, Work in progress
|
|
|
- Clare Morton
- 5 years ago
- Views:
Transcription
1 , Work in progress Samuel Blanquart, CR2 INRIA, EPI Bonsai 10 juin 2013
2 : Researches, animation and teaching Teaching : Algorithm and Application for 20 master 1 students (24h). Teaching : Phylogenetics for Ecology and Environment master 1 students (8 hours). Teaching : coaching 1 Individual Projects (PJI), 2 master 1 students (how many hours?). Researches : Article in preparation for the PopPhyl ERC project (ISEM, Montpellier), Researches : The oldest resurrected yet functional enzyme (Regensburg University), Researches : Adaptation to hyper-halophily through enzyme resurrection, still looking for...funding... Stand by : Phylogenetic model for heterotachy and heteropecily with Nick Goldman. Stand by : Prediction of new exon and alternative splicing of TRPM8 genes in vertebrate. Perspectives : BnB ANR project and the taxonomic assignation point. Perspectives : Region funds and probabilistic models for genomic arrangement.
3 Modeling arbitrary complex ecological relationships with PJI students
4 Modeling arbitrary complex ecological relationships with PJI students
5 ERC PopPhyl, on the empirical matrices of amino acid replacement A) JTT replacement matrix (Jones et al. 1992), B) Venn diagram of amino-acid properties (Taylor 1986). Exchange between biochemically similar amino-acid are more frequent.
6 ERC PopPhyl, on the empirical matrices of amino acid replacement 25 empirical replacement matrices were built for 25 metazoan taxonomic levels.
7 ERC PopPhyl, on the empirical matrices of amino acid replacement Over the elapsed year : Final results found during last spring, Updating my bibliography and start writing during last autumn, Back on my * paper, urgent need to finish!
8 a LUCA s Tim barrel resurrected? Computational and Experimental Evidence for the Evolution of a (αβ)8-barrel Protein from an Ancestral Quarter-Barrel Stabilised by Disulfide Bonds. Richter et al JMB.
9 a LUCA s Tim barrel resurrected? In Richter et al 2010, we proposed a scenario of the HisF evolutionary history based on the inferred ancestral sequences, with monomer duplications and gene fusions. The ancestral HisF inferred at the bacterial and archaeal MRCA (presumably close to the LUCA) has been synthesized. It is functional, has the same catalytic activity as modern enzymes, is stable up to 70 C, and binds with several modern coeffectors. Rejected by Science (with no comments), rejected by PNAS ( too easy ), submitted to JACS (Journal of American Chemistry Society)...
10 More results about LUCA s life Collaboration with the LBBE, estimating growth temperatures across cellular life history. Rejected by MBE, submitted to Biology Letters.
11 Adaptation to halophily in Archaea : MalDH evolution Collaboration with IBS Grenoble, LBBE Lyon, Ecole Polytechnique Paris. Reconstructing trees, species tree, gene tree and reconciliation. New data available last year. Reconstructing ancestral sequences, dependence to the tree topology, to the phylogenetic models. Problem of inferring ancestral sequences and ancestral GAP lengths. Ancestral gene synthesis and characterization, biochemistry, crystallography. The hopeless quest for funds : this year the project was scored A, A, A, by 3 referees, but sadly, we will obtain no fund this year... Beg you 5000 euro Me Lord?
12 Adaptation to halophily in Archaea : MalDH evolution Brochier-Armanet, Forterre and Gribaldo. Phylogeny and evolution of the Archaea : one hundred genomes later. Current Opinion in Microbiology 2011, 14 :
13 Adaptation to halophily in Archaea : MalDH evolution
14 Adaptation to halophily in Archaea : MalDH evolution Enough money to synthesize 4 MalDH ancestors. 3 done yet.
15 Tools for ancestral sequences analysis? PJI, master 1 students : Benoît-Charles Detuncq, Yannick Leroy, Thomas Clément : Viewers for modern and ancestral sequence alignments, and for phylogenetic trees are combined into a same interface, 2012 : Introduction of PDB 3D protein models into the interface : Thank to Thierry for times to debug the code. Objective : save structural-biologists from madness.
16 Adaptation to halophily in Archaea : MalDH evolution
17 Adaptation to halophily in Archaea : MalDH evolution
18 Adaptation to halophily in Archaea : MalDH evolution
19 Conclusion : other awaiting works and collaborations Still many papers to write right now. Still need to maintain, hotline, finish, optimize and parallelize a few models of molecular evolution. True start of the work on genomes rearrangement started with JS, Aïda and GEPV, Evolving from molecular evolution to ecology : metagenomic data and the taxonomic assignation problem.
, Work in progress
2011-2012, Work in progress Samuel Blanquart, CR2 INRIA, EPI Bonsai 12 juin 2012 Researches, animation and teaching Animation : Phylogeny-days, next week! Teaching : Algorithm and Application for 28 master
SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION. Using Anatomy, Embryology, Biochemistry, and Paleontology
SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION Using Anatomy, Embryology, Biochemistry, and Paleontology Scientific Fields Different fields of science have contributed evidence for the theory of
something about srna in archaea
something about srna in archaea or: Processed Small RNAs in Archaea and BHB Elements Sarah Berkemer Bioinformatics Vienzig Archaea? Sarah Berkemer (Bioinformatics Vienzig) BHB elements in Archaea 2 / 23
Microbiology Helmut Pospiech
Microbiology http://researchmagazine.uga.edu/summer2002/bacteria.htm 05.04.2018 Helmut Pospiech The Species Concept in Microbiology No universally accepted concept of species for prokaryotes Current definition
CHAPTERS 24-25: Evidence for Evolution and Phylogeny
CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology
Chapter 26 Phylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life Chapter focus Shifting from the process of how evolution works to the pattern evolution produces over time. Phylogeny Phylon = tribe, geny = genesis or origin
What can sequences tell us?
Bioinformatics What can sequences tell us? AGACCTGAGATAACCGATAC By themselves? Not a heck of a lot...* *Indeed, one of the key results learned from the Human Genome Project is that disease is much more
MiGA: The Microbial Genome Atlas
December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From
Research Proposal. Title: Multiple Sequence Alignment used to investigate the co-evolving positions in OxyR Protein family.
Research Proposal Title: Multiple Sequence Alignment used to investigate the co-evolving positions in OxyR Protein family. Name: Minjal Pancholi Howard University Washington, DC. June 19, 2009 Research
REQUIREMENTS FOR THE BIOCHEMISTRY MAJOR
REQUIREMENTS FOR THE BIOCHEMISTRY MAJOR Grade Requirement: All courses required for the Biochemistry major (CH, MATH, PHYS, BI courses) must be graded and passed with a grade of C- or better. Core Chemistry
Molecular Evolution & Phylogenetics Traits, phylogenies, evolutionary models and divergence time between sequences
Molecular Evolution & Phylogenetics Traits, phylogenies, evolutionary models and divergence time between sequences Basic Bioinformatics Workshop, ILRI Addis Ababa, 12 December 2017 1 Learning Objectives
Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
Warm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab
Date: Agenda Warm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab Ask questions based on 5.1 and 5.2 Quiz on 5.1 and 5.2 How
Introduction to Digital Evolution Handout Answers
Introduction to Digital Evolution Handout Answers Note to teacher: The questions in this handout and the suggested answers (in red, below) are meant to guide discussion, not be an assessment. It is recommended
Name: Class: Date: ID: A
Class: _ Date: _ Ch 17 Practice test 1. A segment of DNA that stores genetic information is called a(n) a. amino acid. b. gene. c. protein. d. intron. 2. In which of the following processes does change
Phylogenetic Trees. How do the changes in gene sequences allow us to reconstruct the evolutionary relationships between related species?
Why? Phylogenetic Trees How do the changes in gene sequences allow us to reconstruct the evolutionary relationships between related species? The saying Don t judge a book by its cover. could be applied
BIOLOGY (BIOL) Biology (BIOL) 1. BIOL 155 Introductory Microbiology Laboratory 1 credits
Biology (BIOL) 1 BIOLOGY (BIOL) BIOL 101 Perspectives in Biology Open only to majors. Intro to the disciplines in the fields of biology; current research topics. BIOL 102 Biology and Society Not open to
REQUIREMENTS FOR THE BIOCHEMISTRY MAJOR
REQUIREMENTS FOR THE BIOCHEMISTRY MAJOR Grade Requirement: All courses required for the Biochemistry major (CH, MATH, PHYS, BI courses) must be graded and passed with a grade of C- or better. Core Chemistry
O 3 O 4 O 5. q 3. q 4. Transition
Hidden Markov Models Hidden Markov models (HMM) were developed in the early part of the 1970 s and at that time mostly applied in the area of computerized speech recognition. They are first described in
Heteropolymer. Mostly in regular secondary structure
Heteropolymer - + + - Mostly in regular secondary structure 1 2 3 4 C >N trace how you go around the helix C >N C2 >N6 C1 >N5 What s the pattern? Ci>Ni+? 5 6 move around not quite 120 "#$%&'!()*(+2!3/'!4#5'!1/,#64!#6!,6!
Lecture 4: Evolutionary models and substitution matrices (PAM and BLOSUM).
1 Bioinformatics: In-depth PROBABILITY & STATISTICS Spring Semester 2011 University of Zürich and ETH Zürich Lecture 4: Evolutionary models and substitution matrices (PAM and BLOSUM). Dr. Stefanie Muff
Chapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships
Chapter 26: Phylogeny and the Tree of Life You Must Know The taxonomic categories and how they indicate relatedness. How systematics is used to develop phylogenetic trees. How to construct a phylogenetic
Dr. Amira A. AL-Hosary
Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological
Grundlagen der Bioinformatik Summer semester Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SS 10, D. Huson, April 12, 2010 1 1 Introduction Grundlagen der Bioinformatik Summer semester 2010 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a)
Microbial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
Biology. Slide 1 of 24. End Show. Copyright Pearson Prentice Hall
Biology 1 of 24 18-2 Modern Evolutionary Classification 2 of 24 18-2 Modern Evolutionary Classification Evolutionary Classification Evolutionary Classification Phylogeny is the study of evolutionary relationships
HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM
I529: Machine Learning in Bioinformatics (Spring 2017) HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington
CMPS 6630: Introduction to Computational Biology and Bioinformatics. Structure Comparison
CMPS 6630: Introduction to Computational Biology and Bioinformatics Structure Comparison Protein Structure Comparison Motivation Understand sequence and structure variability Understand Domain architecture
METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.
Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern
Computational methods for predicting protein-protein interactions
Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational
Phylogenetics. BIOL 7711 Computational Bioscience
Consortium for Comparative Genomics! University of Colorado School of Medicine Phylogenetics BIOL 7711 Computational Bioscience Biochemistry and Molecular Genetics Computational Bioscience Program Consortium
Genomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
The practice of naming and classifying organisms is called taxonomy.
Chapter 18 Key Idea: Biologists use taxonomic systems to organize their knowledge of organisms. These systems attempt to provide consistent ways to name and categorize organisms. The practice of naming
Elements of Bioinformatics 14F01 TP5 -Phylogenetic analysis
Elements of Bioinformatics 14F01 TP5 -Phylogenetic analysis 10 December 2012 - Corrections - Exercise 1 Non-vertebrate chordates generally possess 2 homologs, vertebrates 3 or more gene copies; a Drosophila
Lecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/22
Lecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 24. Phylogeny methods, part 4 (Models of DNA and
3/1/17. Content. TWINSCAN model. Example. TWINSCAN algorithm. HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM
I529: Machine Learning in Bioinformatics (Spring 2017) Content HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM Yuzhen Ye School of Informatics and Computing Indiana University,
Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?
Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species
BEFORE TAKING THIS MODULE YOU MUST ( TAKE BIO-4013Y OR TAKE BIO-
2018/9 - BIO-4001A BIODIVERSITY Autumn Semester, Level 4 module (Maximum 150 Students) Organiser: Dr Harriet Jones Timetable Slot:DD This module explores life on Earth. You will be introduced to the major
Biochemistry-BS Program Study Abroad Pathway
Biochemistry-BS Program Study Abroad Pathway (last revised September 2016) Table 1a: Undergraduate Program Schedule These undergraduate program schedules are subject to change. Please verify information
Phylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
Phylogenetic analysis of Cytochrome P450 Structures. Gowri Shankar, University of Sydney, Australia.
Phylogenetic analysis of Cytochrome P450 Structures Gowri Shankar, University of Sydney, Australia. Overview Introduction Cytochrome P450 -- Structures. Results. Conclusion. Future Work. Aims How the structure
Macroevolution Part I: Phylogenies
Macroevolution Part I: Phylogenies Taxonomy Classification originated with Carolus Linnaeus in the 18 th century. Based on structural (outward and inward) similarities Hierarchal scheme, the largest most
Introduction to Evolutionary Concepts
Introduction to Evolutionary Concepts and VMD/MultiSeq - Part I Zaida (Zan) Luthey-Schulten Dept. Chemistry, Beckman Institute, Biophysics, Institute of Genomics Biology, & Physics NIH Workshop 2009 VMD/MultiSeq
Sec$on 9. Evolu$onary Rela$onships
Sec$on 9 Evolu$onary Rela$onships Sec$on 9 Learning Goals Explain why the ribosomal 16S gene is a good marker for molecular phylogene$c comparisons. Be able to interpret a phylogene$c tree. Explain the
Phylogenetics: Distance Methods. COMP Spring 2015 Luay Nakhleh, Rice University
Phylogenetics: Distance Methods COMP 571 - Spring 2015 Luay Nakhleh, Rice University Outline Evolutionary models and distance corrections Distance-based methods Evolutionary Models and Distance Correction
Evolutionary Models. Evolutionary Models
Edit Operators In standard pairwise alignment, what are the allowed edit operators that transform one sequence into the other? Describe how each of these edit operations are represented on a sequence alignment
AP BIOLOGY SUMMER ASSIGNMENT
AP BIOLOGY SUMMER ASSIGNMENT Welcome to EDHS Advanced Placement Biology! The attached summer assignment is required for all AP Biology students for the 2011-2012 school year. The assignment consists of
Piecing It Together. 1) The envelope contains puzzle pieces for 5 vertebrate embryos in 3 different stages of
Piecing It Together 1) The envelope contains puzzle pieces for 5 vertebrate embryos in 3 different stages of development. Lay out the pieces so that you have matched up each animal name card with its 3
Outline. Evolution: Speciation and More Evidence. Key Concepts: Evolution is a FACT. 1. Key concepts 2. Speciation 3. More evidence 4.
Evolution: Speciation and More Evidence Evolution is a FACT 1. Key concepts 2. Speciation 3. More evidence 4. Conclusions Outline Key Concepts: A species consist of one or more populations of individuals
Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/26
Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 27. Phylogeny methods, part 4 (Models of DNA and
Some Problems from Enzyme Families
Some Problems from Enzyme Families Greg Butler Department of Computer Science Concordia University, Montreal www.cs.concordia.ca/~faculty/gregb gregb@cs.concordia.ca Abstract I will discuss some problems
Tree of Life iological Sequence nalysis Chapter http://tolweb.org/tree/ Phylogenetic Prediction ll organisms on Earth have a common ancestor. ll species are related. The relationship is called a phylogeny
Curriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
BINF6201/8201. Molecular phylogenetic methods
BINF60/80 Molecular phylogenetic methods 0-7-06 Phylogenetics Ø According to the evolutionary theory, all life forms on this planet are related to one another by descent. Ø Traditionally, phylogenetics
BIOINFORMATICS: An Introduction
BIOINFORMATICS: An Introduction What is Bioinformatics? The term was first coined in 1988 by Dr. Hwa Lim The original definition was : a collective term for data compilation, organisation, analysis and
For Classroom Trial Testing
For Classroom Trial Testing Video Description Secrets of the Sequence, Show 141, Episode 2 From Slime to Sublime approximately 10 minutes viewing time While we are similar to our fellow man in size, shape,
CISC 636 Computational Biology & Bioinformatics (Fall 2016)
CISC 636 Computational Biology & Bioinformatics (Fall 2016) Predicting Protein-Protein Interactions CISC636, F16, Lec22, Liao 1 Background Proteins do not function as isolated entities. Protein-Protein
Pairwise & Multiple sequence alignments
Pairwise & Multiple sequence alignments Urmila Kulkarni-Kale Bioinformatics Centre 411 007 urmila@bioinfo.ernet.in Basis for Sequence comparison Theory of evolution: gene sequences have evolved/derived
C.DARWIN ( )
C.DARWIN (1809-1882) LAMARCK Each evolutionary lineage has evolved, transforming itself, from a ancestor appeared by spontaneous generation DARWIN All organisms are historically interconnected. Their relationships
Chapter 19. Microbial Taxonomy
Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)
AP Biology Notes Outline Enduring Understanding 1.B. Big Idea 1: The process of evolution drives the diversity and unity of life.
AP Biology Notes Outline Enduring Understanding 1.B Big Idea 1: The process of evolution drives the diversity and unity of life. Enduring Understanding 1.B: Organisms are linked by lines of descent from
CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES
INTRODUCTION CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES This worksheet complements the Click and Learn developed in conjunction with the 2011 Holiday Lectures on Science, Bones, Stones, and Genes:
Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16
Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological
Creating a Dichotomous Key
Dichotomous Keys A tool used that allows users to determine the identity of unknown species Keys consist of a series of choices, where the user selects from a series of connected pairs Each pair of choices
The universal ancestor was a thermophile or a hyperthermophile
Gene 281 (2001) 11 17 www.elsevier.com/locate/gene The universal ancestor was a thermophile or a hyperthermophile Massimo Di Giulio* International Institute of Genetics and Biophysics, CNR, Via G. Marconi
Bioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
Comparative genomics: Overview & Tools + MUMmer algorithm
Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first
This is a repository copy of Microbiology: Mind the gaps in cellular evolution.
This is a repository copy of Microbiology: Mind the gaps in cellular evolution. White Rose Research Online URL for this paper: http://eprints.whiterose.ac.uk/114978/ Version: Accepted Version Article:
Lowndes County Biology II Pacing Guide Approximate
Lowndes County Biology II Pacing Guide 2009-2010 MS Frameworks Pacing Guide Worksheet Grade Level: Biology II Grading Period: 1 st 9 weeks Chapter/Unit Lesson Topic Objective Number 1 The Process of 1.
How should we organize the diversity of animal life?
How should we organize the diversity of animal life? The difference between Taxonomy Linneaus, and Cladistics Darwin What are phylogenies? How do we read them? How do we estimate them? Classification (Taxonomy)
Biodiversity. The Road to the Six Kingdoms of Life
Biodiversity The Road to the Six Kingdoms of Life How the 6 kingdoms came about At first, only two kingdoms were recognized Then Haeckel proposed a third kingdom Protista (where protists had both plant
Molecular evolution - Part 1. Pawan Dhar BII
Molecular evolution - Part 1 Pawan Dhar BII Theodosius Dobzhansky Nothing in biology makes sense except in the light of evolution Age of life on earth: 3.85 billion years Formation of planet: 4.5 billion
Structure to Function. Molecular Bioinformatics, X3, 2006
Structure to Function Molecular Bioinformatics, X3, 2006 Structural GeNOMICS Structural Genomics project aims at determination of 3D structures of all proteins: - organize known proteins into families
MACROEVOLUTION Student Packet SUMMARY EVOLUTION IS A CHANGE IN THE GENETIC MAKEUP OF A POPULATION OVER TIME Macroevolution refers to large-scale
MACROEVOLUTION Student Packet SUMMARY EVOLUTION IS A CHANGE IN THE GENETIC MAKEUP OF A POPULATION OVER TIME Macroevolution refers to large-scale evolutionary changes such as speciation events, origin of
Homework Assignment, Evolutionary Systems Biology, Spring Homework Part I: Phylogenetics:
Homework Assignment, Evolutionary Systems Biology, Spring 2009. Homework Part I: Phylogenetics: Introduction. The objective of this assignment is to understand the basics of phylogenetic relationships
Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18
Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection
Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction. Lesser Tenrec (Echinops telfairi)
Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction Lesser Tenrec (Echinops telfairi) Goals: 1. Use phylogenetic experimental design theory to select optimal taxa to
Genomics and bioinformatics summary. Finding genes -- computer searches
Genomics and bioinformatics summary 1. Gene finding: computer searches, cdnas, ESTs, 2. Microarrays 3. Use BLAST to find homologous sequences 4. Multiple sequence alignments (MSAs) 5. Trees quantify sequence
Concept Modern Taxonomy reflects evolutionary history.
Concept 15.4 Modern Taxonomy reflects evolutionary history. What is Taxonomy: identification, naming, and classification of species. Common Names: can cause confusion - May refer to several species (ex.
PHYLOGENY AND SYSTEMATICS
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study
Scientists have been measuring organisms metabolic rate per gram as a way of
1 Mechanism of Power Laws in Allometric Scaling in Biology Thursday 3/22/12: Scientists have been measuring organisms metabolic rate per gram as a way of comparing various species metabolic efficiency.
From soup to cells the origin of life
From soup to cells the origin of life A microbe-like cellular filament found in 3.465 billion year old rock Evolution encompasses a wide range of phenomena: from the emergence of major lineages, to mass
USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES
USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES HOW CAN BIOINFORMATICS BE USED AS A TOOL TO DETERMINE EVOLUTIONARY RELATIONSHPS AND TO BETTER UNDERSTAND PROTEIN HERITAGE?
The following pages outline the major elements of the course and when you can expect each to be covered. Assessment
A level biology The course we offer at Robert Smyth Academy is OCR Biology A which a two year linear course. Details of the course can be found at http://www.ocr.org.uk/qualifications/as-a-levelgce-biology-a-h020-h420-from-2015/
I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes.
I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes. A. Chemistry of Life B. Cells 1. Water How do the unique chemical
doi: / _25
Boc, A., P. Legendre and V. Makarenkov. 2013. An efficient algorithm for the detection and classification of horizontal gene transfer events and identification of mosaic genes. Pp. 253-260 in: B. Lausen,
A bioinformatics approach to the structural and functional analysis of the glycogen phosphorylase protein family
A bioinformatics approach to the structural and functional analysis of the glycogen phosphorylase protein family Jieming Shen 1,2 and Hugh B. Nicholas, Jr. 3 1 Bioengineering and Bioinformatics Summer
BIOLOGY 432 Midterm I - 30 April PART I. Multiple choice questions (3 points each, 42 points total). Single best answer.
BIOLOGY 432 Midterm I - 30 April 2012 Name PART I. Multiple choice questions (3 points each, 42 points total). Single best answer. 1. Over time even the most highly conserved gene sequence will fix mutations.
Sequence Alignment: A General Overview. COMP Fall 2010 Luay Nakhleh, Rice University
Sequence Alignment: A General Overview COMP 571 - Fall 2010 Luay Nakhleh, Rice University Life through Evolution All living organisms are related to each other through evolution This means: any pair of
Gene Families part 2. Review: Gene Families /727 Lecture 8. Protein family. (Multi)gene family
Review: Gene Families Gene Families part 2 03 327/727 Lecture 8 What is a Case study: ian globin genes Gene trees and how they differ from species trees Homology, orthology, and paralogy Last tuesday 1
Advanced Certificate in Principles in Protein Structure. You will be given a start time with your exam instructions
BIRKBECK COLLEGE (University of London) Advanced Certificate in Principles in Protein Structure MSc Structural Molecular Biology Date: Thursday, 1st September 2011 Time: 3 hours You will be given a start
Bioinformatics tools for phylogeny and visualization. Yanbin Yin
Bioinformatics tools for phylogeny and visualization Yanbin Yin 1 Homework assignment 5 1. Take the MAFFT alignment http://cys.bios.niu.edu/yyin/teach/pbb/purdue.cellwall.list.lignin.f a.aln as input and
9/19/2012. Chapter 17 Organizing Life s Diversity. Early Systems of Classification
Section 1: The History of Classification Section 2: Modern Classification Section 3: Domains and Kingdoms Click on a lesson name to select. Early Systems of Classification Biologists use a system of classification
Characteristics of Life
UNIT 2 BIODIVERSITY Chapter 4- Patterns of Life Biology 2201 Characteristics of Life All living things share some basic characteristics: 1) living things are organized systems made up of one or more cells
Dynamic optimisation identifies optimal programs for pathway regulation in prokaryotes. - Supplementary Information -
Dynamic optimisation identifies optimal programs for pathway regulation in prokaryotes - Supplementary Information - Martin Bartl a, Martin Kötzing a,b, Stefan Schuster c, Pu Li a, Christoph Kaleta b a
College of Arts and Sciences, University of Oregon (Fall 2014)
Curriculum map Biology B.S./B.A. (Marine Biology LOs on page 4) Learning outcomes (LOs): Having completed a major in Biology, a student will demonstrate: 1. A broad-based knowledge of biology at multiple
8/23/2014. Phylogeny and the Tree of Life
Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major
Phylogenetic Trees. What They Are Why We Do It & How To Do It. Presented by Amy Harris Dr Brad Morantz
Phylogenetic Trees What They Are Why We Do It & How To Do It Presented by Amy Harris Dr Brad Morantz Overview What is a phylogenetic tree Why do we do it How do we do it Methods and programs Parallels
Biodiversity. The Road to the Six Kingdoms of Life
Biodiversity The Road to the Six Kingdoms of Life How the 6 kingdoms came about At first, only two kingdoms were recognized Then Haeckel proposed a third kingdom Protista (where protists had both plant