentary
More informationEvolution Problem Drill 09: The Tree of Life
Evolution Problem Drill 09: The Tree of Life Question No. 1 of 10 Question 1. The age of the Earth is estimated to be about 4.0 to 4.5 billion years old. All of the following methods may be used to estimate
More informationEVOLUTION OF COMPLEX LIFE FORMS
0.002 0.6 1.0 1.9 2.8 Ancestral humans Diversification of mammals Invasion of the land Diversification of animals Origin of the major eukaryotic groups Eukaryotic cells abundant Atmospheric oxygen plentiful
More informationOutline. Origin and History of Life
Origin and History of Life Chapter 19 Primitive Earth Origin of First Cells Fossils The Precambrian The Paleozoic The Mesozoic The Cenozoic Continental Drift Mass Extinctions Outline 1 2 The Primitive
More informationName Class Date. 2. What first appeared on Earth during Precambrian time? a. dinosaurs b. mammals c. life d. humans
Skills Worksheet Directed Reading B Section: Eras of the Geologic Time Scale 1. What are the four biggest eras in geologic history? a. Precambrian, Paleozoic, Mesozoic, and Cenozoic b. Precambrian, Prehistoric,
More informationChapters 25 and 26. Searching for Homology. Phylogeny
Chapters 25 and 26 The Origin of Life as we know it. Phylogeny traces evolutionary history of taxa Systematics- analyzes relationships (modern and past) of organisms Figure 25.1 A gallery of fossils The
More informationRapid Learning Center Chemistry :: Biology :: Physics :: Math
Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/37 *AP is a registered trademark of the College Board, which does not
More informationTracing Evolutionary History (Outline)
Tracing Evolutionary History (Outline) Four stages leading to emergence of living cells Geophysical conditions impact on biodiversity: - continental drift and volcanism, earthquakes and meteorites Living
More informationStandards A complete list of the standards covered by this lesson is included in the Appendix at the end of the lesson.
Lesson 8: The History of Life on Earth Time: approximately 45-60 minutes, depending on length of discussion. Can be broken into 2 shorter lessons Materials: Double timeline (see below) Meter stick (to
More information17-1 The Fossil Record Slide 1 of 40
1 of 40 Fossils and Ancient Life Fossils and Ancient Life Paleontologists are scientists who collect and study fossils. All information about past life is called the fossil record. The fossil record includes
More informationEvolution and diversity of organisms
Evolution and diversity of organisms Competency Levels - 7 3.1.1 Uses the theories of origin of life and natural selection to analyze the process of evolution of life 3.2.1 Constructs hierarchy of taxa
More informationBiology. Slide 1 of 40. End Show. Copyright Pearson Prentice Hall
Biology 1 of 40 2 of 40 Fossils and Ancient Life What is the fossil record? 3 of 40 Fossils and Ancient Life The fossil record provides evidence about the history of life on Earth. It also shows how different
More information5 LIFE HOW DO WE DEFINE LIFE AND WHAT DO WE KNOW ABOUT IT?
5 LIFE HOW DO WE DEFINE LIFE AND WHAT DO WE KNOW ABOUT IT? UNIT 5 OVERVIEW Key Disciplines: Biology Timespan: The first life forms appeared about 3.8 billion years ago Key Question: How do we define life
More informationOrigin of Life. What is Life? The evolutionary tree of life can be documented with evidence. The Origin of Life on Earth is another
sparked by just the right combination of physical events & chemical processes Origin of Life 500 Paleozoic 1500 2000 2500 3000 3500 ARCHEAN Millions of years ago 1000 PROTEROZOIC Cenozoic Mesozoic 4000
More informationMicrobial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
More informationEarth s Formation: 4.6 Billion Years ago
Earth s Formation: 4.6 Billion Years ago Formed from interstellar gas & dust into molten planet Earth s early atmosphere was hostile, made of carbon monoxide, methane, ammonia, nitrogen, nitrogen, sulfur,
More informationGeologic Time on a Strip of Paper
Geologic Time on a Strip of Paper Introduction The Earth is 4,600,000,000 years old. That s 4.6 billion years! But what does this mean? This activity is designed to help you get a feel for the age of the
More informationSummary The Fossil Record Earth s Early History. Name Class Date
Name Class Date Chapter 17 Summary The History of Life 17 1 The Fossil Record Fossils are preserved traces and remains of ancient life. Scientists who study fossils are called paleontologists. They use
More informationMicrobes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationBio 1B Lecture Outline (please print and bring along) Fall, 2007
Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution
More informationUnit 5: Taxonomy. KEY CONCEPT Organisms can be classified based on physical similarities.
KEY CONCEPT Organisms can be classified based on physical similarities. Linnaeus developed the scientific naming system still used today. Taxonomy is the science of naming and classifying organisms. White
More information9.1- Earth Forms and Life Begins
9.1- Earth Forms and Life Begins About Earth: Earth was formed about 4.6 billion years ago! The first life on earth appeared about 4 billion years ago Life started out as small, single-celled organisms
More informationChapter 14 The History of Life
Section 1: Fossil Evidence of Change Section 2: The Origin of Life Click on a lesson name to select. 14.1 Fossil Evidence of Change Land Environments Earth formed about 4.6 billion years ago. Gravity pulled
More informationMETHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.
Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern
More informationBiodiversity. The Road to the Six Kingdoms of Life
Biodiversity The Road to the Six Kingdoms of Life How the 6 kingdoms came about At first, only two kingdoms were recognized Then Haeckel proposed a third kingdom Protista (where protists had both plant
More informationA. Incorrect! Form is a characteristic used in the morphological species concept.
CLEP Biology - Problem Drill 23: Evolutionary Processes No. 1 of 10 The biological-species concept is based on. (A) Form. (B) Similar size. (C) Similar appearance to all other individuals in the population.
More informationSPECIATION. SPECIATION The process by which once species splits into two or more species
SPECIATION SPECIATION The process by which once species splits into two or more species Accounts for the diversity of life on earth If no speciation, there would only be species that was continuously evolving
More information12.1. KEY CONCEPT Fossils are a record of life that existed in the past. 68 Reinforcement Unit 4 Resource Book
12.1 THE FOSSIL RECORD KEY CONCEPT Fossils are a record of life that existed in the past. Fossils can form in several different ways: Permineralization occurs when water surrounds a hard structure such
More information9.3 Classification. Lesson Objectives. Vocabulary. Introduction. Linnaean Classification
9.3 Classification Lesson Objectives Outline the Linnaean classification, and define binomial nomenclature. Describe phylogenetic classification, and explain how it differs from Linnaean classification.
More information6 HOW DID OUR ANCESTORS EVOLVE?
6 HOW DID OUR ANCESTORS EVOLVE? David Christian introduces the science of taxonomy and explains some of the important methods used to identify and classify different species and several key human ancestors.
More informationUNIT 4: EVOLUTION Chapter 12: The History of Life. I. The Fossil Record (12.1) A. Fossils can form in several ways
UNIT IV Chapter 12 The History Of Life UNIT 4: EVOLUTION Chapter 12: The History of Life I. The Fossil Record (12.1) A. Fossils can form in several ways 1. Permineralization- minerals carried by water
More informationUNIT 4: History Of Biological Diversity
UNIT 4: History Of Biological Diversity CHAPTER 14: The History of Life PAST NOW FUTURE? What is this? Earth s Early history Approximately 4.6 billion years ago, the Earth was formed when many pieces of
More informationHow do we learn about ancient life? Fossil- a trace or imprint of a living thing that is preserved by geological processes.
Unit 1B Lesson 4 History of Life on Earth How do we learn about ancient life? Paleontologists scientists that studies fossils Fossil- a trace or imprint of a living thing that is preserved by geological
More informationSection 18-1 Finding Order in Diversity
Name Class Date Section 18-1 Finding Order in Diversity (pages 447-450) Key Concepts How are living things organized for study? What is binomial nomenclature? What is Linnaeus s system of classification?
More informationI. History of Life on Earth
Evolution I. History of Life on Earth I. History of Life A. Early History of Earth I. Early earth was inhospitable hot, with many volcanoes little free oxygen and lots of carbon dioxide other gases present:
More informationBiology 160 Cell Lab. Name Lab Section: 1:00pm 3:00 pm. Student Learning Outcomes:
Biology 160 Cell Lab Name Lab Section: 1:00pm 3:00 pm Student Learning Outcomes: Upon completion of today s lab you will be able to do the following: Properly use a compound light microscope Discuss the
More informationFrom soup to cells the origin of life
From soup to cells the origin of life A microbe-like cellular filament found in 3.465 billion year old rock Evolution encompasses a wide range of phenomena: from the emergence of major lineages, to mass
More information17-1 The Fossil Record Slide 2 of 40
2 of 40 Fossils and Ancient Life What is the fossil record? 3 of 40 Fossils and Ancient Life Fossils and Ancient Life Paleontologists are scientists who collect and study fossils. All information about
More informationBiodiversity. The Road to the Six Kingdoms of Life
Biodiversity The Road to the Six Kingdoms of Life How the 6 kingdoms came about At first, only two kingdoms were recognized Then Haeckel proposed a third kingdom Protista (where protists had both plant
More informationName: Period Study Guide 17-1 and 17-2
Name: Period Study Guide 17-1 and 17-2 17-1 The Fossil Record (pgs. 417-422) 1. What is the fossil record? 2. What evidence does the fossil record provide? 1. 2. 3. List the 2 techniques paleontologists
More informationOrigins of Life. Fundamental Properties of Life. The Tree of Life. Chapter 26
Origins of Life The Tree of Life Cell is the basic unit of life Today all cells come from pre-existing cells Earth formed ~4.5 billion years ago (BYA) Chapter 26 As it cooled, chemically-rich oceans were
More informationA. Incorrect! Darwin could not draw complete conclusions because of the lack of fossils.
High School Biology - Problem Drill 15: Evolutionary History Question No. 1 of 10 1. Which of the following statements is incorrect? Question #01 (A) Darwin was unable to come to a firm conclusion because
More informationBIOLOGY 432 Midterm I - 30 April PART I. Multiple choice questions (3 points each, 42 points total). Single best answer.
BIOLOGY 432 Midterm I - 30 April 2012 Name PART I. Multiple choice questions (3 points each, 42 points total). Single best answer. 1. Over time even the most highly conserved gene sequence will fix mutations.
More informationOrigins of Life and Extinction
Origins of Life and Extinction What is evolution? What is evolution? The change in the genetic makeup of a population over time Evolution accounts for the diversity of life on Earth Natural selection is
More informationBio Microbiology - Spring 2013 Study Guide 14.
Bio 230 - Microbiology - Spring 2013 Study Guide 14 http://www.swarthmore.edu/natsci/cpurrin1/evolk12/slm/origindayimages/06soup.jpg Working Backwards to the Age of the Earth Radioactive decay is consistent
More information8/23/2014. Phylogeny and the Tree of Life
Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major
More informationIV. Major events in biological development on Earth
IV. Major events in biological development on Earth Cambrian explosion We are trying to fill in some of the biological details in the timelines shown here. Meiosis UV shield Snowball Earth XX Horizontal
More informationEvolution and Diversification of Life. Origin and Evolution of. Life. OCN 201 Science of the Sea Biology Lecture 2. The Handfish -BBC Blue Planet
Origin and Evolution of Evolution and Diversification of Life Life OCN 201 Science of the Sea Biology Lecture 2 The Handfish -BBC Blue Planet Grieg Steward, Professor Department of Oceanography Plankton
More informationPHYLOGENY AND SYSTEMATICS
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study
More informationOhio Tutorials are designed specifically for the Ohio Learning Standards to prepare students for the Ohio State Tests and end-ofcourse
Tutorial Outline Ohio Tutorials are designed specifically for the Ohio Learning Standards to prepare students for the Ohio State Tests and end-ofcourse exams. Biology Tutorials offer targeted instruction,
More informationMicrobial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University
Microbial Diversity Yuzhen Ye (yye@indiana.edu) I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Contents Microbial diversity Morphological, structural,
More informationsparked by just the right combination of physical events & chemical processes Origin of Life
sparked by just the right combination of physical events & chemical processes Origin of Life 2010-2011 ARCHEAN Millions of years ago PRECAMBRIAN PROTEROZOIC 0 500 1000 Cenozoic Mesozoic Paleozoic Colonization
More informationSCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION. Using Anatomy, Embryology, Biochemistry, and Paleontology
SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION Using Anatomy, Embryology, Biochemistry, and Paleontology Scientific Fields Different fields of science have contributed evidence for the theory of
More informationChapter 26. Origin of Life
Chapter 26. Origin of Life 1 The history tree of life can be documented with evidence as already discussed. The Origin of Life on Earth is another story 2 Origin of Life hypothesis Abiotic synthesis of
More informationGeologic Time. Mr. Skirbst
Geologic Time Mr. Skirbst Geologic Time Geologic Time Scale Describing and dividing major events of Earth s history Like a timeline of your life! Birth Like a timeline of your life! Like a timeline of
More informationNotes on Life & Geologic Time Name:
Notes on Life & Geologic Time Name: S.W.B.A.T Explain how time can be divided into units Relate changes of Earth s to divisions on the geologic time scale Describe how plate tectonics affects Geologic
More informationSection 17 1 The Fossil Record (pages )
Name Class Date Chapter 17 The History of Life Section 17 1 The Fossil Record (pages 417 422) This section explains how fossils form and how they can be interpreted. It also describes the geologic time
More informationMACROEVOLUTION Student Packet SUMMARY EVOLUTION IS A CHANGE IN THE GENETIC MAKEUP OF A POPULATION OVER TIME Macroevolution refers to large-scale
MACROEVOLUTION Student Packet SUMMARY EVOLUTION IS A CHANGE IN THE GENETIC MAKEUP OF A POPULATION OVER TIME Macroevolution refers to large-scale evolutionary changes such as speciation events, origin of
More informationGenomics and Bioinformatics
Genomics and Bioinformatics Associate Professor Bharat Patel Genomes in terms of earth s history: Earth s environment & cellular evolution Genomes in terms of natural relationships: (Technology driven
More informationSCIENCE SAMPLER ~ Geology ~ Unit 4 of 5
College Guild PO Box 6448, Brunswick ME 04011 SCIENCE SAMPLER ~ Geology ~ Unit 4 of 5 1 Over the past three units we have learned about the birth of the universe, the laws of nature, and the structure
More information4/25/2009. Xi (Cici) Chen Texas Tech University. Ancient: folk taxonomy impulse to classify organisms Carl Linnaenus: binominal nomenclature (1735)
Xi (Cici) Chen Texas Tech University Ancient: folk taxonomy impulse to classify y p y organisms Carl Linnaenus: binominal nomenclature (1735) 1 Darwin, On the origin of species The affinities of all the
More information12.1 The Fossil Record. KEY CONCEPT Specific environmental conditions are necessary in order for fossils to form.
KEY CONCEPT Specific environmental conditions are necessary in order for fossils to form. Fossils can form in several ways. Premineralization occurs when minerals carried by water are deposited around
More information5 LIFE HOW ARE WE STILL EVOLVING?
5 LIFE HOW ARE WE STILL EVOLVING? UNIT 5 LIFE CONTENTS UNIT 5 BASICS 3 Unit 5 Overview 4 Unit 5 Learning Outcomes 5 Unit 5 Lessons 6 Unit 5 Key Concepts LOOKING BACK 8 What Happened in Unit 4? KEY CONTENT
More informationThe History of Life on Earth
CHAPTER 9 VOCABULARY & NOTES WORKSHEET The History of Life on Earth By studying the Vocabulary and Notes listed for each section below, you can gain a better understanding of this chapter. SECTION 1 Vocabulary
More informationWarm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab
Date: Agenda Warm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab Ask questions based on 5.1 and 5.2 Quiz on 5.1 and 5.2 How
More informationOrigins of Life & the Cambrian Explosion
Origins of Life & the Cambrian Explosion Impact Frustration period forces origins of life into a narrow time period to have gotten started! Hydrothermal vents may have served as zones of refuge. Origin
More informationOrigins of Life & the Cambrian Explosion
Origins of Life & the Cambrian Explosion Impact Frustration period forces origins of life into a narrow time period to have gotten started! Hydrothermal vents may have served as zones of refuge. 1 Origin
More informationWhat can sequences tell us?
Bioinformatics What can sequences tell us? AGACCTGAGATAACCGATAC By themselves? Not a heck of a lot...* *Indeed, one of the key results learned from the Human Genome Project is that disease is much more
More informationLecture 11 Friday, October 21, 2011
Lecture 11 Friday, October 21, 2011 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean system
More informationB. Phylogeny and Systematics:
Tracing Phylogeny A. Fossils: Some fossils form as is weathered and eroded from the land and carried by rivers to seas and where the particles settle to the bottom. Deposits pile up and the older sediments
More informationGood Day everyone! Today is Wednesday 10/4/17
Good Day everyone! Today is Wednesday 10/4/17 Agenda: 1. Warm Up 2. Video: Intro to the Geologic Time Scale 3. Notes: Geologic Time Scale a. How the Geologic Time Scale is Organized b. Principle of Uniformitarianism
More informationUNIT 4: EVOLUTION Chapter 12: The History of Life
CORNELL NOTES Directions: You must create a minimum of 5 questions in this column per page (average). Use these to study your notes and prepare for tests and quizzes. Notes will be stamped after each assigned
More informationPhys 214. Planets and Life
Phys 214. Planets and Life Dr. Cristina Buzea Department of Physics Room 259 E-mail: cristi@physics.queensu.ca (Please use PHYS214 in e-mail subject) Lecture 16. Phylogenetic tree. Metabolism. Carbon and
More informationFOSSILS Uncovering Clues to the Earth s Past
FOSSILS Uncovering Clues to the Earth s Past Fossils form when water replaces the cells of dead animals or plants with minerals. These minerals then petrify into rock to form the fossils we see in museums.
More informationHistory of Life on Earth The Geological Time- Scale
History of Life on Earth The Geological Time- Scale Agenda or Summary Layout The Geological Time-Scale 1 2 3 The Geological Time-Scale The Beginning of Life Cambrian Explosion The Geological Time-Scale
More informationChapter 25: The Origin and Evolutionary History of Life on Earth
Chapter 25: The Origin and Evolutionary History of Life on Earth Chemical conditions of the early Earth A model for the first cells First life Life changes the planet: oxygenating Earth s oceans and atmosphere
More informationGenomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationEndosymbiotic Theory
Endosymbiotic Theory Evolution of Prokaryotes The oldest known fossils are 3.5 bya = stromatolites which are rock like layers of bacteria and sediment. Earliest life forms may have emerged as early as
More informationThe Evolution of Microbial Life
1 Chapter 15 The Evolution of Microbial Life Chapter 15 Outline: The Evolution of Microbial Life Major Episodes in the History of Life The Origin of Life Prokaryotes Protists 2 PowerPoint Lectures for
More informationModern Evolutionary Classification. Section 18-2 pgs
Modern Evolutionary Classification Section 18-2 pgs 451-455 Modern Evolutionary Classification In a sense, organisms determine who belongs to their species by choosing with whom they will mate. Taxonomic
More information5 Time Marches On. TAKE A LOOK 1. Identify What kinds of organisms formed the fossils in the picture?
CHAPTER 6 5 Time Marches On SECTION The Rock and Fossil Record BEFORE YOU READ After you read this section, you should be able to answer these questions: How do geologists measure time? How has life changed
More informationLesson 1 Syllabus Reference
Lesson 1 Syllabus Reference Outcomes A student Explains how biological understanding has advanced through scientific discoveries, technological developments and the needs of society. Content The theory
More informationEukaryotic Cells. Figure 1: A mitochondrion
Eukaryotic Cells Figure 1: A mitochondrion How do cells accomplish all their functions in such a tiny, crowded package? Eukaryotic cells those that make up cattails and apple trees, mushrooms and dust
More information