Evolutionary divergence of the plant elicitor peptides (Peps)

Size: px
Start display at page:

Download "Evolutionary divergence of the plant elicitor peptides (Peps)"

Transcription

1 Evolutionary divergence of the plant elicitor peptides (Peps) and their receptors: interfamily incompatibility of perception but compatibility of downstream signalling Item Type Article Authors Lori, M.; van Verk, M. C.; Hander, T.; Schatowitz, H.; Klauser, D.; Flury, P.; Gehring, Christoph A; Boller, T.; Bartels, S. Citation Evolutionary divergence of the plant elicitor peptides (Peps) and their receptors: interfamily incompatibility of perception but compatibility of downstream signalling 2015 Journal of Experimental Botany Eprint version Publisher's Version/PDF DOI /jxb/erv236 Publisher Oxford University Press (OUP) Journal Journal of Experimental Botany Rights This is an Open Access article distributed under the terms of the Creative Commons Attribution License ( creativecommons.org/licenses/by/3.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. Download date 05/07/ :38:39 Link to Item

2 Evolutionary divergence of the plant elicitor peptides (Peps) and their receptors: interfamily incompatibility of perception but compatibility of downstream signalling Martina Lori, Marcel van Verk, Tim Hander, Hendrik Schatowitz, Dominik Klauser, Pascale Flury, Chris Gehring, Thomas Boller, and Sebastian Bartels Supplemental Files Supplementary Table S3: Identity comparison of PROPEP sequences Full-length amino-acid sequences of published and novel HMMER identified PROPEP sequences were compared for the percentage of identical residues in aligned positions (upper half), and the number of identical residues in aligned positions (lower half). Colours indicate increasing amount of identity from low (blue) via white to high (red). Supplementary Table S4: Identity comparison of Pep sequences Pep amino-acid sequences deduced from published and novel HMMER identified PROPEP sequences were compared for the percentage of identical residues in aligned positions (upper half), and the number of identical residues in aligned positions (lower half). Colours indicate increasing amount of identity from low (blue) via white to high (red). Supplementary Table S5: Identity comparison of PEPR sequences Full-length amino-acid sequences of PEPR sequences were compared for the percentage of identical residues in aligned positions (upper half), and the number of identical residues in aligned positions (lower half). Colours indicate increasing amount of identity from low (blue) via white to high (red). Supplementary Table S6: Identity comparison of PEPR LRR domains The LRR domains of PEPR sequences were compared for the percentage of identical residues in aligned positions (upper half), and the number of identical residues in aligned positions (lower half). Colours indicate increasing amount of identity from low (blue) via white to high (red). Supplementary Table S7: Identity comparison of PEPR kinase domains The kinase domains of PEPR sequences were compared for the percentage of identical residues in aligned positions (upper half), and the number of identical residues in aligned positions (lower half). Colours indicate increasing amount of identity from low (blue) via white to high (red). Supplementary Figure S1: Plasticity of the Pep-PEPR-LRR interaction site Sequence alignment of the LRR region of the PEPR sequences from Figure 1B. Amino acid residues are coloured based on the conservation and interacting residues of AtPEPR1-LRR (underlined in red) as described by Tang et al., The LRR sequence of SlPEPR1 and ZmPEPR1a, used in this study, are underlined in grey. Yellow residues: conserved amino acids of AtPEPR1LRR. Magenta residues: AtPep1 interacting amino acids of AtPEPR1LRR. Below the sequence alignment the overall conservation is indicated by pink bars and a sequence logo.

3

4

5

6

7

8

The Arabidopsis Pep-PEPR system is induced by herbivore feeding and contributes to JA-mediated plant defence against herbivory

The Arabidopsis Pep-PEPR system is induced by herbivore feeding and contributes to JA-mediated plant defence against herbivory Journal of Experimental Botany, Vol. 66, No. 17 pp. 5327 5336, 2015 doi:10.1093/jxb/erv250 Advance Access publication 1 June 2015 This paper is available online free of all access charges (see http://jxb.oxfordjournals.org/open_access.html

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting

More information

BMC Evolutionary Biology 2013, 13:6

BMC Evolutionary Biology 2013, 13:6 BMC Evolutionary Biology This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Correction: Male-killing

More information

University of Dundee. Published in: Molecular Biology and Evolution. DOI: /molbev/msw235. Publication date: 2016

University of Dundee. Published in: Molecular Biology and Evolution. DOI: /molbev/msw235. Publication date: 2016 University of Dundee Progressive and biased divergent evolution underpins the origin and diversification of peridinin dinoflagellate plastids Dorrell, Richard G.; Klinger, Christen M.; Newby, Robert J.;

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information

Supporting Information

Supporting Information Supporting Information Development of a human vasopressin V 1a -receptor antagonist from an evolutionary-related insect neuropeptide Maria Giulia Di Giglio, Markus Muttenthaler, Kasper Harpsøe, Zita Liutkeviciute,

More information

2-(3-Chloro-4-hydroxylphenyl)-N-(3,4- dimethyoxyphenethyl)acetamide. Author. Published. Journal Title DOI. Copyright Statement.

2-(3-Chloro-4-hydroxylphenyl)-N-(3,4- dimethyoxyphenethyl)acetamide. Author. Published. Journal Title DOI. Copyright Statement. 2-(3-Chloro-4-hydroxylphenyl)-N-(3,4- dimethyoxyphenethyl)acetamide Author Davis, Rohan, Healy, Peter Published 2008 Journal Title Acta Crystallographica. Section E: Structure reports online DOI https://doi.org/10.1107/s1600536808013299

More information

Research Article A Generalization of a Class of Matrices: Analytic Inverse and Determinant

Research Article A Generalization of a Class of Matrices: Analytic Inverse and Determinant Advances in Numerical Analysis Volume 2011, Article ID 593548, 6 pages doi:10.1155/2011/593548 Research Article A Generalization of a Class of Matrices: Analytic Inverse and Determinant F. N. Valvi Department

More information

Hiromi Nishida. 1. Introduction. 2. Materials and Methods

Hiromi Nishida. 1. Introduction. 2. Materials and Methods Evolutionary Biology Volume 212, Article ID 342482, 5 pages doi:1.1155/212/342482 Research Article Comparative Analyses of Base Compositions, DNA Sizes, and Dinucleotide Frequency Profiles in Archaeal

More information

Consideration of Viscoelasticity in Time Step FEM-Based Restraint Analyses of Hardening Concrete

Consideration of Viscoelasticity in Time Step FEM-Based Restraint Analyses of Hardening Concrete Journal of Modern Physics, 2013, 4, 9-14 http://dx.doi.org/10.4236/jmp.2013.410a2002 Published Online October 2013 (http://www.scirp.org/journal/jmp) Consideration of Viscoelasticity in Time Step FEM-Based

More information

Bacterial protease uses distinct thermodynamic signatures for substrate recognition

Bacterial protease uses distinct thermodynamic signatures for substrate recognition Bacterial protease uses distinct thermodynamic signatures for substrate recognition Gustavo Arruda Bezerra, Yuko Ohara-Nemoto, Irina Cornaciu, Sofiya Fedosyuk, Guillaume Hoffmann, Adam Round, José A. Márquez,

More information

Note on the Expected Value of a Function of a Fuzzy Variable

Note on the Expected Value of a Function of a Fuzzy Variable International Journal of Mathematical Analysis Vol. 9, 15, no. 55, 71-76 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/1.1988/ijma.15.5145 Note on the Expected Value of a Function of a Fuzzy Variable

More information

Abstract. Introduction. Research paper

Abstract. Introduction. Research paper Journal of Experimental Botany, Vol. 64, No. 17, pp. 5309 5321, 2013 doi:10.1093/jxb/ert330 Advance Access publication 22 October, 2013 Research paper The family of Peps and their precursors in Arabidopsis:

More information

Research Article Global Existence and Boundedness of Solutions to a Second-Order Nonlinear Differential System

Research Article Global Existence and Boundedness of Solutions to a Second-Order Nonlinear Differential System Applied Mathematics Volume 212, Article ID 63783, 12 pages doi:1.1155/212/63783 Research Article Global Existence and Boundedness of Solutions to a Second-Order Nonlinear Differential System Changjian

More information

Veller, M.G.P. van. This is a "Post-Print" accepted manuscript, which will be published in "Qualitative and Quantitative Methods in Libraries (QQML)"

Veller, M.G.P. van. This is a Post-Print accepted manuscript, which will be published in Qualitative and Quantitative Methods in Libraries (QQML) Identification of multidisciplinary research based upon dissimilarity analysis of journals included in reference lists of Wageningen University & Research articles Veller, M.G.P. van This is a "Post-Print"

More information

University of Groningen

University of Groningen University of Groningen Role of mitochondrial inner membrane organizing system in protein biogenesis of the mitochondrial outer membrane Bohnert, Maria; Wenz, Lena-Sophie; Zerbes, Ralf M.; Horvath, Susanne

More information

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 3,900 116,000 120M Open access books available International authors and editors Downloads Our

More information

Impact of the crystallization condition on importin-β conformation

Impact of the crystallization condition on importin-β conformation Supporting information Volume 72 (2016) Supporting information for article: Impact of the crystallization condition on importin-β conformation Marcel J. Tauchert, Clément Hémonnot, Piotr Neumann, Sarah

More information

Cyclic Nucleotide Signaling (Methods In Signal Transduction Series)

Cyclic Nucleotide Signaling (Methods In Signal Transduction Series) Cyclic Nucleotide Signaling (Methods In Signal Transduction Series) If searched for a book Cyclic Nucleotide Signaling (Methods in Signal Transduction Series) in pdf format, then you've come to correct

More information

Solving Poisson Equation within Local Fractional Derivative Operators

Solving Poisson Equation within Local Fractional Derivative Operators vol. (207), Article ID 0253, 2 pages doi:0.3/207/0253 AgiAl Publishing House http://www.agialpress.com/ Research Article Solving Poisson Equation within Local Fractional Derivative Operators Hassan Kamil

More information

Approximations to the t Distribution

Approximations to the t Distribution Applied Mathematical Sciences, Vol. 9, 2015, no. 49, 2445-2449 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ams.2015.52148 Approximations to the t Distribution Bashar Zogheib 1 and Ali Elsaheli

More information

Convex Sets Strict Separation in Hilbert Spaces

Convex Sets Strict Separation in Hilbert Spaces Applied Mathematical Sciences, Vol. 8, 2014, no. 64, 3155-3160 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ams.2014.44257 Convex Sets Strict Separation in Hilbert Spaces M. A. M. Ferreira 1

More information

A note on the Lipkin model in arbitrary fermion number

A note on the Lipkin model in arbitrary fermion number Prog. Theor. Exp. Phys. 017, 081D01 9 pages) DOI: 10.1093/ptep/ptx105 Letter A note on the Lipkin model in arbitrary fermion number Yasuhiko Tsue 1,,, Constança Providência 1,, João da Providência 1,,

More information

On Some Identities of k-fibonacci Sequences Modulo Ring Z 6 and Z 10

On Some Identities of k-fibonacci Sequences Modulo Ring Z 6 and Z 10 Applied Mathematical Sciences, Vol. 12, 2018, no. 9, 441-448 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/ams.2018.8228 On Some Identities of k-fibonacci Sequences Modulo Ring Z 6 and Z 10 Tri

More information

Bahnson Biochemistry Cume, April 8, 2006 The Structural Biology of Signal Transduction

Bahnson Biochemistry Cume, April 8, 2006 The Structural Biology of Signal Transduction Name page 1 of 6 Bahnson Biochemistry Cume, April 8, 2006 The Structural Biology of Signal Transduction Part I. The ion Ca 2+ can function as a 2 nd messenger. Pick a specific signal transduction pathway

More information

Rhodamine B pentyl ester and its methyl, ethyl, propyl, and butyl homologues

Rhodamine B pentyl ester and its methyl, ethyl, propyl, and butyl homologues Rhodamine B pentyl ester and its methyl, ethyl, propyl, and butyl homologues Author Cosgrove, Kelly Published 2006 Journal Title Molbank Version Published DOI https://doi.org/10.3390/m515 Copyright Statement

More information

University of Groningen

University of Groningen University of Groningen Identification of Early Intermediates of Caspase Activation Using Selective Inhibitors and Activity-Based Probes Berger, Alicia B.; Witte, Martin; Denault, Jean-Bernard; Sadaghiani,

More information

From Pascal Triangle to Golden Pyramid

From Pascal Triangle to Golden Pyramid Asian Research Journal of Mathematics 6(): -9, 07; Article no.arjom.9964 ISSN: 456-477X From Pascal Triangle to Golden Pyramid Lovemore Mamombe * Department of Civil Engineering, University of Zimbabwe,

More information

Some Properties of a Semi Dynamical System. Generated by von Forester-Losata Type. Partial Equations

Some Properties of a Semi Dynamical System. Generated by von Forester-Losata Type. Partial Equations Int. Journal of Math. Analysis, Vol. 7, 2013, no. 38, 1863-1868 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ijma.2013.3481 Some Properties of a Semi Dynamical System Generated by von Forester-Losata

More information

Solving Homogeneous Systems with Sub-matrices

Solving Homogeneous Systems with Sub-matrices Pure Mathematical Sciences, Vol 7, 218, no 1, 11-18 HIKARI Ltd, wwwm-hikaricom https://doiorg/112988/pms218843 Solving Homogeneous Systems with Sub-matrices Massoud Malek Mathematics, California State

More information

Research Article Technical Note on Q, r, L Inventory Model with Defective Items

Research Article Technical Note on Q, r, L Inventory Model with Defective Items Hindawi Publishing Corporation Abstract and Applied Analysis Volume 010, Article ID 878645, 8 pages doi:10.1155/010/878645 Research Article Technical Note on Q, r, L Inventory Model with Defective Items

More information

Comparison of Pre-service Physics Teachers Conceptual Understanding of Classical and Quantum Mechanics

Comparison of Pre-service Physics Teachers Conceptual Understanding of Classical and Quantum Mechanics New Physics: Sae Mulli, Vol. 64, No. 1, January 2014, pp. 56 65 DOI: 10.3938/NPSM.64.56 Comparison of Pre-service Physics Teachers Conceptual Understanding of Classical and Quantum Mechanics Sungmin Im

More information

Research Article Uniqueness Theorems on Difference Monomials of Entire Functions

Research Article Uniqueness Theorems on Difference Monomials of Entire Functions Abstract and Applied Analysis Volume 202, Article ID 40735, 8 pages doi:0.55/202/40735 Research Article Uniqueness Theorems on Difference Monomials of Entire Functions Gang Wang, Deng-li Han, 2 and Zhi-Tao

More information

Diophantine Equations. Elementary Methods

Diophantine Equations. Elementary Methods International Mathematical Forum, Vol. 12, 2017, no. 9, 429-438 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/imf.2017.7223 Diophantine Equations. Elementary Methods Rafael Jakimczuk División Matemática,

More information

Research Article New Examples of Einstein Metrics in Dimension Four

Research Article New Examples of Einstein Metrics in Dimension Four International Mathematics and Mathematical Sciences Volume 2010, Article ID 716035, 9 pages doi:10.1155/2010/716035 Research Article New Examples of Einstein Metrics in Dimension Four Ryad Ghanam Department

More information

Third and Fourth Order Piece-wise Defined Recursive Sequences

Third and Fourth Order Piece-wise Defined Recursive Sequences International Mathematical Forum, Vol. 11, 016, no., 61-69 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.1988/imf.016.5973 Third and Fourth Order Piece-wise Defined Recursive Sequences Saleem Al-Ashhab

More information

Enhancing hydrogen production of microalgae by redirecting electrons from photosystem I to hydrogenase

Enhancing hydrogen production of microalgae by redirecting electrons from photosystem I to hydrogenase Electronic Supplementary Material (ESI) for Energy & Environmental Science. This journal is The Royal Society of Chemistry 2014 Supplementary information for Enhancing hydrogen production of microalgae

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase

More information

Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants

Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants Liu et al. BMC Evolutionary Biology (2017) 17:47 DOI 10.1186/s12862-017-0891-5 RESEARCH ARTICLE Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.

More information

Research Article A Note on Kantorovich Inequality for Hermite Matrices

Research Article A Note on Kantorovich Inequality for Hermite Matrices Hindawi Publishing Corporation Journal of Inequalities and Applications Volume 0, Article ID 5767, 6 pages doi:0.55/0/5767 Research Article A Note on Kantorovich Inequality for Hermite Matrices Zhibing

More information

Research Article Translative Packing of Unit Squares into Squares

Research Article Translative Packing of Unit Squares into Squares International Mathematics and Mathematical Sciences Volume 01, Article ID 61301, 7 pages doi:10.1155/01/61301 Research Article Translative Packing of Unit Squares into Squares Janusz Januszewski Institute

More information

High Sensitivity Gas Sensor Based on IR Spectroscopy Technology and Application

High Sensitivity Gas Sensor Based on IR Spectroscopy Technology and Application PHOTONIC SENSORS / Vol. 6, No. 2, 2016: 127 131 High Sensitivity Gas Sensor Based on IR Spectroscopy Technology and Application Hengyi LI Department of Electronic Information Engineering, Jincheng College

More information

Research Article A Nice Separation of Some Seiffert-Type Means by Power Means

Research Article A Nice Separation of Some Seiffert-Type Means by Power Means International Mathematics and Mathematical Sciences Volume 2012, Article ID 40692, 6 pages doi:10.1155/2012/40692 Research Article A Nice Separation of Some Seiffert-Type Means by Power Means Iulia Costin

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION University of Groningen Direct observation of the spin-dependent Peltier effect Flipse, J.; Bakker, F. L.; Slachter, A.; Dejene, F. K.; van Wees, Bart Published in: Nature Nanotechnology DOI: 10.1038/NNANO.2012.2

More information

Basins of Attraction for Optimal Third Order Methods for Multiple Roots

Basins of Attraction for Optimal Third Order Methods for Multiple Roots Applied Mathematical Sciences, Vol., 6, no., 58-59 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/.988/ams.6.65 Basins of Attraction for Optimal Third Order Methods for Multiple Roots Young Hee Geum Department

More information

Formula for Lucas Like Sequence of Fourth Step and Fifth Step

Formula for Lucas Like Sequence of Fourth Step and Fifth Step International Mathematical Forum, Vol. 12, 2017, no., 10-110 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/imf.2017.612169 Formula for Lucas Like Sequence of Fourth Step and Fifth Step Rena Parindeni

More information

Figure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and

Figure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and Figure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and counterclockwise for the inner row, with green representing coding

More information

Restrained Independent 2-Domination in the Join and Corona of Graphs

Restrained Independent 2-Domination in the Join and Corona of Graphs Applied Mathematical Sciences, Vol. 11, 2017, no. 64, 3171-3176 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/ams.2017.711343 Restrained Independent 2-Domination in the Join and Corona of Graphs

More information

On a Certain Representation in the Pairs of Normed Spaces

On a Certain Representation in the Pairs of Normed Spaces Applied Mathematical Sciences, Vol. 12, 2018, no. 3, 115-119 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/ams.2018.712362 On a Certain Representation in the Pairs of ormed Spaces Ahiro Hoshida

More information

Jeremy Chang Identifying protein protein interactions with statistical coupling analysis

Jeremy Chang Identifying protein protein interactions with statistical coupling analysis Jeremy Chang Identifying protein protein interactions with statistical coupling analysis Abstract: We used an algorithm known as statistical coupling analysis (SCA) 1 to create a set of features for building

More information

The Law of Luminous Intensity Variation and Technical Vision

The Law of Luminous Intensity Variation and Technical Vision Adv. Studies Theor. Phys. Vol. 7 2013 no. 8 349-354 HIKARI Ltd www.m-hikari.com The Law of Luminous Intensity Variation and Technical Vision Anna Gorbenko Department of Intelligent Systems and Robotics

More information

Research Article Improved Estimators of the Mean of a Normal Distribution with a Known Coefficient of Variation

Research Article Improved Estimators of the Mean of a Normal Distribution with a Known Coefficient of Variation Probability and Statistics Volume 2012, Article ID 807045, 5 pages doi:10.1155/2012/807045 Research Article Improved Estimators of the Mean of a Normal Distribution with a Known Coefficient of Variation

More information

Disconvergent and Divergent Fuzzy Sequences

Disconvergent and Divergent Fuzzy Sequences International Mathematical Forum, Vol. 9, 2014, no. 33, 1625-1630 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/imf.2014.49167 Disconvergent and Divergent Fuzzy Sequences M. Muthukumari Research

More information

Some identities related to Riemann zeta-function

Some identities related to Riemann zeta-function Xin Journal of Inequalities and Applications 206 206:2 DOI 0.86/s660-06-0980-9 R E S E A R C H Open Access Some identities related to Riemann zeta-function Lin Xin * * Correspondence: estellexin@stumail.nwu.edu.cn

More information

Research Article Polynomial GCD Derived through Monic Polynomial Subtractions

Research Article Polynomial GCD Derived through Monic Polynomial Subtractions International Scholarly Research Network ISRN Applied Mathematics Volume 2011, Article ID 714102, 7 pages doi:10.5402/2011/714102 Research Article Polynomial GCD Derived through Monic Polynomial Subtractions

More information

Site Suitability Analysis for Local Airport Using Geographic Information System

Site Suitability Analysis for Local Airport Using Geographic Information System Cloud Publications International Journal of Advanced Remote Sensing and GIS 2018, Volume 7, Issue 1, pp. 2719-2727 ISSN 2320 0243, Crossref: 10.23953/cloud.ijarsg.368 Research Article Site Suitability

More information

Factorization of Directed Graph Describing Protein Network

Factorization of Directed Graph Describing Protein Network Applied Mathematical Sciences, Vol. 11, 2017, no. 39, 1925-1931 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/ams.2017.76205 Factorization of Directed Graph Describing Protein Network G.Sh. Tsitsiashvili

More information

ROOT SQUARE MEAN GRAPHS OF ORDER 5

ROOT SQUARE MEAN GRAPHS OF ORDER 5 Available online at http://scik.org J. Math. Comput. Sci. 5 (2015), No. 5, 708-715 ISSN: 1927-5307 ROOT SQUARE MEAN GRAPHS OF ORDER 5 S.S. SANDHYA 1 S. SOMASUNDARAM 2 AND S. ANUSA 3,* 1 Department of Mathematics,

More information

Research Article The Solution Set Characterization and Error Bound for the Extended Mixed Linear Complementarity Problem

Research Article The Solution Set Characterization and Error Bound for the Extended Mixed Linear Complementarity Problem Journal of Applied Mathematics Volume 2012, Article ID 219478, 15 pages doi:10.1155/2012/219478 Research Article The Solution Set Characterization and Error Bound for the Extended Mixed Linear Complementarity

More information

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina

More information

Research Article Subordination Results on Subclasses Concerning Sakaguchi Functions

Research Article Subordination Results on Subclasses Concerning Sakaguchi Functions Hindawi Publishing Corporation Journal of Inequalities and Applications Volume 2009, Article ID 574014, 7 pages doi:10.1155/2009/574014 Research Article Subordination Results on Subclasses Concerning Sakaguchi

More information

RHS Plants for Pollinators Registered trademark guidelines

RHS Plants for Pollinators Registered trademark guidelines RHS Registered trademark guidelines 2 1 Introduction Welcome to the s guidelines for the RHS registered trademark. The RHS mark has been developed to be easy to use. The rules around its application have

More information

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 3,900 116,000 120M Open access books available International authors and editors Downloads Our

More information

BIOINFORMATICS: An Introduction

BIOINFORMATICS: An Introduction BIOINFORMATICS: An Introduction What is Bioinformatics? The term was first coined in 1988 by Dr. Hwa Lim The original definition was : a collective term for data compilation, organisation, analysis and

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/2/1/e1500989/dc1 Supplementary Materials for An epidermis-driven mechanism positions and scales stem cell niches in plants Jérémy Gruel, Benoit Landrein, Paul Tarr,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,

More information

Lesson 2. Parts of a plant Contains: Worksheet 3.1 Support worksheet 3.1

Lesson 2. Parts of a plant Contains: Worksheet 3.1 Support worksheet 3.1 Unit 3. Plants Lesson 2. Parts of a plant Contains: Worksheet 3.1 Support worksheet 3.1 WORKSHEET 3.1 1. Read and circle the words that are part of a plant. Draw the plant. This plant has six roots. It

More information

Analysis of Forward Collision Warning System. Based on Vehicle-mounted Sensors on. Roads with an Up-Down Road gradient

Analysis of Forward Collision Warning System. Based on Vehicle-mounted Sensors on. Roads with an Up-Down Road gradient Contemporary Engineering Sciences, Vol. 7, 2014, no. 22, 1139-1145 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ces.2014.49142 Analysis of Forward Collision Warning System Based on Vehicle-mounted

More information

SIMPLE MICROMECHANICAL MODEL OF PROTEIN CRYSTALS FOR THEIR MECHANICAL CHARACTERIZATIONS

SIMPLE MICROMECHANICAL MODEL OF PROTEIN CRYSTALS FOR THEIR MECHANICAL CHARACTERIZATIONS EPJ Web of Conferences 6, 6 51 (21) DOI:1.151/epjconf/21651 Owned by the authors, published by EDP Sciences, 21 SIMPLE MICROMECHANICAL MODEL OF PROTEIN CRYSTALS FOR THEIR MECHANICAL CHARACTERIZATIONS Gwonchan

More information

Improvements in Newton-Rapshon Method for Nonlinear Equations Using Modified Adomian Decomposition Method

Improvements in Newton-Rapshon Method for Nonlinear Equations Using Modified Adomian Decomposition Method International Journal of Mathematical Analysis Vol. 9, 2015, no. 39, 1919-1928 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ijma.2015.54124 Improvements in Newton-Rapshon Method for Nonlinear

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/3/6/e1700147/dc1 Supplementary Materials for Ribosome rearrangements at the onset of translational bypassing Xabier Agirrezabala, Ekaterina Samatova, Mariia Klimova,

More information

Poincaré`s Map in a Van der Pol Equation

Poincaré`s Map in a Van der Pol Equation International Journal of Mathematical Analysis Vol. 8, 014, no. 59, 939-943 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.1988/ijma.014.411338 Poincaré`s Map in a Van der Pol Equation Eduardo-Luis

More information

Remark on the Sensitivity of Simulated Solutions of the Nonlinear Dynamical System to the Used Numerical Method

Remark on the Sensitivity of Simulated Solutions of the Nonlinear Dynamical System to the Used Numerical Method International Journal of Mathematical Analysis Vol. 9, 2015, no. 55, 2749-2754 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ijma.2015.59236 Remark on the Sensitivity of Simulated Solutions of

More information

Supplementary Figure 1. Fourier shell correlation curves for sub-tomogram averages and

Supplementary Figure 1. Fourier shell correlation curves for sub-tomogram averages and Supplementary Figure 1. Fourier shell correlation curves for sub-tomogram averages and comparisons to other published in situ T3SS structures. a, Resolution estimates after applying Fourier shell correlation

More information

Research Article Ulam-Hyers-Rassias Stability of a Hyperbolic Partial Differential Equation

Research Article Ulam-Hyers-Rassias Stability of a Hyperbolic Partial Differential Equation International Scholarly Research Network ISRN Mathematical Analysis Volume 212, Article ID 69754, 1 pages doi:1.542/212/69754 Research Article Ulam-Hyers-Rassias Stability of a Hyperbolic Partial Differential

More information

On Symmetric Bi-Multipliers of Lattice Implication Algebras

On Symmetric Bi-Multipliers of Lattice Implication Algebras International Mathematical Forum, Vol. 13, 2018, no. 7, 343-350 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/imf.2018.8423 On Symmetric Bi-Multipliers of Lattice Implication Algebras Kyung Ho

More information

On Numerical Solutions of Systems of. Ordinary Differential Equations. by Numerical-Analytical Method

On Numerical Solutions of Systems of. Ordinary Differential Equations. by Numerical-Analytical Method Applied Mathematical Sciences, Vol. 8, 2014, no. 164, 8199-8207 HIKARI Ltd, www.m-hiari.com http://dx.doi.org/10.12988/ams.2014.410807 On Numerical Solutions of Systems of Ordinary Differential Equations

More information

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 3,500 108,000 1.7 M Open access books available International authors and editors Downloads Our

More information

Creative Commons: Attribution 3.0 Hong Kong License

Creative Commons: Attribution 3.0 Hong Kong License Title Mechanism of the X-ray and soft gamma-ray emissions from the high magnetic field pulsar: PSR B1509-58 Author(s) Wang, Y; Takata, J; Cheng, KS Citation Journal of Astronomy and Space Science, 2013,

More information

An Improved Hybrid Algorithm to Bisection Method and Newton-Raphson Method

An Improved Hybrid Algorithm to Bisection Method and Newton-Raphson Method Applied Mathematical Sciences, Vol. 11, 2017, no. 56, 2789-2797 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/ams.2017.710302 An Improved Hybrid Algorithm to Bisection Method and Newton-Raphson

More information

Some New Three Step Iterative Methods for Solving Nonlinear Equation Using Steffensen s and Halley Method

Some New Three Step Iterative Methods for Solving Nonlinear Equation Using Steffensen s and Halley Method British Journal of Mathematics & Computer Science 19(2): 1-9, 2016; Article no.bjmcs.2922 ISSN: 221-081 SCIENCEDOMAIN international www.sciencedomain.org Some New Three Step Iterative Methods for Solving

More information

Antibound State for Klein-Gordon Equation

Antibound State for Klein-Gordon Equation International Journal of Mathematical Analysis Vol. 8, 2014, no. 59, 2945-2949 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ijma.2014.411374 Antibound State for Klein-Gordon Equation Ana-Magnolia

More information

Research Article Subnormal Solutions of Second-Order Nonhomogeneous Linear Differential Equations with Periodic Coefficients

Research Article Subnormal Solutions of Second-Order Nonhomogeneous Linear Differential Equations with Periodic Coefficients Hindawi Publishing Corporation Journal of Inequalities and Applications Volume 2009, Article ID 416273, 12 pages doi:10.1155/2009/416273 Research Article Subnormal Solutions of Second-Order Nonhomogeneous

More information

Research Article Parametric Evaluations of the Rogers-Ramanujan Continued Fraction

Research Article Parametric Evaluations of the Rogers-Ramanujan Continued Fraction International Mathematics and Mathematical Sciences Volume 011, Article ID 940839, 11 pages doi:10.1155/011/940839 Research Article Parametric Evaluations of the Rogers-Ramanujan Continued Fraction Nikos

More information

Lecture 2, 5/12/2001: Local alignment the Smith-Waterman algorithm. Alignment scoring schemes and theory: substitution matrices and gap models

Lecture 2, 5/12/2001: Local alignment the Smith-Waterman algorithm. Alignment scoring schemes and theory: substitution matrices and gap models Lecture 2, 5/12/2001: Local alignment the Smith-Waterman algorithm Alignment scoring schemes and theory: substitution matrices and gap models 1 Local sequence alignments Local sequence alignments are necessary

More information

Diammonium biphenyl-4,4'-disulfonate. Author. Published. Journal Title DOI. Copyright Statement. Downloaded from. Link to published version

Diammonium biphenyl-4,4'-disulfonate. Author. Published. Journal Title DOI. Copyright Statement. Downloaded from. Link to published version Diammonium biphenyl-4,4'-disulfonate Author Smith, Graham, Wermuth, Urs, Healy, Peter Published 2008 Journal Title Acta Crystallographica. Section E: Structure Reports Online DOI https://doi.org/10.1107/s1600536807061995

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 The correlation of n-score cutoff and FDR in both CID-only and CID-ETD fragmentation strategies. A bar diagram of different n-score thresholds applied in the search, plotted against

More information

Direct Product of BF-Algebras

Direct Product of BF-Algebras International Journal of Algebra, Vol. 10, 2016, no. 3, 125-132 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ija.2016.614 Direct Product of BF-Algebras Randy C. Teves and Joemar C. Endam Department

More information

Bioinformatics Exercises

Bioinformatics Exercises Bioinformatics Exercises AP Biology Teachers Workshop Susan Cates, Ph.D. Evolution of Species Phylogenetic Trees show the relatedness of organisms Common Ancestor (Root of the tree) 1 Rooted vs. Unrooted

More information

Hyperbolic Functions and. the Heat Balance Integral Method

Hyperbolic Functions and. the Heat Balance Integral Method Nonl. Analysis and Differential Equations, Vol. 1, 2013, no. 1, 23-27 HIKARI Ltd, www.m-hikari.com Hyperbolic Functions and the Heat Balance Integral Method G. Nhawu and G. Tapedzesa Department of Mathematics,

More information

Tridip Sheet, Raja Banerjee*

Tridip Sheet, Raja Banerjee* Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Supplementary information The C NN motif: an intrinsic lover of sulfate and phosphate ions

More information

Measuring quaternary structure similarity using global versus local measures.

Measuring quaternary structure similarity using global versus local measures. Supplementary Figure 1 Measuring quaternary structure similarity using global versus local measures. (a) Structural similarity of two protein complexes can be inferred from a global superposition, which

More information

Research Article A New Class of Meromorphically Analytic Functions with Applications to the Generalized Hypergeometric Functions

Research Article A New Class of Meromorphically Analytic Functions with Applications to the Generalized Hypergeometric Functions Abstract and Applied Analysis Volume 20, Article ID 59405, 0 pages doi:0.55/20/59405 Research Article A New Class of Meromorphically Analytic Functions with Applications to the Generalized Hypergeometric

More information

Aspects of the optical system relevant for the KM3NeT timing calibration

Aspects of the optical system relevant for the KM3NeT timing calibration EPJ Web of Conferences 116, 06002 (2016) DOI: 10.1051/epjconf/201611606002 C Owned by the authors, published by EDP Sciences, 2016 Aspects of the optical system relevant for the KM3NeT timing calibration

More information

PAMP-triggered immunity (PTI)

PAMP-triggered immunity (PTI) PAMP-triggered immunity (PTI) PAMP-triggered immunity (PTI) Recognition of danger signals - Distinguish self or damaged self versus non-self fundamental to any immune system - PAMP or MAMP pathogen/microbe-associated

More information

Research Article An Optimized Grey GM(2,1) Model and Forecasting of Highway Subgrade Settlement

Research Article An Optimized Grey GM(2,1) Model and Forecasting of Highway Subgrade Settlement Mathematical Problems in Engineering Volume 015, Article ID 606707, 6 pages http://dx.doi.org/10.1155/015/606707 Research Article An Optimized Grey GM(,1) Model and Forecasting of Highway Subgrade Settlement

More information

Binary Relations in the Space of Binary Relations. I.

Binary Relations in the Space of Binary Relations. I. Applied Mathematical Sciences, Vol. 8, 2014, no. 109, 5407-5414 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ams.2014.47515 Binary Relations in the Space of Binary Relations. I. Vyacheslav V.

More information

Using Bioinformatics to Study Evolutionary Relationships Instructions

Using Bioinformatics to Study Evolutionary Relationships Instructions 3 Using Bioinformatics to Study Evolutionary Relationships Instructions Student Researcher Background: Making and Using Multiple Sequence Alignments One of the primary tasks of genetic researchers is comparing

More information

Supporting Information

Supporting Information Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)

More information