Regulation of the Synaptonemal Complex Protein, Zip1, During Meiosis in Budding Yeast

Transcription

1 Wesleyan University Regulation of the Synaptonemal Complex Protein, Zip1, During Meiosis in Budding Yeast By Pritam Mukherjee Faculty Advisor: Dr. Amy J. MacQueen A dissertation submitted to the faculty of Wesleyan University in partial fulfillment of the requirements for the degree of Master of Arts in Molecular Biology and Biochemistry Middletown, CT 2014 i

2 Acknowledgements First and foremost, I would like to thank my P.I., Prof. Amy J. MacQueen for her guidance, encouragement and immense support to carry out my graduate research at Wesleyan University. She has always given me the freedom to perform independent research in the lab, and has taught me how to learn from mistakes and to be an independent individual. Amy, you are a real inspiration. I would also like to extend my gratitude to my excellent committee members: Prof. Scott Holmes, Prof. Donald Oliver and Prof. Michael McAlear for their valuable advise and support. I would also like to thank all the past and present members of the MacQueen lab: specially Karen Voelkel-Meiman (for constantly sharing her knowledge and scientific experience with me), Sarah Moustafa, Louis Taylor, Lina Yisehak, Yashna Thapetta and Michelle Cheng for their friendship and support. Finally, I would like to thank my sister and my parents for their unconditional love, continuous support and enormous encouragement during my stay at Wesleyan. ii

3 Table of Contents Section Pages(s) Acknowledgements ii List of Tables vi List of Figures vii Abstract ix Chapter 1 General Introduction Introduction to meiosis Meiotic prophase chromosome choreography leads to attached homologs Polycomplex formation and its structural organization Significance of Synaptonemal Complex Significance of Polycomplex Regulation of the Synaptonemal Complex and Polycomplex Questions addressed in this study Chapter 2 Materials and Methods Strains and plasmids construction Surface chromosome-spreads of meiotic cells Preparation of chromosome spreads for fluorescence microscopy Fpr3 induction using β-estradiol Fluorescence imaging Isolation of total yeast protein via Trichloroacetic acid (TCA) preparation Western blot analysis Yeast two-hybrid assay Spore viability Sporulation efficiency Data analysis and statistical significance Chapter 3-5 Results and Discussion iii

4 Chapter 3 Characterization of factors that regulate Zip1 in the absence of recombination initiation during meiosis in budding yeast Abstract Introduction Results Two prolyl isomerases regulate Zip1 polycomplex formation through separate pathways Increased penetrance of linear Zip1 elaborations in spo11 fpr3 zip3 mutants lacking Rrd1 activity Overexpression of phosphatase component Sit4 phenocopies loss-of-function of Rrd Rrd1-MYC and YFP-Sit4 localize to the nucleoplasm but are absent from Zip1 polycomplexes in spo11 meiotic cells Residues within Fpr3 s PPIase domain might be essential for Zip1 polycomplex formation Phosphatase component Pph3 promotes Zip1 polycomplex formation together with Rrd Discussion Chapter 4 The relationship between Zip1 and its regulators within the polycomplex Abstract Introduction Results Fpr3 but not Zip1 depend on Pch2 for their aggregation into a polycomplex at the nucleolus Fpr3 aggregation into polycomplex occurs independently of Zip1, but requires Zip1 for co-localization with SUMO and Synapsis Initiation Complex (SIC) proteins SUMO and the SIC proteins are dispensable for Fpr3 and Zip1 aggregation into a polycomplex Pph3-MYC often localizes to polycomplex structures in a Zip1-dependent manner Investigating interactions between Fpr3 (or other SC regulators) and Zip1 using a vegetative yeast two-hybrid system Discussion iv

5 Chapter 5 Fpr3-overexpression results in a Pch2-dependent defect in early-meiotic prophase progression, SC assembly and meiotic spore formation Abstract Introduction Results FPR3-overexpression causes a PCH2-dependent defect in meiotic spore formation Overexpression of Fpr3 causes a defect in early prophase progression and SC assembly during meiotic prophase Deletion of PCH2 rescues the defect in early prophase progression and SC assembly caused by Fpr3-overexpression Discussion Appendix References v

6 List of Tables Section Page(s) Chapter 2 Table P1. Yeast two-hybrid Gal4-AD and Gal4-DBD fusion plasmids constructed and/or used in this study Table P2. Primers used in this study Table S1. Strains used in this study Chapter 3 Table 1. Spore viability Table 2. Zip1 and Fpr3 polycomplex formation in spo11 meiotic cells containing fpr3 mutant alleles that are defective in PPIase and/or recombination-checkpoint function Chapter 4 Table 1. A vegetative yeast two-hybrid (Y2H) assay for HIS3 reporter system Chapter 5 Table 1. Spore viability of uninduced (UI) and induced (I) P GAL1 [FPR3]/+ meiotic strains in presence or absence of Pch vi

7 List of Figures Section Page(s) Chapter 1 Figure 1. Meiotic prophase chromosome choreography leads to attached homologs Figure 2. The structure of the Synaptonemal Complex (SC) Figure 3. How is SC assembly coordinated with homolog pairing? Figure 4. Proposed model on how Fpr3 and/or Rrd1 might regulate Zip1 s nuclear distribution in absence of recombination and/or homolog pairing Chapter 3 Figure 1. Rrd1 promotes Zip1 polycomplex formation in parallel with Fpr3 in pairingdefective meiotic nuclei Figure 2. Deletion of RRD1 in spo11 fpr3 zip3 meiotic nuclei results in an increased penetrance of linear Zip1 assemblies on chromosomes Figure 3. Overexpression of Sit4 phosphatase phenocopies loss-of-function of Rrd Figure 4. Localization of epitope-tagged Rrd1 and Sit4 within a meiotic cell Figure 5. Hydrophobic pocket-residues of Fpr3 s prolyl isomerase domain might be required for Zip1 and/or Fpr3 polycomplex formation Figure 6. Pph3 phosphatase promotes Zip1 and Fpr3 polycomplex formation in spo11 meiotic mutants Figure 7. A cartoon represents proposed model on how Fpr3 and/or Rrd1 might regulate Zip1 s nuclear distribution via parallel pathways Chapter 4 Figure 1. Fpr3 but not Zip1 rely on Pch2 for their aggregation into a polycomplex at the nucleolus in pairing-defective meiotic nuclei Figure 2. Zip1-independent Fpr3 polycomplexes require Zip1 for co-localization with SUMO and Synapsis Initiation Complexes (SICs) Figure 3. SUMO and the Synapsis Initiation Complex (SIC) proteins are dispensable for Fpr3 and Zip1 aggregation into polycomplexes Figure 4. Pph3-MYC often localizes to polycomplex structures in a Zip1-dependent vii

8 manner Figure 5. Investigating interactions between Fpr3 (or other SC regulators) and the SC protein Zip1 using a vegetative yeast two-hybrid system Figure 6. Current model for Zip1 polycomplex formation in absence of recombination and/or homolog pairing during budding yeast meiosis Chapter 5 Figure 1. Overexpression of FPR3 causes a Pch2-dependent defect in meiotic cell-cycle progression Figure 2. Overexpression of FPR3 causes a defect in early prophase progression and SC assembly in meiotic prophase cells Figure 3. Deletion of PCH2 rescues the early prophase progression and SC assembly defect in Fpr3-overexpressing meiotic cells Figure 4. Current model viii

9 Abstract Meiosis is a specialized cell division wherein diploid cells produce haploid gametes by halving the chromosome number. During meiosis, the success of chromosome ploidy reduction relies on pre-established linkages between homologous chromosomes (homologs). Such associations between homologs occur through a series of highly ordered events during early meiotic prophase. The Synaptonemal Complex (SC) is a structurally conserved assembly of proteins that lies at the interface of lengthwise-aligned homologs. When homolog pairing fails, SC proteins usually aggregate into a polycomplex structure instead of assembling SCs between paired homologs. We use genetic and cytological approaches in Saccharomyces cerevisiae to identify protein regulators that ensure the SC assembles only in the right place at the right time. We have identified several trans-acting factors that promote SC protein aggregation when recombination and/or homolog pairing is absent. Fpr3 and Rrd1 prolyl isomerases along with phosphatase subunit Pph3 are required for the aggregation of Zip1 (a SC central region protein) into a polycomplex at the nucleolus. In absence of such Zip1 regulators, polycomplex failure can correlate with promiscuous SC assembly on unpaired chromosomes, suggesting the importance of negatively regulating Zip1 to promote polycomplex formation. Like Fpr3, epitope-tagged Pph3 often co-aggregates within a polycomplex in a Zip1-dependent manner. However, epitope-tagged Rrd1 does not appear to localize to Zip1 polycomplex structures. Moreover, while Zip1 requires Fpr3 for its full capacity to form polycomplex, Fpr3 polycomplex forms independent of Zip1 at the nucleolus. Such Zip1-independent, nucleolus-anchored Fpr3 polycomplexes are devoid of SUMO (another SC central region protein) and Synapsis Initiation Complex ix

10 (SIC) proteins that are normally present within polycomplexes. Consistent with this idea, SUMO and SICs are dispensable for Zip1 and Fpr3 aggregation into a polycomplex. Taken together, our results are consistent with a model in which Fpr3 may directly act on Zip1 to promote polycomplex formation whereas Rrd1 may promote Zip1 polycomplex indirectly through activating and/or inhibiting the phosphatase components Pph3 and Sit4 respectively. Finally, we asked whether Fpr3-overexpression interferes with SC assembly during an otherwise normal meiosis. Intriguingly, we found that overexpression of Fpr3 reduces steady-state SC protein levels, and results in a meiosis-specific AAA+ ATPase Pch2- dependent defect in early prophase (pre-pachytene) progression, SC assembly and meiotic spore formation. Together, these results suggest a novel function of Pch2 (that otherwise functions as a pachytene checkpoint protein) in monitoring early prophase (pre-pachytene) checkpoint, and we propose that the defect in SC assembly and sporulation caused by Fpr3-overexpression is an indirect consequence of this Pch2 mediated pre-pachytene checkpoint activation. x

11 Chapter 1 General Introduction 1

12 1.1 Introduction to meiosis All sexually reproducing diploid organisms inherit one set of maternal and paternal chromosomes through the fusion of two haploid sex cells (gametes). Such gametes arise from diploid cells by virtue of a specialized cell division called meiosis, which halves the chromosome number. In order to successfully segregate during meiosis I, homologous chromosomes (homologs) must find and stably associate with one another until their alignment on the first meiotic spindle. This feat is achieved during meiotic prophase. Meiotic fidelity depends on successful chromosome segregation. Failure to disjoin homologs during meiosis results in aneuploidy, a major cause of infertility in adults, embryonic death and mental retardation (such as Down s syndrome) (Hassold and Hunt, 2001). Such disease manifestations could originate from disturbances in key meiotic prophase chromosomal events such as homologous recombination, homolog pairing and synapsis, all of which are important for the success of meiosis I. Therefore, identification and characterization of essential regulators of meiotic chromosome processes will lead to a better understanding of human reproductive health. 1.2 Meiotic prophase chromosome choreography leads to attached homologs As compared to the prophase stage of mitosis, meiotic prophase is extended and comprises five distinct cytological sub-stages (Zickler and Kleckner, 1998) (Figure 1). Chromosome condensation begins at leptotene, the first sub-stage of meiotic prophase, and in cytological preparations each chromosome usually appears as thin linear strands. In most organisms, meiotic recombination initiates between early- and mid-leptotene, 2

13 which eventually facilitates local homolog alignment during the leptotene-zygotene transition. At mid-meiotic prophase (pachytene), chromosomes are highly condensed and homologs are completely aligned lengthwise (homolog pairing is complete), and each homolog is capable of undergoing crossover recombination with its partner (Roeder, 1997; Zickler, 2006; Zickler and Kleckner, 1998; Zickler and Kleckner, 1999). At this stage, each homolog pair features a structurally conserved, proteinaceous structure called the Synaptonemal Complex (SC) along the interface between partner chromosomes (Page and Hawley, 2004). The SC joins two meiotic homolog axes together along their length by the assembly of multiple proteins that make up the overall SC structure. The assembly of SC (synapsis) initiates during zygotene, a stage prior to mid-meiotic prophase (Page and Hawley, 2004). The process of SC disassembly occurs during diplotene, a stage that immediately follows pachytene. Diplotene usually features a decondensed state of meiotic chromosomes and ultimately culminates in the formation of direct physical attachment between homologs mediated by crossover recombination events called chiasmata. After SC disassembly, chiasmata hold homologs together until chromosomes can properly orient, and segregate away from one another to opposite poles of the spindle during the meiosis I division (Page and Hawley, 2004; Zickler and Kleckner, 1998). 3

14 Leptotene-Zygotene! Pachytene! Diplotene-Diakinesis! Nuclear! Reorganization! Initial Pairing! Synapsis! Crossover! Recombination! Chromosome! Cores! Meiosis I Spindle!! C N! N C! Zip1 Dimer! SC Central Region! Meiosis I Spindle!! Meiosis I!! Gamete Formation! (Meiosis II)! *Courtesy of Dr. Amy J. MacQueen Figure 1. Meiotic prophase chromosome choreography leads to attached homologs. The associations between homologous chromosomes (homologs) are established through a series of well-coordinated chromosomal events during early meiotic prophase. A conserved feature (of early prophase) is initial pairing that is associated with global reorganization of chromosomes. Initial homolog associations are ultimately maintained/reinforced by crossover recombination events (initiated with programmed DNA double strand breaks that repair off the partner homolog). These crossover events then serve to maintain the association between homologs until their alignment on the first meiotic spindle. Finally, another conserved feature of meiotic prophase is a proteinaceous structure that links initial pairing with crossover recombination. A cartoon of the protein structure called the Synaptonemal Complex (SC) that assembles along the entire length of aligned homologs is shown. In budding yeast, Zip1 is an essential protein constituent of the SC central region and forms parallel homo-dimers. Several such Zip1 dimers or tetramers join at their N-termini while their C-termini connect the homolog axes (chromosome cores) together to build the full-length SC structure. 4

15 1.2.1 Homology recognition and initial pairing At the onset of meiotic prophase, chromosomes undergo an extensive reorganization during which they initiate the search for, ultimately recognize, and pair with their homologous partners. However, the exact mechanism by which homology recognition is achieved is not understood. At least two groups of organisms have evolved to pair homologs via separate mechanisms, one of which is recombination-independent and the other, which is recombination-dependent. In a group of organisms (including humans, plants and budding yeast), initial recombination events are a prerequisite for homolog pairing and synapsis (SC assembly). On the other hand, early recombination processes are dispensable for homolog pairing and SC assembly in at least worms and flies. Nevertheless, almost all these organisms display global chromosome movements during the early meiotic prophase (Bhalla and Dernburg, 2008). During leptotene in budding yeast, chromosomes feature a process called centromere coupling where two centromeres associate in a homology-independent and recombination-independent manner (Bardhan et al., 2010; Tsubouchi and Roeder, 2005). It is not clear at this point whether such homology-independent centromeric associations are functionally important for homolog pairing. Another hallmark of late-leptotene displayed by many organisms is chromosomal bouquet formation, in which one or both telomeric chromosomal regions cluster at a confined portion of the meiotic nuclear envelope. Since meiotic bouquet chromosomes are transiently brought together in close proximity, perhaps this facilitates an efficient homology search between chromosomes, although this idea remains controversial (Scherthan, 2001; Zickler, 2006; Zickler and Kleckner, 1998). Finally, meiotic 5

16 chromosomes exhibit rapid prophase movements (RPMs) during leptotene/zygotene via interactions between telomere and cytoskeleton protein components (Chikashige et al., 2006; Conrad et al., 2007; Scherthan et al., 2007). These telomere-mediated rapid prophase movements have been recently demonstrated to play direct roles in the efficient establishment of homolog pairing (Lee et al., 2012; Sonntag Brown et al., 2011) Crossover recombination directly links homologous chromosomes A widely conserved feature of early meiotic prophase is homologous recombination, initiated by Spo11-mediated programmed DNA double strand breaks (DSBs). The DNA ends of breaks are processed and repaired using a homolog s chromatid as a template. There could be several outcomes for the repair process, one of which is a crossover event. If DSB-repair results in a crossover outcome, then two independent chromosomes of the homologous pair become physically linked by virtue of the DNA strand exchange, in conjunction with sister chromatid cohesion. Such DNA exchange events serve to maintain the association of homologs after the SC disassembles and until homolog disjunction on the first meiotic spindle (Page and Hawley, 2004; Roeder, 1997; Zickler, 2006; Zickler and Kleckner, 1998; Zickler and Kleckner, 1999). Spo11, a highly conserved topoisomerase-like enzyme, is the catalytic subunit of the 9-protein complex that makes a DNA DSB. Out of these 9 proteins, 6 of them are expressed specifically in meiosis (Keeney et al., 1997). Moreover, later findings revealed the role of Ski8 to directly associate with Spo11 and act as a scaffold for recruiting other cofactors onto meiotic chromosomes to facilitate DSB formation (Arora et al., 2004). In general, breaks in the genome/dna are deleterious for cell viability but during meiosis, 6

17 DNA breaks are deliberately made. In meiotic cells, the homologous recombination repair machinery is generally up regulated and these repair enzymes process breaks, which sometimes led to crossover recombination events. In budding yeast, although DNA breaks are made throughout the chromosomes they are usually concentrated at special chromosomal regions termed as hot-spots (with no detectable sequence conservation) near the centromeres and the telomeres. However, not all breaks are processed and mature as crossover events (Allers and Lichten, 2001; Blitzblau et al., 2007; Cromie and Smith, 2007; Hunter and Kleckner, 2001; Roeder, 1997; Zickler and Kleckner, 1999) Synapsis (SC assembly) A. The initiation of SC Several meiosis-specific proteins, also known as Synapsis Initiation Complex (SIC) proteins such as Zip2, Zip3, Zip4 and Spo16 localize on meiotic chromosomes in budding yeast as numerous discrete foci during the zygotene and pachytene stage of meiosis. Sites where these foci are located during zygotene are thought to be the sites of SC initiation (Agarwal and Roeder, 2000; Chua and Roeder, 1998; Shinohara et al., 2008; Tsubouchi et al., 2006). SC initiation occurs predominantly at centromeres (Tsubouchi et al., 2008; Tsubouchi and Roeder, 2005). Occasionally, SIC protein (at least Zip2) is found localized to one edge of a short SC stretch away from the centromere, suggesting that SCs might often elongate unidirectional from centromeres (Tsubouchi et al., 2008). However, SIC staining is sometimes observed at the opposite ends of a nascent SC originated from the centromere, suggesting the existence of a bidirectional SC initiation event or two 7

18 independent SC initiation events occurring in opposite directions (Tsubouchi et al., 2008). SC also initiates at non-centromereric regions of the chromosomes that are thought to be the sites for crossover recombination (Rockmill and Roeder, 1990). However, apart from the distinction in chromosomal locations for SC initiation, the meiotic proteins involved in facilitating this process also vary. Zip2, Zip4 and Spo16 promote SC initiation and its subsequent polymerization at all SC initiation sites (Chua and Roeder, 1998; Shinohara et al., 2008; Tsubouchi et al., 2006). On the other hand, Zip3 promotes SC initiation from non-centromeric sites while it prevents synapsis initiation from centromeric locations (MacQueen and Roeder, 2009; Tsubouchi et al., 2008). At centromeres, Zip3 loading is dependent on Zip1 while Zip3 loading at non-centromeric chromosome sites is Zip1-independent. Zip3 influences SC assembly indirectly via its downstream effector proteins Zip2, Zip4 and Spo16. Zip3 facilitates loading of Zip2, Zip4 and Spo16 onto meiotic chromosomes and/or stabilizes their association (Agarwal and Roeder, 2000; Chua and Roeder, 1998; Shinohara et al., 2008; Tsubouchi et al., 2006). Signals downstream of recombination initiation events at locations distal to the centromeres might trigger SIC (Zip2 and Zip4) localization to centromeres, where these proteins might reverse the negative effect of Zip3 on SC initiation at centromeres. (MacQueen and Roeder, 2009; Tsubouchi et al., 2008). While SC initiates early at centromeres and later at presumed recombination sites on S. cerevisiae chromosomes, in an organism that does not rely on recombination for synapsis such as C. elegans, the initiation of SC occurs predominantly at a specialized region at one end of each chromosome, the pairing center (MacQueen et al., 2005). On 8

19 the other hand, in the human male (which depends on recombination initiation for synapsis) specialized telomeric regions serve as unique sites for preferential SC initiation (Brown et al., 2005). B. The SC: a tripartite structure Cytological studies in various organisms have revealed three distinct sub-structures within the SC: the lateral elements, a transverse filament and a central element (Moses, 1969; Page and Hawley, 2004; Solari and Moses, 1973) (Figure 2). The lateral elements are homolog axes formed after sister chromatid condensation and contain cohesin proteins, condensin proteins, as well as meiosis-specific proteins such as Red1 and Hop1 (Page and Hawley, 2004; Smith and Roeder, 1997; Zickler and Kleckner, 1999). Two lateral elements, corresponding to homolog axes, aligned parallel to one other are connected by a set of central region proteins. A major sub-element of the central region proteins is a set of perpendicularly-oriented, transverse filament proteins. At the midline of the transverse filaments lays a structure called the central element (Page and Hawley, 2004; Sym et al., 1993). The Zip1 protein, a meiosis-specific protein with a central coiled-coil domain, forms a major component of the transverse filaments of budding yeast SCs (Dong and Roeder, 2000; Sym et al., 1993; Sym and Roeder, 1995). An immuno-em study using gold-labeled antibodies revealed that two Zip1 monomers interact to form a parallel homo-dimer or tetramer (Dong and Roeder, 2000). Several such dimers interact near their N-terminal regions at the SC central element, while the C- terminal regions interact with the chromosome/homolog axes. This process of Zip1 multimerization with other central region proteins continues until a full-length SC is built 9

20 along the entire interface of two closely aligned homologs. The distance spanned by the SC between the two axes of homologous chromosomes is ~100nm (Page and Hawley, 2004; Sym et al., 1993; Sym and Roeder, 1995; Tung and Roeder, 1998). Zip1 does not share much sequence similarity with transverse filament proteins in other organisms such as C(3)G in Drosophila melanogaster, Syp1 in C. elegans and SCP1 in Homo sapiens, except for the fact that all these transverse filament proteins contain coiled-coil domains (Page and Hawley, 2004). However, the overall structural architecture of the SC is highly conserved across species (von Wettstein et al., 1984). Recent studies have shown that the SC is a dynamic structure. SC accommodates continuous incorporation of new incoming Zip1 proteins, and interestingly, a steady-state SC grows continuously in size (Voelkel-Meiman et al., 2012). The SUMO (Small Ubiquitin like MOdifier) protein co-localizes with Zip1 within SC and is a component of the SC central region (Hooker and Roeder, 2006). Two new meiosis-specific proteins, Ecm11 and Gmc2, also were recently shown to be components of SC central region (Humphryes et al., 2013). Interestingly, both Ecm11 and Gmc2 proteins contain a very small, predicted coiled-coil domain (Humphryes et al., 2013). Moreover, SUMO, Ecm11 and Gmc2 have been identified as components of the central element structure of the budding yeast SC (Voelkel-Meiman et al., 2013). 10

21 A! B! Tttttttttttttttttttttttttttttttttttttttttttttt! Figure 2. The structure of the Synaptonemal Complex (SC). (A) Cartoon represents a cross-section of a portion of the budding yeast SC structure. The central region, which is composed of transverse filaments and a central element (CE), spans ~100nm and connects the two flanking parallel lateral elements (LE). Within the LEs, the cohesin or condensin proteins are represented as blue ovals and the other LE proteins (such as Red1 and Hop1) are represented as green ovals. The arrangement of two parallel homo-dimers of Zip1 (yellow and orange spiral rods) is shown at the bottom (Page and Hawley, 2004). (B) Electron microscopic image of Blaps cribrosa (beetle) SC. The longitudinal section showing a central element (CE), two flanking lateral elements (LE) and chromatin loops (ch) (Zickler and Kleckner, 1999). 11

22 C. Current model of the SC Based on our current understanding, the SC central region components, Ecm11 and Gmc2 form a stable complex and localize with SIC proteins at synapsis initiation sites (Zip2, Zip4 and Spo16) in parallel with Zip1. Together, this multiprotein ensemble favors SUMOylation of Ecm11, and the multimerization of Ecm11, Gmc2 and Zip1 along the interface of paired homologs (Humphryes et al., 2013; Voelkel-Meiman et al., 2013). SUMOylation of Ecm11 is required for stable SC formation, however SUMOylation is not required for Ecm11 incorporation into a precursor SC structure per se, suggesting that SUMOylation could be an event that occurs subsequent to the initial incorporation of Ecm11 into the SC structure (Humphryes et al., 2013; Voelkel-Meiman et al., 2013). While Ecm11 and Gmc2 likely interact with one another within the meiotic cell (based on their strong interaction in a yeast two-hybrid system) (Humphryes et al., 2013), which SC proteins Zip1 interfaces with at its N- or at its C-terminus are not yet known. 1.3 Polycomplex formation and its structural organization Polycomplexes are large aggregates of SC proteins formed within the meiotic nucleus and have been noticed in various different organisms (Goldstein, 1987). In many organisms including mammals, plants and budding yeast, initial processes of recombination are absolutely required for homolog pairing and SC assembly (Bhalla and Dernburg, 2008; Zickler and Kleckner, 1998; Zickler and Kleckner, 1999). Absence of homolog pairing or defects in synapsis in budding yeast results in SC protein aggregation into a polycomplex structure (Agarwal and Roeder, 2000; Chua and Roeder, 1998; Tsubouchi et al., 2006; Voelkel-Meiman et al., 2013). Polycomplexes are also observed 12

23 as a result of overproduction of SC proteins such as Zip1 (Sym and Roeder, 1995; Voelkel-Meiman et al., 2012). While SC is associated with condensed chromatin, polycomplexes are often located in chromatin-free regions of a surface-spread nucleus. Interestingly, SC central region proteins like SUMO, Ecm11 and Gmc2 also localize to polycomplex structures (Humphryes et al., 2013; Voelkel-Meiman et al., 2013), and in fact Zip1 polycomplex structures are dependent on Ecm11 and/or Gmc2 in recombination-deficient mutants (Humphryes et al., 2013). Moreover, the absence of Corona (a Drosophila SC central element protein) similarly abolishes polycomplex formation (Page et al., 2008), suggesting a relationship between SC central element components and polycomplex structures. Furthermore, SC initiation complex proteins such as Zip2, Zip3 and Zip4 are found associated within such polycomplexes (Agarwal and Roeder, 2000; Chua and Roeder, 1998; Tsubouchi et al., 2006). While the SC central region proteins are distributed uniformly throughout the polycomplex structures, the SICs exhibit unique localization patterns within polycomplexes. Zip2 and Zip4 are only located at the two polar ends of the polycomplex whereas Zip3 covers the entire polycomplex body together with localizing at the two polar ends (Agarwal and Roeder, 2000; Cheng et al., 2006; Chua and Roeder, 1998; Humphryes et al., 2013; Tsubouchi et al., 2006). Together, these observations suggest that proteins that are involved in SC initiation and/or polymerization might play separate functions or interact with separate domains of Zip1 within polycomplexes. However, very little is known about the overall structure and function of the polycomplex. Despite the differences between polycomplexes and SCs with respect to their morphology as well as their spatial distribution within a meiotic nucleus, both these 13

24 proteinaceous structures share a few commonalities. Zip1 is an integral part of both SCs and polycomplexes. Moreover, polycomplexes seem to have a tripartite structure similar to that of an SC. EM studies revealed that SC proteins within polycomplexes appear to be arranged in parallel structures, resembling the higher order organization of the SC. Interestingly, the distance between two such densely stained parallel lines has been recorded to be ~100nm, and usually a lightly stained central line is also visible between these parallel structures (Sym and Roeder, 1995). Moreover, an immuno-em structural analysis of a polycomplex using gold-labeled Zip1 domain-specific antibodies revealed that anti-zip1-n staining coincides with the central lightly stained regions (resembling a central element-like organization) while the anti-zip1-c staining coincides with the densely stained regions on either ends (resembling a pair of lateral element-like organization) (Dong and Roeder, 2000). Together, these structures resemble several stacks of SC unit lying parallel to each other. 1.4 Significance of Synaptonemal Complex The SC links recombination and initial pairing events with crossover formation and chromosome disjunction during meiosis. Loss of SC assembly results in unsynapsed but paired homologs, with intertwined axial cores at specific regions called the axial associations (Rockmill et al., 1995a; Rockmill et al., 1995b). The SC promotes a proper level and distribution of crossover recombination events (Page and Hawley, 2004). In mammals, worms and flies, deletion of SC proteins results in an absolute diminishment of crossover maturation (Zickler, 2006). Similarly, zip1 null mutants in budding yeast exhibit a dramatic reduction in crossover events (Sym et al., 1993). The SC is also 14

25 involved in maintaining proper crossover interference, a phenomenon that ensures that two independent crossover events are unlikely to be positioned immediately adjacent to each other (Sym and Roeder, 1994). 1.5 Significance of Polycomplex In recombination-deficient mutants, polycomplex failure can correlate with promiscuous SC assembly on unpaired chromosomes, suggesting the significance of polycomplex formation in preventing aberrant SC assembly (MacQueen and Roeder, 2009). Therefore, polycomplexes might be the storage hubs for SC proteins (when meiotic prophase events like recombination and/or synapsis are aberrant) that might eventually be incorporated into future SC structures. In such defective meiotic situations, SC proteins are still expressed in the meiotic cells but somehow fail to incorporate into SC initiation sites, or assemble as functional SCs. 1.6 Regulation of the Synaptonemal Complex and Polycomplex In many organisms, SC assembly is dependent on DSB formation and the early events of homolog pairing (Bhalla and Dernburg, 2008). Interestingly, SC assembles on unpaired or non-homologous chromosomes in certain genetic contexts (Loidl et al., 1991). In recent years we have focused on the question: How is pairing reinforcement (SC assembly) coordinated with homology recognition (Figure 3)? In search for negative regulators of SC/Zip1, a genetic screen was carried out using transposon mutagenesis approach in meiotic strains lacking Spo11 activity and containing a GFP-tagged version of Zip1 (MacQueen and Roeder, 2009). Two peptidyl-prolyl cis- 15

26 trans isomerases, Fpr3 and Rrd1 were identified as factors involved in Zip1 regulation in the absence of Spo11. Fpr3 belongs to the nuclear FKBP class of prolyl isomerases that usually binds immunosuppressive drugs like FK506 and rapamycin (Arevalo-Rodriguez et al., 2004). Rrd1 is a member of a completely different class of prolyl isomerases and shares no sequence homology with Fpr3 (Jordens et al., 2006). In pairing-defective mutants such as spo11, the absence of Fpr3 function reduces polycomplex formation and instead causes Zip1 to localize to the meiotic nucleoplasm (MacQueen and Roeder, 2009). The screen also revealed a role for a meiosis-specific E3 SUMO ligase, Zip3, in ensuring that SC assembly is linked to successful homolog pairing. spo11 meiotic mutants lacking both Fpr3 and Zip3 functions exhibit ectopic SC polymerization on unpaired chromosomes, suggesting the importance of negative regulators and perhaps polycomplex formation for ensuring proper SC assembly (MacQueen and Roeder, 2009). However, many aspects of the mechanisms by which Fpr3, Rrd1 and/or Zip3 regulate Zip1 localization within meiotic nuclei remain to be elucidated. 16

27 Unpaired Homologs! Spo11! (Recombination Initiation)! Paired Homologs! Zip2! Zip3! Zip4! SUMO! Ecm11! Gmc2! Signals / Regulators?! SC Assembly! Figure 3. How is SC assembly coordinated with homolog pairing? We are interested in understanding the signals or regulators that trigger SC assembly once homolog pairing has taken place. SC is built between paired homologs with the help of Synapsis Initiation Complex (SIC) proteins (such as Zip2, Zip3 and Zip4) and SC central region proteins (such as SUMO, Ecm11 and Gmc2), but in the absence of recombination initiation when the SICs and the SC component proteins are still present within the meiotic nucleus: What prevents SC assembly on unpaired chromosomes? 17

28 A. Proposed model on how Fpr3 and/or Rrd1 might regulate Zip1 s nuclear distribution Prolyl isomerases act on peptidyl-prolines to alter their cis-trans orientation and they usually function as protein-folding chaperones (Parsell and Lindquist, 1993). Interestingly, two negative regulators of Zip1 (Fpr3 and Rrd1) that came out of the genetic screen happen to be prolyl isomerase proteins. We therefore propose that probably Fpr3 and Rrd1 prolyl isomerases interact with Zip1 directly or through separate downstream effector proteins to catalyze Zip1 folding, and prevent Zip1 s transition from an inactive state (Zip1 within the nucleoplasmic pool or at the polycomplex) to an active state (Zip1 within SC that form at the interface of aligned homologs) (Figure 4). 18

29 In absence of recombination initiation and/or homolog pairing:! Fpr3! Rrd1!?! Inactive! Zip1! (Polycomplex! or nucleoplasmic)!! Active! Zip1! (Synaptonemal! Complex)! Figure 4. Proposed model on how Fpr3 and/or Rrd1 might regulate Zip1 s nuclear distribution in absence of recombination initiation and/or homolog pairing. In absence of recombination initiation and/or homolog pairing, Fpr3 and/or Rrd1 might directly or via downstream effector proteins act on Zip1, and prevent the transition of inactive form of Zip1 (that localizes to the nucleoplasm or that aggregates within the polycomplex structure) to the active form of Zip1 (that assembles SC between paired homologs). 19

30 1.7 Questions addressed in this study In order to understand the mechanisms involved in the regulation of SC at the molecular level, my project aims to characterize the key molecular regulators that are essential for the establishment of SC at the proper time and place. The primary aim of this study is to further explore the mechanisms of two different classes of prolyl isomerase proteins, Fpr3 and Rrd1, in regulating Zip1 s nuclear distribution and maintaining polycomplex architecture in recombination-deficient cells during budding yeast meiosis. To answer these, we investigated whether Fpr3 and Rrd1 proteins are acting together or in parallel to regulate Zip1 s capacity to form a polycomplex. We further studied the structure-function relationships of Fpr3 and Zip1 in the absence of recombination initiation, and we asked whether overexpression of Fpr3 interferes with Zip1 polymerization between paired homologs. We investigated whether Rrd1 activates catalytic phosphatase components such as Pph3 and/or Sit4 to regulate Zip1. Finally, we studied dependency relationships between proteins that co-aggregate within a polycomplex. 20

31 Chapter 2 Materials and Methods 21

32 2.1 Strains and plasmids construction All budding yeast strains used in this study are isogenic with BR1919-8B (Rockmill et al., 1995a) and their genotypes are listed in the strain table (Table S1). The plasmids constructed and/or used in this study are listed in the plasmid table (Table P1). The 5-3 sequences of forward and reverse primers used in this study (for standard gene amplification, diagnostic and sequencing PCRs) are listed in the primer table (Table P2) Cloning SIT4 into a 2-micron plasmid The SIT4 open reading frame (ORF) including the promoter sequence was inserted into a 2-micron plasmid (YEp351 containing a LEU2 marker) (Zakian et al., 1979). First, we amplified SIT4 ORF along with ~800bp of upstream and 150bp of downstream sequence from BR1919 genomic DNA via standard PCR. The primer pair, AJM494 and AJM495, used for PCR amplification contained restriction digestion sites for the HindIII restriction endonuclease. The PCR amplified product (insert) was purified using QIAquick PCR Purification Kit (Qiagen) and then digested, along with the YEp351 vector, using HindIII (New England Biolabs). The HindIII-treated insert was again purified. Linearized vector was gel purified and then treated with calf intestinal phosphatase (CIP). After CIP treatment, the vector was purified again using the QIAquick PCR Purification Kit. Insert and vector were then ligated using T4 DNA ligase (New England Biolabs) at 15 C for overnight (16 hours) and the ligation product was transformed into XL1-Blue competent cells and plated onto LB-Amp plates. A few bacterial colonies from LB-Amp plates were randomly selected, plasmid DNA was isolated using Miniprep Kit (Qiagen) and analyzed via double restriction digestion with 22

33 AgeI and NcoI, which generated a 2095bp and 5484bp DNA fragments (as expected). This recombinant, multi-copy plasmid containing the SIT4 sequence (7579 base pairs) was named as ppm2 (BAM119) Construction of yeast two-hybrid Gal4 fusion plasmids via gap-repair in budding yeast A. Primary and secondary PCR The primary and secondary PCR primers used in the construction of yeast two-hybrid Gal4 fusion plasmids are mentioned in Table P1 and Table P2, and the fusion clones generated are mentioned in Table P1. The primary set of primers used for PCR is different for each Gal4-activation domain (AD) and Gal4-DNA binding domain (DBD) fusion constructed whereas the secondary primer set used for re-pcr remains the same for all fusion plasmids. The flanking homologous sequence in the re-pcr products containing full-length and truncated versions of a gene ORF targets these sequences to the C-terminus of Gal4-AD or Gal4-DBD present within poad or pobd2 plasmids respectively (James et al., 1996). B. Co-transformation of PCR amplified insert and linearized vector PJ69-4a and PJ69-4α strains (James et al., 1996) were transformed with poad and pobd2 plasmids as described in (James et al., 1996), with the following modifications. MATa cells containing Gal4-AD fusions [AD (a)] was plated on SC-Leu while MATα cells containing Gal4-BD fusions [BD (α)] was plated on SC-Trp and incubated at 30 C for 2-3 days. Colony number was recorded; at least 5 colonies were picked from each 23

34 transformation plates and streaked onto either SC-Leu [AD (a)] or SC-Trp [BD (α)] plates. Recombinant plasmid DNA was isolated from yeast cells via a standard yeast miniprep protocol (Sherman et al., 1986). Isolated plasmid was then transformed into XL1-Blue bacterial cells. Plasmid DNA was again isolated from bacterial cells and run on a 0.8% agarose gel for visualization of gel mobility shift of recombinant plasmids compared to an original empty plasmid. The concentration of the Gal4-AD or Gal4-BD chimera was measured using a NanoDrop (Thermo Scientific). Recombinant (Gal4-AD and Gal4-BD) plasmid DNA samples for sequencing were prepared in 200μL PCR tubes by adding 1μL 5μM of specific sequencing primer (refer primer table) and ~675ng poad (8.2Kb) or ~592ng pobd2 (7.1Kb) plasmid DNA in dh 2 O such that the total volume of the sequencing reaction remained 12μL (DNA Analysis Facility on Science Hill at Yale University) Genetic manipulations in budding yeast A. Constructing Sit4-knockout strain A Sit4-knockout strain was constructed by standard methods (Sherman et al., 1986) in which kanmx4 or hphmx4 dominant drug resistance (DDR) cassettes replaced the two endogenous SIT4 ORFs (Longtine et al., 1998). The AM1000 and AM1001 primer pairs were used to PCR amplify kanmx4 (G418) or hphmx4 (hygromycin B) from pfa6akanmx4 or pag32 plasmid respectively (Goldstein and McCusker, 1999). The diagnostic primer pairs, AM1002 and AM1003, were used to screen and confirm positive yeast transformants. As published earlier (Sutton et al., 1991), we noticed that the haploid sit4δ strains 24

35 were extremely slow growing on YEPADU plates owing to Sit4 s role in facilitating late G1 to S phase progression of budding yeast cells. Intriguingly, we found that the haploid sit4::kanmx4 and sit4::hphmx4 strains show robust growth on YEPADU plates containing selective marker G418 and hygromycin B respectively. However, the reason for such a phenotype is unclear. Moreover, unfortunately we noticed that such haploid sit4δ strains exhibit mating incapability among themselves. Therefore, in order to overcome the mating incapability of sit4δ strains, we transformed the MATa and MATα sit4δ haploid strains with the 2-micron plasmid containing the SIT4 sequence (mentioned earlier). We constructed the corresponding diploid strains homozygous for SIT4-deletion using standard crossing technique. We then selected for diploid strains that have lost the multi-copy plasmid via screening of single colonies on rich media that exhibited slow growth and loss of selective (LEU2) marker. B. Constructing Fpr3-, Rrd1-MYC- and Pph3-MYC-overexpression strains For the generation of the Fpr3-overexpression strain, we first amplified TRP1-P GAL1 from the pfa6a-trp1-pgal1 (BAM103) plasmid using AJM776 and AJM777 primers such that it contains 50 base pairs of flanking homology to sequence upstream of FPR3 ORF (from the start codon ATG) and downstream of FPR3 ORF (from and including the start codon ATG) (Longtine et al., 1998). Via standard yeast transformation technique, the PCR amplified cassette was then inserted upstream of the wild-type FPR3 gene copy in a haploid MATa yeast cell. A diagnostic colony PCR using typing primers AJM203 and AJM204 was then performed for the screening and validation of positive yeast transformants on SC-Trp plates. Second, pkb80 or BAM102 (ura3::p GPD1 - GAL4(848).ER::URA3) plasmid containing the Gal4-estrogen receptor (Gal4-ER) 25

36 chimera was linearized using ApaI. Next, via a subsequent yeast transformation this linearized fragment was inserted into TRP1-P GAL1 [FPR3]/+ haploid MATα yeast strains at the endogenous ura3 locus and selected on SC-Ura plates. The two haploid MATa and MATα yeast cells were then crossed and zygotes were pulled to obtain the final diploid strain [courtesy of Adam Ilowite and Alexander Iwamoto (MB&B 294) for their contribution in generating the Fpr3-overexpression strain]. An analogous approach was taken to generate Rrd1-MYC- and Pph3-MYCoverexpression strains. TRP1-P GAL1 cassette from pfa6a-trp1-pgal1 plasmid was PCR amplified using AJM778 and AJM779 primers (for Rrd1-MYC) and AJM886 and AJM887 primers (for Pph3-MYC). A diagnostic colony PCR using typing primers AJM207 and AJM208 (for TRP1-P GAL1 [RRD1-MYC]/+) and AJM3002 and AJM888 primers (for TRP1-P GAL1 [PPH3-MYC]/+) was then performed for the screening and validation of positive yeast transformants [courtesy of Lisle A. Winston and Pik Yee Yuen (MB&B 294) for their contribution in generating the Pph3-MYC-overexpression strain]. The GAL1-promoter drives robust gene expression when bound by Gal4 transcription factor. Gal4 is fused to a domain of the estrogen receptor (ER), which sequesters the Gal4-ER protein in the cytoplasm. β-estradiol binds to the ER domain of Gal4-ER and facilitates its translocation from the cytoplasm to the nucleus (Benjamin et al., 2003). We assessed Fpr3- and Pph3-MYC-overexpression on a Western blot using anti-fpr3 and anti-c-myc antibodies respectively for the detection of increased Fpr3 or Pph3-MYC protein levels in the induced (I) strains compared to the uninduced (UI) counterparts. However, Rrd1-MYC-overexpression has not yet been tested on a Western blot. 26

37 C. Epitope-tagging of Rrd1, Pph3 and Sit4 Using standard PCR tagging and yeast transformation technique, we engineered diploid strains in which one copy of RRD1 or PPH3 was C-terminally tagged with a MYC epitope. We used primers AJM508 and AJM509 for Rrd1, and AJM866 and AJM867 for Pph3 to amplify 9Myc-hphMX4 from pym20 plasmid (for Rrd1) and 13Myc-kanMX6 from pfa6a-13myc-kanmx6 plasmid (for Pph3) (Bahler et al., 1998; Janke et al., 2004). Each amplified cassette was targeted to the C-terminus of RRD1 or PPH3 in a diploid yeast cell. A colony PCR using diagnostic primers AJM510 and AJM705 (for RRD1-MYC) and AJM3002 and AJM3003 (for PPH3-MYC) was then employed for the confirmation of positive yeast transformants. The final Spo11-deficient diploid strain, in which both copies of RRD1 or PPH3 contained the C-terminal MYCepitope tag, was obtained via mating of the appropriate haploid strains. To investigate the localization of Sit4 in meiotic cells, we constructed a wild-type diploid strain in which one copy of SIT4 was tagged with YFP (Yellow Fluorescent Protein) at the N-terminus (such that the YFP-Sit4 expression will be driven by SIT4 s endogenous promoter) (Prein et al., 2000). Primers AM1004 and AM1005 were used to amplify kanmx4-yfp from pdh22 (BAM108) plasmid (Prein et al., 2000). A colony PCR using diagnostic primers AJM300 and AM1008 (for YFP-SIT4) was carried out for the confirmation of positive yeast transformants. D. Generation of Sit4- and SUMO-diminished strains In order to generate SUMO- and Sit4-diminished strains, one copy of the SMT3 or SIT4 gene ORF was placed under the control of a vegetative specific promoter (P SCC1 ) and 27

38 the other copy was replaced with a dominant drug resistance (DDR) cassette (kanmx4 or hphmx4). The kanmx4-p SCC1 cassette was PCR amplified from pfa66-kanmx4 plasmid (4035) using AM1006 and AM1007 primers. A diagnostic colony PCR using typing primers AM300 and AJM1008 was performed for the confirmation of positive yeast transformants. Next, this haploid kanmx4-p SCC1 [SIT4] strain was crossed with a sit4::kanmx4 or sit4::hphmx4 haploid strain of opposite mating type to produce a final Sit4-diminished diploid strain. We need to assess Sit4-diminishment on a Western blot using anti-sit4 antibody staining for the detection of Sit4 protein levels. Generation of SUMO-diminished strain is described in (Voelkel-Meiman et al., 2013). E. Generation of strains harboring an fpr3 mutant allele The shuttle mutagenesis p325 (pic19, 5Kb) vectors [AHp197, AHp198, AHp199, AHp200, and AHp201 (generously provided by Andreas Hochwagen, NYU)], each containing an unique missense mutation in the C-terminus of the FPR3 ORF, were restriction-digested with EcoRI enzyme to release the region containing fpr3 mutant allele marked with URA3 for targeting to the endogenous FPR3 locus (Hochwagen et al., 2005). SC-Ura plates were used for the selection of transformants. A colony PCR using primers AJM203 and AJM204 was performed to amplify FPR3 ORF from yeast transformants growing on SC-Ura. The PCR amplified product was then purified using the QIAquick PCR Purification Kit (Qiagen). PCR samples were sequenced at the DNA Analysis Facility on Science Hill at Yale University. 28

39 2.2 Surface chromosome-spreads of meiotic cells Overnight diploid cell cultures were grown in 2mL or 10mL YEPADU liquid media for hours (until early stationary phase) at 30 C. Cells were washed in equal volumes of deionized water before re-suspension into sporulation media. Cells were sporulated in 2% potassium acetate (KAc) (four times the volume of rich medium) for various time durations at 30 C. For culturing diploid strains containing SIT4 into a 2-micron plasmid for chromosome-spreads, a dense load of yeast colonies that had been growing on SC-Leu plates were inoculated into 2mL of liquid YEPADU medium and grown for a shorter time-period (8-10 hours) to reduce the probability of plasmid-loss. Saturated cell cultures were then washed in dh 2 O, re-suspended into a sporulation medium and sporulated for 16 hours at 30 C. Chromosome-spreads were performed as described in (Rockmill, 2009) with the following modifications: At a particular time-point, 5mL of sporulating cell culture was collected for chromosome-spreads. Cell pellets were thoroughly re-suspended in 530μL of spheroplasting solution (Rockmill, 2009) and incubated at 30 C for minutes on a roller drum. Spheroplasting was stopped by the addition of 2mL of ice-cold 1X MES- 1M Sorbitol. 80μL of ice-cold 1X MES solution was added to each spheroplasted sample (one at a time) placed on ice, and briefly agitated on a vortex. Immediately then, 200μL of ice-cold 4% w/v Paraformaldehyde (ph-8.2) solution was added, and mixed gently by tapping on the side of the tube. 80μL of the slurry was then dispensed onto a pre-cleaned frosted glass slide (Fisher Scientific) and gentle mechanical pressure was applied in order 29

40 to evenly spread the slurry (containing meiotic nuclei) along the entire length of the slide with the help of the edge of a 24x50mm glass coverslip. Slides were then allowed to dry (~50%) at room temperature for 5-10 minutes and washed thoroughly with 5-10mL of 4% v/v Kodak Professional Photo-Flo 200 solution. Slides were then placed vertically on a steel test-tube rack for minutes until completely dried, placed inside a black slide box and stored at -20 C. 2.3 Preparation of chromosome spreads for fluorescence microscopy Primary and secondary antibodies were diluted in equal volumes of FBS and 5% BSA (Sigma-Aldrich) in 1X PBS to obtain the final concentrations recommended by the manufacturer. Diluted antibody solution was dispensed as a droplet on top of a 24x50mm glass coverslip, and the coverslip was then placed up side down on the surface of a surface-spread slide. Incubation of surface-spread slides stained with primary and secondary antibodies was performed in a closed, airtight 10 x7 x2 plastic chamber (IKEA 365+) containing a wet paper towel at the bottom, and slides were placed on a plastic PCR rack in order to prevent any physical contact between the damp paper towel and the antibody-stained slides. Primary antibody-stained, chromosome-spread slides were incubated for 16 hours at room temperature (dark) while the secondary antibodystained slides were incubated for 1-2 hours at room temperature (dark). After primary and secondary antibody staining, antibody-stained slides were then washed three times in 1X PBS (for 1L 1X PBS solution: 8 grams NaCl, 0.2 grams KCl, 1.44 grams Na 2 HPO 4, and 0.24 grams KH 2 PO 4 were added and autoclaved), 5 minutes for each wash in a glass Coplin jar placed on an orbital shaker. 24μL of mount containing DNA-binding dye, 4-6-diamidino-2-phenylindole (DAPI) (90% v/v glycerol, 10% v/v PBS, 1mg/mL p- 30

41 phenylenediamine, 10ng/μL DAPI) was applied onto the surface of a 24x50mm glass coverslip, the coverslip was inverted and placed on an antibody-treated slide. Slides were then incubated for at least 10 minutes at room temperature in the dark for allowing uniform distribution of the mount-dapi solution. Slides with coverslips were then placed (up-side-down) on a Kim-wipe bed and pressed gently with fingertips to remove excess mount-dapi solution. Slides could be used immediately for microscopy or could be stored at -20 C for later use. Most of the primary antibodies such as rabbit polyclonal anti-zip1, rabbit polyclonal anti-red1, mouse polyclonal anti-hop1 (all three are generous gifts of Shirleen Roeder), chicken monoclonal anti-gfp (Abcam), mouse monoclonal anti-ha.11 (San-Segundo and Roeder, 2000) were used at 1:100 dilutions whereas guinea-pig polyclonal anti-smt3 (Hooker and Roeder, 2006) and mouse monoclonal anti-c-myc [9E10.3 (Invitrogen) or 9E10 (Abcam)] were used at 1:200 dilutions, and rabbit polyclonal anti-fpr3 (a kind gift of Jeremy Thorner) was used at 1:1000 dilution. All secondary antibodies such as anti-fitc/af488, anti-cy3/af594 and anti- Cy5/AF647 (Jackson ImmunoResearch) were used at 1:200 dilutions. 2.4 Fpr3 induction using β-estradiol Sporulating cultures containing FPR3 under the control of a β-estradiol-inducible GAL1 promoter and the Gal4-ER chimeric protein were split into two equal halves before induction. To one half of the culture, 8μL of 5mM β-estradiol was added per 40mL of sporulating culture such that the final concentration of β-estradiol is 1μM [5mM β- estradiol (Sigma-Aldrich E2257) was prepared by re-suspending 1mg of β-estradiol 31

42 ( grams/mole) thoroughly in 734.2μL of ethanol]. The other half of the sporulating culture was treated as an uninduced control; to these control 40mL cultures, 8μL of 95% ethanol was added. 2.5 Fluorescence imaging A DeltaVision personal DV system (Applied Precision) adapted to an Olympus (IX71) microscope was employed for acquiring fluorescence-imaging data. Several z-stack images (usually seven, each 0.2 micron thick) were acquired using DeltaVision SoftWorx software. The best two-three z-stacks were chosen for each given channel (such as DAPI/FITC/TRITC/Cy5) and projected using the SoftWorx Volume Viewer tool to get the final representative image for a figure. For measurements of maximum fluorescence intensity of Zip1 polycomplex, experimental surface-spread slides containing specific fluorophore labeling of Zip1 were imaged with constant exposure times (0.1s) normalized for Cy3 fluorescent channel. Seven nuclear sections were taken where each section is 0.2 micron apart. The best z- section with the highest intensity was selected for analysis. Region of interest (ROI) box (4 4 pixels; 1 pixel = μm) was placed at the center of the Zip1 polycomplex for every nucleus analyzed. For experiments that did not involve fluorescence-intensity measurements, optimal exposure times for each fluorescent channel were detected via the SoftWorx Find Exposure tool. For the measurement of total area of Zip1 and Fpr3 polycomplexes (in square microns), the distances of the long axis (in microns) and the short axis (in microns) were calculated using the SoftWorx Measure Distance tool. Then, both the 32

43 long axis and the short axis values were multiplied to obtain the total area of each polycomplex. 2.6 Isolation of total yeast protein via Trichloroacetic acid (TCA) preparation 5mL of a sporulating cell culture at a particular time-point (depending on the experiment) was collected in a 15mL round-bottom Falcon tube and centrifuged at 1800 rpm. Most of the supernatant was discarded and the cell pellet was re-suspended in the leftover supernatant and transferred to a clean 1.5mL eppendorf tube. The cell suspension was then centrifuged at room temperature at 13,200 rpm. The cell pellet was washed with 400μL of ice-cold 20% Trichloroacetic acid (TCA) solution, centrifuged at 15,000 at 4 C and the supernatant was discarded. Cell pellets were re-suspended in 200μL of ice-cold 20% TCA and ice-cold BioSpec glass beads (0.5mm in diameter) were added to make up the volume to 500μL. Cell-bead mixtures were vortexed for 10 minutes at 4 C. Two holes were created on the eppendorf tube with a red-hot hypodermic needle (20 ga x 1 1/2"), one on the top and the other at the bottom of the tube. The tube containing holes was placed inside another 1.5mL eppendorf and spun at 1000 rpm for 1 minute at 4 C. The flow-through was collected (while the beads containing cell debris were discarded) and re-suspended with 500μL of ice-cold 5% TCA and incubated on ice for 25 minutes. Total protein extract was then centrifuged at 15,000 rpm for 10 minutes at 4 C. Next, the protein extract was washed twice with 300μL of ice-cold 100% Acetone to remove the residual TCA, then centrifuged for 5 minutes at 15,000 rpm. Finally, total protein extract was dried for at least 3 hours at 4 C. Dried protein extract were weighed and either used immediately or stored at -80 C for later use. 33

44 2.7 Western blot analysis A. Sample preparation TCA-precipitated samples were re-suspended thoroughly in 2X Laemmli sample buffer containing 30mM dithiothreitol (DTT) and heated at 65 C for 10 minutes. The volume of the sample buffer added depends on the weight of the total protein extract for each sample to ensure equal protein concentration among all samples (i.e., 10-20μg/μL). B. Western blot Samples were centrifuged at 13,200 rpm for 5 minutes and a volume from the supernatant was carefully loaded onto a gel. Western blots were carried out using 8-10% (10-15-wells) Tris/Glycine SDS-Polyacrylamide Gels (Sambrook et al., 1989) and run at 100V at room temperature for 1 hour 45 minutes using 1X Tris/Glycine/SDS buffer (for 1L 5X Tris/Glycine/SDS buffer: 15.1 grams Tris base, 94 grams glycine, and 50mL 10% SDS solution were added; the volume was brought up to 1L with dh 2 O) μg of total protein was loaded per lane. Proteins in the gel were transferred onto a Whatman Protran nitrocellulose blotting membrane (pore size 0.2 or 0.45 micron) at 4 C in the cold room for 2-3 hours using 1X Towbin buffer (BioRad) (for 1L 1X Towbin buffer: 3.03 grams Tris base, 14.4 grams glycine and 200mL methanol were added; the volume was brought up to 1L with dh 2 O). After the completion of protein transfer, the membrane was subjected to 5mL of Ponceau S staining solution [for 300mL Ponceau S solution: 3mL glacial acetic acid and 0.33 grams Ponceau S (Sigma-Aldrich) were added, and the volume was brought up to 300mL with dh 2 O] and stained for 5 minutes on a rocker. The membrane was then 34

45 washed gently in equal volumes of dh 2 O for 1 minute and scanned using an Epson scanner for visualization of total proteins. Next, the membrane was submerged in 5mL of blocking buffer for 30 minutes and shaken gently on a rocker [for 50mL blocking buffer: 5mL 10X Tris-buffered saline with Tween-20 (TTBS), 2.5 grams of non-fat dry milk, 1 gram of bovine serum albumin (BSA), and 1mL gelatin from cold water fish skin were added; the volume was brought up to 50mL with dh 2 O]. The blocked membrane was then subjected to subsequent primary and secondary antibody staining. All primary antibodies were diluted in 3-5mL blocking buffer to obtain the recommended antibody dilutions suggested in the user s manual. Membranes bathed in diluted primary antibody solution (in a 50mL falcon tube) were incubated with rocking overnight at 4 C. Primary antibodies such as rabbit polyclonal anti-zip1, rabbit anti-red1 and chicken monoclonal anti-gfp (Abcam) were used at 1:2,000 dilutions whereas rabbit anti-zip1-s75-p (a kind gift of Andreas Hochwagen), rat anti-tubulin (Santa Cruz Biotechnology) and rabbit polyclonal anti-fpr3-c were used at 1:500, 1:10,000 and 1:100,000 dilutions respectively. All horseradish peroxide (HRP) conjugated secondary antibodies were diluted in 3-5mL 1X TTBS while all alkaline phosphatase (AP) conjugated secondary antibodies were diluted in 3-5mL blocking buffer to obtain the antibody dilutions as recommended in the user s manual (Jackson ImmunoResearch). Membranes bathed in diluted secondary antibody solution were incubated with rocking for 1 hour at room temperature. The secondary antibodies such as donkey anti-rabbit HRP, goat anti-rat HRP and goat anti- 35

46 chicken HRP were used at 1:2000 dilutions. The secondary antibodies such as goat antirabbit AP, goat anti-rat AP and mouse anti-c-myc AP were also used at 1:2000 dilutions. The membrane was washed in 3-5mL 1X TTBS (for 1L 10X TTBS solution [ph-7.5]: 24.2 grams Tris base, grams NaCl, 0.2 grams NaN3 and 5mL Tween-20 were added; the volume was brought up to 1L with dh 2 O) four times over 10 minutes, after primary and secondary antibody staining. Washed membranes were developed using Amersham TM ECL TM Prime Western Blotting Detection Reagent kit as described by the manufacturer (GE Healthcare Life Sciences) and imaged in Syngene imager equipped with a CCD camera for the visualization of HRP signal via chemiluminescence. Bands were quantified using the GeneSnap tool as described in (Voelkel-Meiman et al., 2013). Quantified bands per lane for Zip1-GFP, Red1 or Fpr3 proteins were normalized against Tubulin (used as a loading control) for that given lane. On the other hand, for the detection of AP signal washed membrane was developed using NBT/BCIP solution as described by the manufacturer (Roche) that results in the formation of a chromogenic substrate. 2.8 Yeast two-hybrid assay Diploid yeast strains carrying the HIS3 gene under the control of a GAL1 promoter along with both poad and pobd2 clone derivatives marked with LEU2 and TRP1 respectively, were generated via mating of appropriate haploids and selection on SC-Leu- Trp double dropout media (for 500mL: 0.85 grams of yeast nitrogen base without amino acids and ammonium sulfate, 2.5 grams ammonium sulfate, 10 grams dextrose, 0.32 grams complete supplement mixture minus leucine and tryptophan and 10 grams agar 36

47 were added, and the volume was brought up to 500mL with dh 2 O). Then, a growth (spotting) assay was performed on SC-Leu-Trp-His triple dropout plates (for 500mL: 0.85 grams of yeast nitrogen base without amino acids and ammonium sulfate, 2.5 grams ammonium sulfate, 10 grams dextrose, 0.31 grams complete supplement mixture minus histidine, leucine and tryptophan and 10 grams agar were added, and the volume was brought up to 500mL with dh 2 O) to monitor interactions between any two given Gal4- fusions. Growth assay: A small clump of cells from each yeast two-hybrid strain was inoculated in 0.5mL liquid YEPADU and overnight cultures were grown for 12 hours at 30 C. Next, six serial dilutions (1, 1/10, 1/100, 1/1000, 1/10,000 and 1/100,000) with distilled H 2 O were prepared for each overnight culture on a 96-well plate. For example, 200μL of saturated overnight culture was directly dispensed into the first well, and every time from then onwards 20μL of cell suspension from the previous well was mixed to 180μL of dh 2 O in the adjacent well along the same row until 10-5 serial dilution was achieved. A heat sterilized, 48-pin frogger (Holmes lab) was used to print the serial dilutions onto SC-Leu-Trp-His (triple dropout) and SC-Leu-Trp (double dropout) plates. Plates were then dried briefly, and incubated at 30 C for 2-3 days before acquiring images of colony growth. 2.9 Spore viability Diploid strains were sporulated on either solid sporulation media (0.2% yeast extract, 0.1% dextrose, 2% KAc, 0.1% complete amino acid mix, 1.5% agar) for 5 days or liquid sporulation media (2% KAc [ph-6-6.5]) for 47 hours (for the Fpr3-induction 37

48 experiments). Cells were treated with glusulase solution (1:10 dilutions) for 15 minutes and laid onto middle of a YEPADU plate. Tetrads were dissected using a dissection scope and plates containing tetrads were incubated at 30 C for 2-3 days. Spore viability (%) was calculated by using the following formula: [{Total number of: (4sv 4) + (3sv 3) + (2sv 2) + (1sv 1) + (0sv 0)} 100] Total number of asci/tetrads dissected Sporulation efficiency Monads, dyads, triads/tetrads were counted using a colony counter and a haemocytometer under a light microscope. Sporulation efficiency (%) was calculated using the following formula: [{Total number of: (dyads + triads/tetrads)} 100] Total number of cells counted Data analysis and statistical significance Excel 2007 was used for generation of spore viability tables. GraphPad Prism 6 software was used for the generation of bar graphs, stacked column graphs, linear graphs, scatter plots and also for putting error bars on the bar/linear graphs based on the standard deviation of the mean. Fisher s exact test (two-tailed) and Unpaired t test with Welch s correction (two-tailed) was used for measuring statistical significance values. 38

49 Table P1. Yeast two-hybrid Gal4-AD and Gal4-DBD fusion plasmids constructed and/or used in this study Plasmid name Fusion protein Description Primers Strain number Sequencing primers ppm277-6 Fpr3-AD (FL) Full-length 572, 553; 922, 923 YAM , 585 ppm287-1 Fpr3-BD (FL) Full-length 572, 553; 922, 923 YAM , 583 ppm268-2 Fpr3-N AD N-terminal half containing nucleolar localization signal ppm270-1 Fpr3-N BD N-terminal half containing nucleolar localization signal 914, 915; 922, 923 YAM , , 915; 922, 923 YAM , 583 ppm298-2 Fpr3-C AD C-terminal half containing prolyl isomerase domain 916, 917; 922, 923 YAM , 585 ppm283-1 Fpr3-C BD C-terminal half containing prolyl isomerase domain 916, 917; 922, 923 YAM , 583 ppm296-5 Zip1-AD (FL) Full-length 525, 573; 922, 923 YAM , 585, 543, 545, 548 ppm Zip1-BD (FL) Full-length 525, 573; 922, 923 YAM , 583, 543, 545, 548 ppm299-3 Zip1-N N-terminal domain 990, 991; 922, 923 YAM , 585 AD ppm284-1 Zip1-N BD N-terminal domain 990, 991; 922, 923 YAM , 583 ppm509-1 Zip1-N AD N-terminal domain with a portion of the coiled-coil ppm506-2 Zip1-N BD N-terminal domain with a portion of the coiled-coil ppm273-1 Zip1-C AD C-terminal domain with a portion of the coiled-coil ppm281-2 Zip1-C BD C-terminal domain with a portion of the coiled-coil 1081, 1082; 922, 923 YAM , , 1082; 922, YAM , , 526; 922, 923 YAM , , 526; 922, 923 YAM , 583 ppm508-2 Zip1-C AD C-terminal domain containing SUMO Interacting Motif (SIM) 1079, 1080; 922, 923 YAM , 585 ppm507-3 Zip1-C BD C-terminal domain containing SUMO Interacting Motif (SIM) 1079, 1080; 922, 923 YAM , 583 ppm272-1 Rrd1-AD (FL) Full-length 576, 556; 922, 923 YAM , 585 ppm279-1 Rrd1-BD (FL) Full-length 576, 556; 922, 923 YAM , 583 ppm335-1 Pph3-AD (FL) Full-length 926, 927; 922, 923 YAM ,

50 ppm340-5 Pph3-BD (FL) Full-length 926, 927; 922, 923 YAM , 583 ppm267-6 Zip3-AD (FL) Full-length 575, 527; 922, 923 YAM , 585 ppm269-1 Zip3-BD (FL) Full-length 575, 527; 922, 923 YAM , 583 ppm276-1 Smt3-AD (FL) Full-length 574, 577; 922, 923 YAM , 585 ppm285-2 Smt3-BD (FL) Full-length 574, 577; 922, 923 YAM , 583 ppm Sit4-AD (FL) Full-length 928, 929; 922, 923 YAM , 585 ppm Sit4-BD (FL) Full-length 928, 929; 922, 923 YAM , 583 ppm337-1 Ecm11-AD (FL) Full-length 1050, 1051; 922, ppm342-1 Ecm11-BD (FL) Full-length 1050, 1051; 922, 923 ppm Gmc2-AD (FL) Full-length plus intron 1052, 1053; 922, YAM , 585 YAM , 583 YAM , 585 ppm Gmc2-BD (FL) Full-length plus intron 1052, 1053; 922, YAM , ppm300-1 Zip2-AD (FL) Full-length 587, 529; 922, 923 YAM , 585 ppm292-4 Zip2-BD (FL) Full-length 587, 529; 922, 923 YAM , 583 ppm297-2 Zip4-AD (FL) Full-length plus intron 588, 531; 922, 923 YAM , 585, 1181, ppm Zip4-BD (FL) Full-length plus intron 588, 531; 922, 923 YAM , 583, 1181, 1182 ppm334-2 Red1-AD (FL) Full-length 924, 925; 922, 923 YAM , 585, 1180 ppm Red1-BD (FL) Full-length 924, 925; 922, 923 YAM , 583, ppm ppm Zip1 (K.l)-AD (FL) Zip1 (K.l)-BD (FL) Full-length 918, 919; 922, 923 YAM , 585, 869 Full-length 918, 919; 922, 923 YAM , 583, 869 ppm303-2 Zip1-C (K.l)-AD C-terminal domain 920, 919; 922, 923 YAM , 585 ppm Zip1-C (K.l)-BD C-terminal domain 920, 919; 922, 923 YAM , 583 ppm Zip1-C (K.l)-AD C-terminal domain with a portion of the coiled-coil 921, 919; 922, 923 YAM , 585 ppm307-4 Zip1-C (K.l)-BD C-terminal domain with a portion of the coiled-coil 921, 919; 922, 923 YAM ,

51 Table P2. Primers used in this study Name AJM203 AJM204 AJM207 AJM208 AJM300 AJM494 AJM495 AJM508 AJM509 AJM510 AJM705 AJM776 AJM777 AJM778 AJM779 AJM866 AJM867 AJM886 AJM887 AJM888 Sequence 5 AGCCTACTAACACGTTTCTATATAATAC3 5 AGAATGTTTTCGGATTTACATACAGAAGG3 5 AAGAACGCACATATGAACAAGC3 5 TTCCACTTCTTTGTTTATTTGTATTACCGCTTCC3 5 TTGGACGAGTCGGAATCGCAGACCG3 5 ATGATAAGCTTTGCTCGTGTAAGTGTCGGCCCGG3 5 AGATTAAGCTTTTGTGTATCGTATCGTAGCAAATGGCG3 5 AAACCAGTCGCACCGGAACCAGACTTCTTTTTCAAGAGATAGACTACGTAG ACGTACGCTGCAGGTCGAC3 5 AAATAGAAGTCATAATGCTTGTCATACACATTTATATGTTTAATTAATATTA ATCGATGAATTCGAGCTCG3 5 TCGTCTCAATGGCAGCTGCTTGATGCGC3 5 AACTTCTCGACAGACGTCGCGG3 5 TTGTGTGAAAGTTCATACATAATTGAAAGCAAGCATCCAACCAGCCCAATG AATTCGAGCTCGTTTAAAC3 5 TAAGGTTCAACATTCAAACTGTAGGTAGCTAGTGGTAACAAATCAGACATT TTGAGATCCGGGTTTT3 5 TGCAAAGTGCAAAAGAACGCACATATGAACAAGCATTAAACGAGCAAAGA AGAATTCGAGCTCGTTTAAAC3 5 ACCGGCGTAGAGAAGGTGGCGTGCGGCCAATCTACACGATCCAGAGACAT TTTGAGATCCGGGTTTT3 5 TCGGAAATGCTATAATTCCAACCAAAAAATCTCAAATGGACTATTTCTTAC GGATCCCCGGGTTAATTAA3 5 AGAAAAAAAGAAAAATGCACTTGACAATTAGAGTGCCTGTTAAAAATTTA AATTCGAGCTCGTTTAAAC3 5 TAGCAAGTAAAACAGCACGAAAAAAGTGATTACAAATTTCAAGGGAGATG AATTCGAGCTCGTTTAAAC3 5 ATATGTTTTCCGTCTCTCAGTGATGCTATAATCTTATCTAAGTCCATCATTTT GAGATCCGGGTTTT3 5 TTTCTTCAGGAATATGTTTTCCG3 41

52 42 AM TGAAATACTATTGAAGCTCAAAAACATCCATAATAAAAGGAACAATAACA ATCGATGAATTCGAGCTCG3 AM ATTGTGAAAATTATTTTTATTCGTCGAGTTAGGGAGGGCATGCCGTCGTGA TCGATGAATTCGAGCTCG3 AM TTCTTCAGTCCCCTCCTCGC3 AM GAGTTAGGGAGGGCATGCCG3 AM TTAGATTCGACATTACAAGGTGAAATACTATTGAAGCTCAAAAACATCCAT AATAAAAGGAACAATAACACGGCCGCCAGGGG3 AM TTCAGTTAGCGCCTGGCATTTCTTTATTGTTTCAAGCCATTCGTCGGGGCCT CTAGATACCATTTTGTACAATTCATCCATACCATGGG3 AM TGAAATACTATTGAAGCTCAAAAACATCCATAATAAAAGGAACAATAACA CGTACGCTGCAGGTCGAC3 AM TGGCATTTCTTTATTGTTTCAAGCCATTCGTCGGGGCCTCTAGATACCATGT CGTGTTTCTTGTAAAGTAATTG3 AM AACGGGGGTCTGTACCGGCTGG3 AJM TAGTCACACGCTAGTCCACG3 AJM TAGCTGGGTATATATTAGTATTCAAAAGCC3 AJM570 5 ATGATGAAGATACCCCACCAAACCC3 AJM571 5 TTCATAGATCTCTGCAGGTCGACGG3 AJM582 5 AAGGTCTCCGCTGACTAGGGC3 AJM583 5 ATGCACAGTTGAAGTGAACTTGCGGG3 AJM584 5 AACGCGTTTGGAATCACTACAGGG3 AJM585 5 TTGAGATGGTGCACGATGC3 AJM543 5 AGAGCTACAAAAGCAGCAACAGG3 AJM545 5 AAGATACCCTTAACGTAGGC3 AJM548 5 AAGATACCCTTAACGTAGGC3 AJM AATTTGAAAGAAAGAAAATCAGG3 AJM AATTTTCAATTATATCTTTCGG3 AJM AAAGAATAGTTTCAGAACCC3 AJM869 5 ATAGCAGAGTCAGAAGCC3

53 43 AJM525 5 AATTCCAGCTGACCACCATGTCAAACTTTTTTAGAGATAGTTC3 AJM573 5 GATCCCCGGGAATTGCCATGCTATTTCCTTCTCCTTTTCTTGCTTATTTTTAA TGACTGGTCTTCG3 AJM560 5 AATTCCAGCTGACCACCATGGTGCAATCGCAAAAGAGGGAATTAGAACAG 3 AJM526 5 GATCCCCGGGAATTGCCATGATCTCCTATTACCTTTTAAAC3 AJM914 5 AATTCCAGCTGACCACCATG TCTGATTTGTTACCACTAGCT3 AJM915 5 GATCCCCGGGAATTGCCATG CTATGGTTTATGCTTATCTTG3 AJM916 5 AATTCCAGCTGACCACCATGAAGAGTAAGGTTTTGGAAGGC3 AJM917 5 GATCCCCGGGAATTGCCATG CTAGTTTTTCATAGAAACCAA3 AJM918 5 AATTCCAGCTGACCACCATGTCTAACTTCTTCAGAGACAACTCG3 AJM919 5 GATCCCCGGGAATTGCCATG TTATCTGAATCTTTTGGTC3 AJM920 5 AATTCCAGCTGACCACCATGCTCAGATCTAAAGATCATG3 AJM921 5 AATTCCAGCTGACCACCATGCTGGAAGACAAATTAAAACAAGC3 AJM574 5 GATCCCCGGGAATTGCCATGCTAATACGTAGCACCACC3 AJM577 5 AATTCCAGCTGACCACCATGTCGGACTCAGAAGTCAATCAAGAAGCTAAGC C3 AJM575 5 GATCCCCGGGAATTGCCATGTTACCTAATCCTTCTAAACTTATTGTTTTTCT TGCTACTACCC3 AJM527 5 AATTCCAGCTGACCACCATGGGCGGCTATTTGGCGATCGTG3 AJM922 5 CTATCTATTCGATGATGAAGATACCCCACCAAACCCAAAAAAAGAGATCG AATTCCAGCTGACCACCATG3 AJM923 5 CTTGCGGGGTTTTTCAGTATCTACGATTCATAGATCTCTGCAGGTCGAGGAT CCCCGGGAATTGCCATG3 AJM572 5 GATCCCCGGGAATTGCCATGCTAGTTTTTCATAGAAACCAATTTAACGTCG AATGTCAGTTCGG3 AJM553 5 AATTCCAGCTGACCAACATGTCTGATTTGTTACCACTAGCTACC3 AJM576 5 GATCCCCGGGAATTGCCATGTTATCTACGTAGTCTATCTCTTGAAAAAGAA GTCTGGTTCCGGTGCG3 AJM556 5 AATTCCAGCTGACCAACATGTCTCTGGATCGTGTAGATTGGCC3 AJM587 5 GATCCCCGGGAATTGCCATGTTACCATTCTAAGGTTAA3

54 AJM529 AJM588 AJM531 AJM990 AJM991 AJM924 AJM925 AJM926 AJM927 AJM928 AJM929 AJM1050 AJM1051 AJM1052 AJM1053 AJM1079 AJM1080 AJM1081 AJM1082 AJM60 AJM61 AJM109 5 AATTCCAGCTGACCACCATGATTATTGAACGTTGGGAAGTA3 5 GATCCCCGGGAATTGCCATGTTATTTAGCAATACTATTGAT3 5 AATTCCAGCTGACCACCATGTCAGACCACAACCTTAACTCC3 5 AATTCCAGCTGACCACCATGTCAAACTTTTTTAGAGATAGT3 5 GATCCCCGGGAATTGCCATGCTAAGATGTACTAGAATTATT3 5 AATTCCAGCTGACCACCATGGAAGGTTTGAAGAAAAAG3 5 GATCCCCGGGAATTGCCATGTTATCTCTTGTTGTTATCAAATTTTC3 5 AATTCCAGCTGACCACCATGATGGACTTAGATAAGATTATAGC3 5 GATCCCCGGGAATTGCCATGTTATAAGAAATAGTCCATTTGAG3 5 AATTCCAGCTGACCACCATGGTATCTAGAGGCCCCGACG3 5 GATCCCCGGGAATTGCCATGTTATAAGAAATAGCCGGC3 5 AATTCCAGCTGACCACCATG ACTGTTATAAAGACAGAACC3 5 GATCCCCGGGAATTGCCATGCTATATAATATTGAGAATTTCATTAGCC3 5 AATTCCAGCTGACCACCATG AGTGATACTACGGAAGTCCC3 5 GATCCCCGGGAATTGCCATGCTATCTATCATCTGTTAGTC3 5 AATTCCAGCTGACCACCATGATGAAACCTCCAATTTCTTCA3 5 GATCCCCGGGAATTGCCATG CTATTTCCTTCTCCTTTTTCTT3 5 AATTCCAGCTGACCACCATGTCAAACTTTTTTAGAGATAGT3 5 GATCCCCGGGAATTGCCATG CTACCCTGATGACGTTAATAG3 5 TGATGATGCGTCTCAAACAGCC3 5 AAGTGCCTATTCTGCTCTTCAAGC3 5 TCGTACGGAATACAAACTTCGGCGGC3 44

55 Table S1. Strains used in this study NAME PM89 BR1919 PM150 AM1848 AM991 AM987 PM558 PM559 LFT61 PM56 PM54 PM63 PM209 PM210 PM60 PM217 PM216 PM260 PM369 GENOTYPE MATα leu2-3,112 his4-260,519 lys2δnhe thr1-4 ade2-1 ura3-1 trp1-289 MATa leu2-3,112 his4-260,519 lys2δnhe thr1-4 ade2-1 ura3-1 trp1-289 PM89 LYS2 LYS2 PM89 LYS2 spo11δ::ade2 LYS2 spo11δ::ade2 PM150 ndt80δ::leu2 ndt80δ::leu2 AM1848 zip1δ::natmx4 zip1δ::natmx4 PM150 ndt80δ::ura3 zip1δ::natmx4 fpr3δ::kanmx4 ndt80δ::ura3 zip1δ::natmx4 fpr3δ::kanmx4 PM150 ndt80δ::ura3 zip2δ::leu2 ndt80δ::ura3 zip2δ::leu2 PM89 spo11δ::ade2 ndt80δ::leu2 zip4δ::ade2 spo11δ::ade2 ndt80δ::leu2 zip4δ::ade2 AM1848 kanmx4-p SCC1 -SMT3 smt3δ::hphmx4 PM150 fpr3δ::kanmx4 fpr3δ::kanmx4 PM150 rrd1δ::hphmx4 rrd1δ::hphmx4 PM150 pph3δ::kanmx4 lys2δ pph3δ::kanmx4 lys2δ PM150 fpr3δ::kanmx4 rrd1δ::hphmx4 fpr3δ::kanmx4 rrd1δ::hphmx4 PM150 fpr3δ::kanmx4 pph3δ::kanmx4 fpr3δ::kanmx4 pph3δ::kanmx4 PM150 rrd1δ::hphmx4 pph3δ::kanmx4 lys2δ rrd1δ::hphmx4 pph3δ::kanmx4 lys2δ PM150 fpr4δ::kanmx4 fpr4δ::kanmx4 PM150 pch2δ::ura3 pch2δ::ura3 PM150 PPH3-13MYC::kanMX6 PPH3-13MYC::kanMX6 PM260 fpr3δ::kanmx4 fpr3δ::kanmx4 45

56 PM474 PM368 PM33 PM43 PM34 PM35 PM255 PM9 PM10 PM31 PM28 PM32 PM37 PM29 PM30 PM62 PM219 PM36 PM230 PM260 rrd1δ::hphmx4 lys2δ rrd1δ::hphmx4 lys2δ PM260 zip1δ::lys2 zip1δ::lys2 PM150 RRD1-9MYC::hphMX4 RRD1-9MYC::hphMX4 PM33 fpr3δ::kanmx4 zip3δ::ura3 fpr3δ::kanmx4 zip3δ::ura3 PM33 fpr3δ::kanmx4 fpr3δ::kanmx4 PM33 zip3δ::ura3 zip3δ::ura3 PM89 PPH3-13MYC::kanMX6 lys2δ PPH3-13MYC::kanMX6 lys2δ PM89 LYS2 RRD1-9MYC::hphMX4 LYS2 RRD1-9MYC::hphMX4 PM89 LYS2 RRD1-9MYC::hphMX4 LYS2 rrd1δ::hphmx4 PM89 LYS2 fpr3δ::kanmx4 LYS2 fpr3δ::kanmx4 PM89 LYS2 zip3δ::ura3 LYS2 zip3δ::ura3 PM89 LYS2 fpr3δ::kanmx4 zip3δ::ura3 LYS2 fpr3δ::kanmx4 zip3δ::ura3 PM89 LYS2 fpr3δ::kanmx4 zip3δ::ura3 rrd1δ::hphmx4 LYS2 fpr3δ::kanmx4 zip3δ::ura3 rrd1δ::hphmx4 PM89 LYS2 zip3δ::ura3 rrd1δ::hphmx4 LYS2 zip3δ::ura3 rrd1δ::hphmx4 PM89 LYS2 rrd1δ::hphmx4 LYS2 rrd1δ::hphmx4 PM89 pph3δ::kanmx4 pph3δ::kanmx4 PM89 zip3δ::ura3 pph3δ::kanmx4 zip3δ::ura3 pph3δ::kanmx4 PM89 LYS2 fpr3δ::kanmx4 rrd1δ::hphmx4 LYS2 fpr3δ::kanmx4 rrd1δ::hphmx4 PM89 fpr3δ::kanmx4 pph3δ::kanmx4 zip3δ::ura3 lys2δ fpr3δ::kanmx4 pph3δ::kanmx4 zip3δ::ura3 LYS2 46

57 PM232 PM229 PM179 PM177 PM178 PM526 PM555 PM553 PM552 PM554 PM89 pph3δ::kanmx4 zip3δ::ura3 rrd1δ::hphmx4 pph3δ::kanmx4 zip3δ::ura3 rrd1δ::hphmx4 PM89 LYS2 fpr3δ::kanmx4 pph3δ::kanmx4 zip3δ::ura3 rrd1δ::hphmx4 LYS2 fpr3δ::kanmx4 pph3δ::kanmx4 zip3δ::ura3 rrd1δ::hphmx4 PM89 rrd1δ::hphmx4 pph3δ::kanmx4 rrd1δ::hphmx4 pph3δ::kanmx4 PM89 rrd1δ::hphmx4 pph3δ::kanmx4 rrd1δ::hphmx4 PPH3 PM89 rrd1δ::hphmx4 pph3δ::kanmx4 RRD1 pph3δ::kanmx4 PM150 fpr3-f341y/d342v::ura3 lys2δ fpr3-f341y/d342v::ura3 lys2δ PM150 fpr3-t345a::ura3 lys2δ fpr3-t345a::ura3 lys2δ PM150 fpr3-w363l::ura3 lys2δ fpr3-w363l::ura3 lys2δ PM150 fpr3-y386d::ura3 lys2δ fpr3-y386d::ura3 lys2δ PM150 fpr3-f402y::ura3 lys2δ fpr3-f402y::ura3 lys2δ PM499 PM498 PM501 PM500 PM220 PM225 PM198 PM222 PM150 pph3δ::kanmx4 zip1-s75a LYS2 pph3δ::kanmx4 zip1-s75a lys2δ PM150 pph3δ::kanmx4 zip1-s75d lys2δ pph3δ::kanmx4 zip1-s75d lys2δ PM150 zip1-s75a LYS2 zip1-s75a lys2δ PM150 zip1-s75d LYS2 zip1-s75d lys2δ PM150 ZIP2-GFP::URA3 zip2δ::leu2 ZIP2-GFP::URA3 zip2δ::leu2 PM150 ZIP2-GFP::URA3 zip2δ::leu2 zip1δ::lys2 ZIP2 zip2δ::leu2 zip1δ::lys2 AM1848 ZIP3-MYC lys2δ ZIP3-MYC lys2δ PM150 ZIP3-MYC zip1δ::lys2 ZIP3-MYC zip1δ::lys2 47

58 EK53 PM223 AM1851 AM1852 AM1850 AM1853 AM1854 AM1855 AM1892 AM892 PM50 PM157 PM97 PM551 PM94 PM99 PM150 ZIP4-HA ZIP4-HA AM1848 zip1δ::lys2 ZIP4-HA zip1δ::lys2 ZIP4 AM1848 fpr3δ::kanmx4 fpr3δ::kanmx4 AM1848 rrd1δ::hphmx4 rrd1δ::hphmx4 AM1848 zip3δ::ura3 zip3δ::ura3 AM1848 fpr3δ::kanmx4 rrd1δ::hphmx4 fpr3δ::kanmx4 rrd1δ::hphmx4 AM1848 fpr3δ::kanmx4 zip3δ::ura3 fpr3δ::kanmx4 zip3δ::ura3 AM1848 rrd1δ::hphmx4 zip3δ::ura3 rrd1δ::hphmx4 zip3δ::ura3 AM1848 fpr3δ::kanmx4 rrd1δ::hphmx4 zip3δ::ura3 fpr3δ::kanmx4 rrd1δ::hphmx4 zip3δ::ura3 PM150 fpr3δ::kanmx4 zip3δ::ura3 fpr3δ::kanmx4 zip3δ::ura3 PM150 fpr3δ::kanmx4 rrd1δ::hphmx4 zip3δ::ura3 fpr3δ::kanmx4 rrd1δ::hphmx4 zip3δ::ura3 PM89 LYS2 sit4δ::hphmx4 LYS2 sit4δ::hphmx4 PM89 LYS2 sit4δ::hphmx4 LYS2 SIT4 PM150 kanmx4-p SCC1 -SIT4 LYS2 sit4δ::hphmx4 lys2δ PM89 kanmx4-p SCC1 -SIT4 SIT4 PM89 kanmx4-p SCC1 -SIT4 kanmx4-p SCC1 -SIT4 PM26 PM89 LYS2 plus ppm2 (BAM119) (SIT4 2μ) LYS2 PM74 PM150 plus ppm2 (BAM119) (SIT4 2μ) PM19 PM150 fpr3δ::kanmx4 zip3δ::ura3 plus ppm2 (BAM119) (SIT4 2μ) fpr3δ::kanmx4 zip3δ::ura3 48

59 PM76 PM150 fpr3δ::kanmx4 rrd1δ::hphmx4 zip3δ::ura3 plus ppm2 (BAM119) (SIT4 2μ) fpr3δ::kanmx4 rrd1δ::hphmx4 zip3δ::ura3 PM105 PM92 PM115 PM168 PM531 PM237 PM388 PJ69-4 PJ69-4 PM89 LYS2 kanmx4-yfp-sit4 LYS2 kanmx4-yfp-sit4 PM89 LYS2 kanmx4-yfp-sit4 LYS2 SIT4 PM89 TRP1-P GAL1 -FPR3 ura3::p GPD1 -GAL4(848).ER::URA3 ZIP1-GFP ndt80δ::leu2 FPR3 ura3-1 ZIP1-GFP ndt80δ::leu2 PM89 TRP1-P GAL1 -FPR3 ura3::p GPD1 -GAL4(848).ER::URA3 ZIP1-GFP ndt80δ::leu2 TRP1-P GAL1 -FPR3 ura3-1 ZIP1-GFP ndt80δ::leu2 PM115 pch2δ::hphmx4 pch2δ::hphmx4 PM89 TRP1-P GAL1 -FPR3 ura3::p GPD1 -GAL4(848).ER::URA3 ZIP1::hphMX4 FPR3 ura3-1 ZIP1::hphMX4 PM237 pch2δ::hphmx4 pch2δ::hphmx4 MATα trp1-901 leu2-3,112 ura3-52 his3-200 gal4δ gal80δ LYS2::GAL1-HIS3 GAL2- ADE2 met2::gal7-lacz MATa trp1-901 leu2-3,112 ura3-52 his3-200 gal4δ gal80δ LYS2::GAL1-HIS3 GAL2-ADE2 met2::gal7-lacz Plasmid PM2 (BAM119) is described in Materials and Methods section. 49

60 Chapter 3 Characterization of Factors that Regulate Zip1 in the Absence of Recombination Initiation During Meiosis in Budding Yeast 50

61 3.1 Abstract The Synaptonemal Complex (SC) is a multiprotein structure that bridges a pair of lengthwise-aligned homologs during meiotic prophase. When homolog pairing fails in budding yeast, SC proteins typically aggregate into a polycomplex structure instead of assembling SCs on chromosomes. We have identified several trans-acting factors that promote polycomplex formation. The Rrd1 prolyl isomerase along with the PP4 phosphatase subunit Pph3, are each involved in the aggregation of Zip1 (a SC central region protein) into a polycomplex. Similar to loss of the Fpr3 prolyl isomerase, loss of Rrd1 function results in the occurrence of linear Zip1 elaborations on non-homologous chromosomes in mutants that usually fail to build SC. We further demonstrate that overexpression of Sit4 (a catalytic component of PP2A-like phosphatase) can similarly result in aberrant Zip1 linear assemblies. Unlike Fpr3, Rrd1 does not appear to localize to Zip1 polycomplex (preliminary data). Taken together, our results are consistent with a model in which Rrd1 promotes Zip1 polycomplex formation indirectly through activating Pph3. On the other hand, Rrd1 may prevent promiscuous SC polymerizations on unassociated chromosomes by inhibition of a PP2A phosphatase. 3.2 Introduction The Synaptonemal Complex (SC) is a tripartite protein structure that joins two homologs together during mid-meiotic prophase. The SC links initial homolog pairing with crossover formation. Crossover recombination, a conserved feature of early meiosis, is triggered by Spo11-mediated DNA breaks. Crossover events ultimately mature as physically interlocked homolog pairs. Such homolog associations facilitate the 51

62 orientation of, and segregation of chromosomes on the first meiotic spindle (Page and Hawley, 2004; Roeder, 1997; Zickler, 2006; Zickler and Kleckner, 1998; Zickler and Kleckner, 1999). In a group of organisms including humans and budding yeast, initial recombination events (such as double-strand breaks) are crucial for homolog pairing and SC assembly (synapsis) (Bhalla and Dernburg, 2008). Failure to successfully pair homologs results in SC protein aggregation into a polycomplex at the expense of SC polymerization on condensed chromatin (Chua and Roeder, 1998; Zickler and Kleckner, 1999). This observation suggests that pairing reinforcement (SC assembly) is somehow coordinated with homolog recognition such that the SC assembles only at the right place in the right time. We wonder how polycomplex formation is regulated during meiosis. The SC is a ladder-like proteinaceous structure composed of transverse filaments that lie perpendicular to, and connect the longitudinal lateral elements (Page and Hawley, 2004). The lateral elements are proteinaceous axes of homologous chromosomes formed as a result of sister chromatid condensation and contain the meiosis-specific Red1 and Hop1 proteins (Smith and Roeder, 1997). At the midline of the transverse filament, lies a protein core equidistant from the lateral elements called the SC central element. The transverse filament together with the central element is called the SC central region. The SC central region spans ~100nm between two lateral elements (Zickler and Kleckner, 1999). In budding yeast, Zip1 (a meiosis-specific coiled-coil protein) forms an essential protein constituent of the SC central region (Sym et al., 1993; Sym and Roeder, 1995). Parallel-homo dimers of Zip1 join at the N-termini (marking the SC central element) while the C-termini of Zip1 dimers connect the homolog axes. Several such Zip1 52

63 tetramers polymerize along paired homologs to build the budding yeast SC (Dong and Roeder, 2000; Page and Hawley, 2004; Tung and Roeder, 1998). A genetic screen identified novel regulators of Zip1, which prevent SC assembly when proper homolog recognition has not been established (MacQueen and Roeder, 2009). This screen identified Fpr3, which is a peptidyl-prolyl isomerase (PPIase) protein (Benton et al., 1994). Prolyl isomerases generally function as molecular chaperones (Parsell and Lindquist, 1993). Fpr3 co-localizes with Zip1 within a polycomplex, and the frequency of Zip1 polycomplex formation decreases in spo11 fpr3 meiotic cells (MacQueen and Roeder, 2009). In absence of yet another Zip1 regulator, Zip3 (a meiosisspecific E3 SUMO ligase), polycomplex failure is accompanied by promiscuous SC assembly on unpaired chromosomes, suggesting the importance of negatively regulating Zip1 (MacQueen and Roeder, 2009). How the polycomplex structure forms within a budding yeast nucleus during meiotic prophase remains unclear. This screen also identified a second prolyl isomerase, Rrd1. Here we show that Rrd1 promotes polycomplex assembly in meiotic mutants that fail to initiate early recombination processes. We demonstrate that Rrd1 s role in regulating Zip1 is independent from the one mediated by Fpr3. Our results suggest that there are at least two parallel pathways that promote polycomplex formation and that prevent promiscuous Zip1 assemblies in meiotic recombination- and homolog pairing-deficient cells. Additionally, we provide evidence that Rrd1 regulates Zip1 aggregation into a polycomplex through the catalytic components of serine-threonine protein phosphatases, Sit4 and Pph3. Finally, here we have identified key residues in Fpr3 (present within the 53

64 hydrophobic pocket of its PPIase domain) that might be important for promoting Zip1 polycomplex. 3.3 Results Two prolyl isomerases regulate Zip1 polycomplex formation through separate pathways Rrd1 was identified in a screen for negative regulators of Zip1 assembly in recombination-deficient cells. Like Fpr3, Rrd1 is also a prolyl isomerase protein (Jordens et al., 2006). Furthermore we found that, similar to an fpr3 mutation, deletion of RRD1 causes a reduction in Zip1 polycomplex formation in cells that fail to initiate meiotic recombination (% of meiotic nuclei with a Zip1 polycomplex: 50.9% ± 7.9% and 12.1% ± 4.2% in spo11 and spo11 rrd1 meiotic mutants respectively; n 50 per replicate, total of three replicates) (Figure 1A). In order to explore the relationship between Rrd1 and Fpr3 in regulating Zip1, meiotic chromosome spreads were examined from spo11, spo11 fpr3, spo11 rrd1, and spo11 fpr3 rrd1 strains. This technique preserves fixed chromatin and favors removal of other nucleoplasmic and cytoplasmic material (Rockmill, 2009). The surface-spread meiotic nuclei were stained with Zip1 and either Red1 or Hop1 (meiotic chromosome axis component) antibodies, and visualized via a fluorescence microscope. Red1 and Hop1 proteins localize on unpaired meiotic chromosomal axis in spo11 cells (Smith and Roeder, 1997). In addition to a spo11 mutation, each of these strains lacks the activity of Ndt80, a transcription factor required for progression through mid-meiotic prophase or pachytene 54

65 (Xu et al., 1995). The ndt80 mutation enriched our chromosome spread populations with meiotic nuclei that were arrested at the mid-meiotic prophase stage, pachytene. Wellspread, DAPI-stained nuclei were selected based on either Red1 or Hop1 staining. For each strain, at least 50 nuclei were analyzed and scored for Zip1 polycomplex. We found that Red1 protein frequently caps both ends of Zip1 polycomplex in spo11 ndt80 (% Zip1 polycomplex with Red1: 66.7%, n = 45) while Hop1 staining is often distributed uniformly throughout Zip1 polycomplexes (% Zip1 polycomplex with Hop1: 35.6%, n = 45). However, this observation is preliminary and further biological replicates are needed to confirm this result (Figure 1E). Interestingly, spo11 fpr3 rrd1 strains exhibited fewer Zip1 polycomplexes than spo11 fpr3 or spo11 rrd1 strains (Figure 1A). As described in MacQueen and Roeder (2009), Zip1 polycomplex size and frequency increases in spo11 cells missing the SC assembling factor, Zip3. Like the fpr3 mutation, absence of Rrd1 in spo11 zip3 reduces polycomplexes and Zip1 polycomplexes are further reduced in spo11 zip3 when both prolyl isomerase functions are missing (Figure 1A). Together, these results suggest that Rrd1 operates in parallel with Fpr3 and/or Zip3 for polycomplex regulation. Zip1 polycomplexes in spo11 meiotic cells typically have a round, ball-like structure. Rarely, linear (long instead of round) Zip1 polycomplex structures are seen in such mutants. We wonder whether linear Zip1 polycomplexes occur as an effect of loss-offunction of Zip1 regulators. We noticed that 35% of the Zip1 polycomplexes in spo11 fpr3 and spo11 rrd1 are linear. The frequency of linear polycomplex remains similar between spo11 fpr3, spo11 rrd1, and spo11 fpr3 rrd1 (Figure 1B). However, loss of Fpr3 function in spo11 zip3 results in increased linear Zip1 polycomplexes (79.5% ± 9.9%; n = 55

66 88) compared to spo11 fpr3 (46.5% ± 11.8%; n = 73) and spo11 zip3 (36% ± 7.4%; n = 98). Interestingly, absence of Rrd1 in spo11 zip3 fpr3 reduces the formation of linear polycomplexes (49% ± 11.1%; n = 61) (Figure 1B). Together these data suggest that linear Zip1 polycomplexes accumulate in spo11 when one or more SC regulators are absent. It appears that Fpr3 and Zip3 have a synergistic effect on linear Zip1 polycomplex formation while Rrd1 counteracts this effect. A. Rrd1 is dispensable for Fpr3 to co-localize with Zip1 polycomplex Fpr3 and Zip1 co-localize within a polycomplex in recombination-deficient meiotic cells (MacQueen and Roeder, 2009). To determine if Rrd1 is required for Fpr3 to colocalize with Zip1 polycomplex, we stained ndt80 spo11 and ndt80 spo11 rrd1 surfacespread meiotic nuclei with Zip1 and Fpr3 antibodies. For each given strain, we analyzed individual nuclei for Zip1-Fpr3 co-localization within the few polycomplexes present. For both strains, Fpr3 was always found to co-localize with Zip1 polycomplex structure independent of Rrd1 function (n = 23 for ndt80 spo11 and n = 38 for ndt80 spo11 rrd1). We note that in ndt80 spo11 rrd1 when Zip1 polycomplex is linear, Fpr3 staining also looks linear. Therefore, we conclude that Rrd1 is dispensable for co-localization of Fpr3 with Zip1 polycomplex (Figure 1C). This further suggests that Fpr3 and Rrd1 are acting in parallel to promote Zip1 polycomplex formation. B. Fpr4 is dispensable for Zip1 polycomplex formation To test whether other budding yeast prolyl isomerases are essential for Zip1 polycomplex formation, we knocked out FPR4 in a spo11 mutant strain. FPR4 encodes a 56

67 similar class of prolyl isomerase protein to Fpr3; Fpr3 and Fpr4 belong to a class of prolyl isomerases that bind an immunosuppressive drug called FK506 (Arevalo- Rodriguez et al., 2004; Harding et al., 1989; Siekierka et al., 1989). We noticed that the absence of Fpr4 function in spo11 fails to alter the frequency of Zip1 polycomplex, suggesting that not all yeast prolyl isomerases regulate Zip1 during meiosis (Figure 1D). 57

68 DAPI Zip1 Hop1! A! ndt80 spo11! DAPI Zip1 Hop1! B! ndt80 spo11! % of meiotic nuclei with! a Zip1 polycomplex! % of Zip1 polycomplexes! that are linear! n 50 per replicate! *! *! *! *! *! *! spo11 spo11 fpr3 spo11 rrd1 spo11 fpr3 rrd1 n 30 per replicate! ndt80 spo11 ndt80 spo11 fpr3 ndt80 spo11 rrd1 ndt80 spo11 ndt80 spo11 fpr3 ndt80 spo11 rrd1 ndt80 spo11 fpr3 rrd1 ndt80 spo11 zip3 ndt80 spo11 zip3 fpr3 ndt80 spo11 zip3 rrd1 ndt80 spo11 zip3 fpr3 rrd1 ndt80 spo11 fpr3 rrd1 ndt80 spo11 zip3 ndt80 spo11 zip3 fpr3 ndt80 spo11 zip3 rrd1 ndt80 spo11 zip3 fpr3 rrd1 Figure 1. Rrd1 promotes Zip1 polycomplex formation in parallel with Fpr3 in pairing-defective meiotic nuclei. (A) Representative image of a Zip1 polycomplex in spo11 surface-spread meiotic nuclei labeled with Zip1 (green) and Hop1 (red) antibodies and DAPI (blue). Scale bar = 1 micron. Bar graph represents % of meiotic nuclei displaying a Zip1 polycomplex in spo11, spo11 fpr3, spo11 rrd1, and spo11 fpr3 rrd1 meiotic mutants. For each strain, at least 50 nuclei per replicate were scored. Total of three replicates for the first four columns: NDT80+ strains (15 hours in SPM). Total of two replicates for the last eight columns: ndt80 strains (17-18 hours in SPM). The NDT80+ strain pair that show statistical significance are as follows: (p value = , , and by two-tailed unpaired t test with Welch s correction for spo11 versus spo11 fpr3, spo11 versus spo11 rrd1 and spo11 versus spo11 fpr3 rrd1 respectively). The ndt80 strain pair that show statistical significance are as follows: (p value = , , and by two-tailed Fisher s exact test for spo11 versus spo11 fpr3, spo11 versus spo11 rrd1 and spo11 versus spo11 fpr3 rrd1 respectively). Asterisk represents statistical significance. Error bars indicate mean with SD. (B) Representative image of a linear Zip1 polycomplex in spo11 surface-spread meiotic nuclei labeled with Zip1 (green) and Hop1 (red) antibodies and DAPI (blue). Scale = 1 micron. Bar graph shows % of Zip1 polycomplexes that are linear in various spo11 ndt80 meiotic mutants labeled 58

69 in the X-axis (n 30 for each strain, total of two replicates). Error bars indicate mean with SD. DAPI Zip1 Fpr3! DAPI Zip1 Fpr3! C! D! N! C! Fpr3! Fpr4! PPIase domain! ndt80 spo11! ndt80 spo11 rrd1! 58%! 85%! DAPI Zip1 Red1! E! ndt80 spo11! DAPI Zip1 Hop1! ndt80 spo11! % of meiotic nuclei with! a Zip1 polycomplex! n 50! spo11 spo11 fpr4 Figure 1. Rrd1 promotes Zip1 polycomplex formation in parallel with Fpr3 in pairing-defective meiotic nuclei. (C) Representative images of surface-spread ndt80 spo11 and ndt80 spo11 rrd1 meiotic nuclei (labeled with Zip1 and Fpr3 antibodies) show co-localization of Zip1 polycomplex (green) with Fpr3 (red) independent of Rrd1 activity. DNA (blue), scale bar represents 1 micron. (D) Schematic representation showing 85% sequence identity between the C-terminal PPIase domain of Fpr3 and Fpr4 at the amino acid level. Bar graph depicts % of meiotic nuclei with a Zip1 polycomplex in spo11 and spo11 fpr4 meiotic mutants (n 50 for each strain). p value = (by two-tailed Fisher s exact test) between spo11 and spo11 fpr4 are not statistically significant. (E) Representative image shows a Zip1 polycomplex with Red1 staining at both ends (left) and uniform localization of Hop1 (right) in ndt80 spo11 meiotic cells. Scale bar = 1 micron. 59

70 3.3.2 Increased penetrance of linear Zip1 elaborations in spo11 zip3 fpr3 mutants lacking Rrd1 activity MacQueen and Roeder (2009) revealed that the meiosis-specific protein Zip3, an E3 SUMO ligase, negatively regulates SC assembly, along with Fpr3, in mutants that fail to initiate homologous recombination. Loss of Zip3 function in spo11 fpr3 results in linear Zip1 assemblies on unpaired chromosomes and increased linear Zip1 polycomplexes. In order to test whether Rrd1 has a role in preventing Zip1 polymerization on unpaired chromosomes, meiotic nuclei from spo11 zip3, spo11 zip3 fpr3, spo11 zip3 rrd1, and spo11 zip3 fpr3 rrd1 cells were surface-spread after hours of sporulation and labeled with antibodies to meiotic chromosome axis proteins and Zip1. Well-spread nuclei that display either Red1 or Hop1 (meiotic marker) staining were chosen. At least 50 nuclei were scored and analyzed for Zip1 linear assemblies for each strain mentioned above. Interestingly, the absence of Rrd1 activity in spo11 zip3 fpr3 resulted in an increased penetrance of linear Zip1 elaborations on chromosomes (% of meiotic nuclei with multiple linear Zip1 structures: 94% in spo11 zip3 fpr3 rrd1 versus 53.2% in spo11 zip3 fpr3; n 100), suggesting that Rrd1 functions in parallel with Fpr3 and Zip3 to prevent promiscuous Zip1 polymerization on unpaired chromosomes (Figure 2A). The Small Ubiquitin MOdifier protein, SUMO co-localizes to the central region of budding yeast SCs (Hooker and Roeder, 2006). Zip1 linear elaborations that occur independent of homolog pairing also display SUMO associations on them (MacQueen and Roeder, 2009). Therefore, we looked at SUMO staining pattern on the Zip1 linear assemblies found in spo11 zip3 fpr3 rrd1. We found that SUMO also co-localizes with such linear Zip1 elaborations (Figure 2B). Together, our data suggest that both Fpr3 and 60

71 Rrd1 prolyl isomerases are acting in separate pathways in order to regulate the nuclear distribution of SC proteins and their polymerization on chromosomes. Rrd1 may prevent high occurrence of promiscuous SC assemblies in spo11 fpr3 zip3 by promoting Zip1 polycomplexes. 61

72 DAPI Zip1" A" ndt80 spo11 zip3 fpr3! Zip1 SUMO" B" DAPI Zip1" ndt80 spo11 zip3 fpr3 rrd1! Zip1 SUMO" % of meiotic nuclei with " multiple Zip1 linear structures" 100 n 50 per replicate" *" ndt80 spo11 ndt80 spo11 fpr3 ndt80 spo11 rrd1 ndt80 spo11 fpr3 rrd1 ndt80 spo11 zip3 ndt80 spo11 zip3 fpr3 ndt80 spo11 zip3 rrd1 ndt80 spo11 zip3 fpr3 rrd1 ndt80 spo11 zip3 fpr3! ndt80 spo11 zip3 fpr3 rrd1! Figure 2. Deletion of RRD1 in spo11 fpr3 zip3 meiotic nuclei results in an increased penetrance of linear Zip1 assemblies on chromosomes. (A) Representative image of linear Zip1 elaborations in spo11 zip3 fpr3 and spo11 zip3 fpr3 rrd1 surface-spread meiotic nuclei labeled with Zip1 (green) antibody and DAPI (blue). Scale = 1 micron. Bar graph represents % of meiotic nuclei displaying multiple ( 3) linear Zip1 structures in spo11 zip3, spo11 zip3 fpr3, spo11 zip3 rrd1, and spo11 zip3 fpr3 rrd1 meiotic mutants after hours in sporulation media. Each strain lacks Ndt80 function. For each strain, at least 50 nuclei were scored per replicate (total of two replicates). Error bars represent mean with SEM. The strain pair that show statistical significance are as follows: (p value = by two-tailed Fisher s exact test for spo11 zip3 fpr3 versus spo11 zip3 fpr3 rrd1). Asterisk represents statistical significance. (B) Representative images show co-localization of SUMO with linear Zip1 elaborations in spo11 fpr3 zip3 (positive control) and spo11 fpr3 rrd1 zip3 (experimental) meiotic mutants (n 15). Scale bar represents 1 micron. 62

73 3.3.3 Overexpression of phosphatase component Sit4 phenocopies loss-of-function of Rrd1 Rrd1 displays both genetic and physical interaction with Sit4, a catalytic subunit of yeast PP2A-like phosphatase (Douville et al., 2004; Mitchell and Sprague, 2001; Van Hoof et al., 2005). The phosphatase component Sit4 is required in late G1 phase to allow progression into S phase (Sutton et al., 1991). In addition, both Rrd1 and Sit4 share similar cellular locations (cytoplasm) during vegetative growth in budding yeast (Douville et al., 2004; Sutton et al., 1991). In order to test the hypothesis that Rrd1 might act through regulating the catalytic subunit of PP2A-like phosphatase, Sit4, in regulating Zip1 s nuclear distribution in spo11 mutant strains, we monitored Zip1 linear assemblies in meiotic cells that overexpress Sit4 via a 2-micron plasmid. Surface-spread meiotic nuclei from spo11, spo11 fpr3 zip3, and spo11 fpr3 zip3 rrd1 strains overexpressing Sit4 were labeled with Zip1 and Red1 antibodies. For each strain, at least 50 nuclei were scored and analyzed for either Zip1 polycomplexes or Zip1 linear assemblies associated with unpaired homologs. My preliminary results suggest that SIT4 overexpression phenocopies loss of Rrd1 function. Like spo11 rrd1, overexpression of Sit4 in spo11 meiotic cells results in reduced Zip1 polycomplex formation [% meiotic nuclei with a Zip1 polycomplex: 12.1% ± 4.2% (n 150) and 22% (n = 50) in spo11 rrd1 and spo11 SIT4-OE respectively versus 50.9% ± 7.9% (n 150) in spo11] (Figure 3A). Similarly, like loss-of-function of Rrd1, an increased penetrance of linear Zip1 assembly is seen as an effect of Sit4 overexpression in spo11 fpr3 zip3 meiotic mutants (% meiotic nuclei with multiple Zip1 linear elaborations: 70.8%, n = 50 and 86.5%, n = 52 in spo11 fpr3 zip3 rrd1 and spo11 63

74 fpr3 zip3 SIT4-OE respectively) compared to spo11 fpr3 zip3 triple mutants (% meiotic nuclei with multiple Zip1 linear elaborations: 35.7%, n = 53) (Figure 3D). Moreover, Zip1 polycomplex is greatly reduced in spo11 zip3 fpr3 rrd1 (10%, n = 50) and spo11 zip3 fpr3 SIT4-OE (30.8%, n = 52) compared to spo11 fpr3 zip3 meiotic mutants (64%, n = 53) (Figure 3C). This raises the possibility that Rrd1 might regulate Zip1 s ability to either form polycomplex or assemble SC on unpaired chromosomes via inhibition of the Sit4 phosphatase. Consistent with this idea, spo11 fpr3 zip3 rrd1 SIT4-OE meiotic mutants display similar frequencies of linear Zip1 elaborations (80%, n = 50) as compared to spo11 fpr3 zip3 SIT4-OE meiotic cells (Figure 3D). Next, we studied the effect of SIT4 under-expression on Zip1 polycomplex formation in spo11 meiotic mutants. Since deletion of both copies of SIT4 makes cells extremely slow growing, and such strains fail to sporulate, we created a Sit4-diminished strain. In order to maximally diminish Sit4 function during meiosis, we knocked out one copy of SIT4 and placed the other copy under the control of a vegetative-specific promoter (P SCC1 ). Interestingly, spo11 P SCC1 [SIT4]/sit4 strains exhibit an increased frequency of Zip1 polycomplex (80%; n = 55) after 15 hours of sporulation in contrast to spo11 SIT4- OE strains (22%; n = 50) while spo11 strains show 72% Zip1 polycomplex (n = 50) (Figure 3B). We note that the majority of the Zip1 polycomplexes are linear in Sit4- diminished spo11 meiotic cells (45.5% linear polycomplex out of 44 Zip1 polycomplexes), in contrast to non-linear polycomplexes (1 linear polycomplex out of 36 Zip1 polycomplexes) typically seen in spo11 meiotic cells. Our preliminary data suggests that unlike Rrd1, Sit4 may negatively regulate Zip1 polycomplex formation, but levels of Sit4 protein in the aforementioned strain must be examined on a Western blot. 64

75 To determine whether Rrd1 is regulating Zip1 linear assembly via inhibition of Sit4, we will monitor the effect of SIT4-diminution in spo11 zip3 fpr3, and spo11 zip3 fpr3 rrd1 mutants. If the phenotype resulting from loss of Rrd1 function is dependent on Sit4 activity, then under-expression of Sit4 in spo11 fpr3 zip3 rrd1 will suppress the phenotype of increased penetrance of linear Zip1 assembly of spo11 fpr3 zip3 rrd1 strain. This will suggest that Rrd1 is acting upstream of, and inhibiting Sit4 to promote Zip1 linear elaborations. 65

76 A! B! % of meiotic nuclei with! a Zip1 polycomplex! n 50! n 50! 100 spo11 spo11 SIT4OE spo11 rrd1 % of meiotic nuclei with! a Zip1 polycomplex! spo11 spo11 Pscc1[SIT4]/sit4Δ C" D" % of meiotic nuclei with " a Zip1 polycomplex " n 50" spo11 zip3 fpr3 spo11 zip3 fpr3 SIT4OE spo11 zip3 fpr3 rrd1 spo11 zip3 fpr3 rrd1 SIT4OE % of meiotic nuclei with " multiple Zip1 linear elaborations" n 50" spo11 zip3 fpr3 *" *" spo11 zip3 fpr3 SIT4OE *" spo11 zip3 fpr3 rrd1 spo11 zip3 fpr3 rrd1 SIT4OE Figure 3. Overexpression of Sit4 phosphatase phenocopies loss-of-function of Rrd1. Surface-spread, pairing-defective meiotic nuclei were labeled with Zip1 antibody. For each strain, at least 50 nuclei were scored and analyzed for the frequency of either Zip1 polycomplex or linear Zip1 assemblies on unpaired chromosomes. (A) Bar graph represents % of meiotic nuclei featuring a Zip1 polycomplex in spo11 (from Figure 1A), 66

77 spo11 SIT4-OE, and spo11 rrd1 (from Figure 1A) meiotic cells (n 50) after hours of sporulation. (B) Bar graph shows % of meiotic nuclei containing a Zip1 polycomplex in spo11 and spo11 P SCC1 [SIT4]/sit4 (Sit4-diminished) strains (n 50) after 15 hours of sporulation. (C-D) Bar graph depicts % of meiotic nuclei displaying a Zip1 polycomplex (C) and multiple ( 3) linear Zip1 elaborations (D) in spo11 zip3 fpr3, spo11 zip3 fpr3 SIT4-OE, spo11 zip3 fpr3 rrd1, and spo11 zip3 fpr3 rrd1 SIT4-OE meiotic mutants after 16 hours of sporulation (n 50 for each strain). Data for the first and third columns, and the second and fourth columns are from separate experiments. The strain pair that show statistical significance are as follows: (p value = , , and by twotailed Fisher s exact test for spo11 zip3 fpr3 versus spo11 zip3 fpr3 SIT4-OE, spo11 zip3 fpr3 versus spo11 zip3 fpr3 rrd1, and spo11 zip3 fpr3 versus spo11 zip3 fpr3 rrd1 SIT4- OE respectively). Asterisk represents statistical significance. 67

78 3.3.4 Rrd1-MYC and YFP-Sit4 localize to the nucleoplasm but are absent from Zip1 polycomplexes in spo11 meiotic cells During vegetative growth in budding yeast, Rrd1 localizes to both nucleus and cytoplasm (Douville et al., 2004; Sutton et al., 1991) but so far, the localization of Rrd1 within a meiotic cell has not been studied. In order to see the localization of Rrd1 in meiotic cells, we engineered a wild-type diploid strain in which both copies of RRD1 were C-terminally tagged with a MYC epitope. We confirmed the expression of epitope-tagged Rrd1 during meiosis by visualizing spo11 RRD1-MYC strain on a Western blot (Figure 4B). We then tested whether epitope-tagging of Rrd1 alters its functions in meiotic prophase cells by comparing Zip1 polycomplex frequencies between spo11 (positive control), spo11 rrd1 (negative control) and spo11 RRD1-MYC after 15 hours of sporulation. Since absence of Rrd1 function reduces Zip1 polycomplex in spo11 (data shown in previous section), we reasoned that perturbation in Rrd1 activity should affect Zip1 polycomplex formation. We noticed no significant difference in Zip1 polycomplex frequency between spo11 (72%, n = 50) and spo11 RRD1-MYC (78.2%, n = 55) whereas spo11 rrd1 showed (10%, n = 50) Zip1 polycomplex. Therefore, we inferred that tagging of Rrd1 with an epitope at the C-terminus does not alter its function during meiotic prophase. Next, meiotic chromosomes from spo11 RRD1-MYC and spo11 (negative control) diploid strains were surface-spread after 10 hours of sporulation using a semi-squash technique that preserves both nucleoplasmic and cytoplasmic materials (Fuchs and Loidl, 2004). These semi-squashed meiotic nuclei were stained with c-myc and Red1 (used in this case as a meiotic marker) antibodies. For each strain, at least 10 meiotic nuclei were 68

79 scored. The spo11 strain with an untagged version of RRD1 served as a negative control for our experiment. Our preliminary data reveals that 83.3% of spo11 RRD1-MYC meiotic cells show more Rrd1-MYC staining in the nucleoplasm than in the cytoplasm while 16.7% of such cells exhibit Rrd1-MYC localization only in the nucleoplasm (Figure 4A). Since Rrd1 can physically interact with, and shares the same cellular (cytoplasmic) location with Sit4 phosphatase during vegetative growth (Douville et al., 2004; Mitchell and Sprague, 2001; Sutton et al., 1991; Van Hoof et al., 2005), we studied Sit4 localization during meiosis. For studying Sit4 localization in meiotic cells, we epitopetagged one copy of SIT4 with YFP (Yellow Fluorescent Protein) at the N-terminus in wild-type (WT) diploid strain. The heterozygous epitope-tagged Sit4 strain exhibits wildtype spore viability (Table 1). We noticed that a homozygous YFP-tagged Sit4 strain displays a slow growth phenotype on rich media (data not shown). Meiotic nuclei from a heterozygous diploid YFP-SIT4 strain were semi-squashed (as mentioned earlier) and spread on a glass slide after 11 hours of sporulation. These semi-squashed nuclei were labeled with GFP, Nsp1 (to mark the nuclear envelope), and Red1 (meiotic marker) antibodies. At least 15 meiotic nuclei were scored. For each nucleus, several z-stack images were taken and projected to obtain the final image. We found that 5 out of 15 (33.3%) meiotic nuclei show equal distribution of YFP-Sit4 signal in the nucleoplasm and cytoplasm whereas 10 out of 15 (66.7%) meiotic nuclei show robust nucleoplasmic YFP-Sit4 staining and faint cytoplasmic YFP-Sit4 staining (Figure 4C). Thus our preliminary data indicate that, like Rrd1, majority of epitope-tagged Sit4 localizes to the 69

80 nucleoplasm in a meiotic cell, suggesting that these two proteins could interact during meiosis. Detectable Rrd1-MYC staining was not observed on Zip1 polycomplexes in spo11 RRD1-MYC meiotic nuclear spreads (preliminary data not shown). Faint YFP-Sit4 staining was noticed on a small fraction of Zip1 polycomplexes in spreads from spo11 YFP-SIT4, but a similar staining pattern was also seen in spo11 strains containing an untagged version of SIT4 (preliminary data not shown). Therefore, we conclude that detectable Rrd1-MYC and YFP-Sit4 may be absent from Zip1 polycomplexes in pairingdefective mutants. 70

81 A! spo11! Rrd1-MYC! Rrd1-MYC! B! 75 KDa! 70 KDa! Marker! WT! RRD1-MYC! spo11! spo11! RRD1-MYC! spo11 fpr3! spo11 zip3! spo11 fpr3 zip3! α Myc! Rrd1-MYC! Rrd1-MYC! spo11 RRD1-MYC! C! DAPI! Nsp1! Red1! yyyyyyyyyyyyyyyyyyyyyyyyy! WT! YFP-Sit4! DAPI Nsp1 YFP-Sit4! Figure 4. Localization of epitope-tagged Rrd1 and Sit4 within a meiotic cell. For each nucleus, several z-stack images were taken and the best z-stacks were projected into one final image. (A) Semi-squashed, recombination-deficient meiotic nuclei were labeled with anti-c-myc and anti-red1 (meiotic marker, not shown) antibodies. Representative images show maximal localization of Rrd1-MYC (red) within the meiotic nucleoplasm in spo11 RRD1-MYC than in spo11 (non-specific staining). For both spo11 and spo11 RRD1-MYC meiotic nuclei, the background-staining signal for Rrd1-MYC was brought down to the equal level of intensity. The large blue circles represent an arbitrary cytoplasmic boundary whereas the small red circles (created based on DAPI) represent an arbitrary nucleoplasmic boundary. Scale bar represents 1 micron. (B) Western blot showing expression of Rrd1-MYC protein in WT and various spo11 meiotic cells containing an epitope-tagged version of Rrd1. WT and spo11 cells with untagged Rrd1 served as negative controls. (C) Semi-squashed meiotic nuclei were labeled with anti- 71

82 GFP, anti-nsp1, and anti-red1 (meiotic marker) antibodies. Representative images show maximal localization of YFP-Sit4 (green) within the nucleoplasm and minimal YFP-Sit4 staining within the cytoplasm during meiotic prophase. Linear Red1 represents midmeiotic prophase cells. Nsp1 (red) demarcates the nuclear periphery. Scale bar represents 1 micron. 72

83 3.3.5 Residues within Fpr3 s PPIase domain might be essential for Zip1 polycomplex formation Prolyl isomerases catalyze the isomerization of peptidyl prolines (Pemberton, 2006; Pemberton and Kay, 2005). Biochemical studies have shown that the C-terminal domain of Fpr3 corresponding to residues exhibits in vitro PPIase activity (Benton et al., 1994; Manning-Krieg et al., 1994; Shan et al., 1994). We asked whether Fpr3 s PPIase activity is required for Zip1 polycomplex formation in the absence of Spo11 activity. Several amino acid residues such as T345, W363 and F402 residing within the catalytic domain of Fpr3 are essential for its in vitro PPIase function (Hochwagen et al., 2005) (see schematics in Figure 5A). We therefore assessed polycomplex formation in spo11 strains each carrying one out of three fpr3 mutant alleles that have disrupted PPIase activity. We found that the frequency of meiotic cells exhibiting Zip1 polycomplex in the absence of Spo11 (72%; n = 50) is similar to spo11 fpr3-f402y meiotic mutants (72%; n = 50) (Figure 5B) after 15 hours of sporulation. On the contrary, spo11 fpr3-t345a and spo11 fpr3-w363l meiotic nuclei displayed 37% (n = 51) and 36% (n = 50) of Zip1 polycomplex respectively similar to spo11 fpr3 (43.6%; n = 55) (Figure 5B). Thus, our preliminary results suggest that Fpr3-F402 is dispensable whereas both Fpr3-T345 and Fpr3-W363 may be essential for Fpr3 s role in Zip1 polycomplex formation. Apart from T345 s role in Fpr3 s PPIase activity, it is also important for Fpr3 s recombination checkpoint function (Hochwagen et al., 2005). We checked additional alleles of Fpr3, which showed no defect in PPIase activity in vitro but were defective in checkpoint function such as Y386D and F341Y/D342V in spo11 for their involvement in 73

84 Zip1 polycomplex formation (Hochwagen et al., 2005). We noticed a reduction in Zip1 polycomplex frequency in these recombination-checkpoint mutants (33.9% and 36.5% in spo11-y386d and spo11-f341y/d342v respectively; n 56) compared to spo11 (72%; n = 50) (Figure 5B). However, the frequency of Zip1 polycomplex formation in all five spo11 fpr3 mutant alleles after 18 hours of sporulation was found to be ~50% (n 50 for each strain) (Figure 5B). We note that SUMO usually co-localize with Zip1 polycomplex in these mutant strains (Figure 5D). Taken together, our results suggest that four out of five residues within the hydrophobic pocket of Fpr3 s PPIase domain may be essential for promoting Zip1 polycomplex in spo11. We speculate that probably these four residues are important for sustaining physical contacts with Zip1 in order to modulate its capacity to form polycomplex structures at the nucleolus. Since Fpr3 forms polycomplex independent of Zip1 activity and mostly shares the same nuclear compartment (i.e., nucleolus) with Zip1 (data shown in Chapter 4), we asked if any of these aforementioned residues are required for aggregation of Fpr3 itself into a polycomplex. To ensure that we are measuring Fpr3 polycomplexes in meiotic cells, Hop1 (an axial/lateral element protein of the SC) is used as a meiotic marker. We observed that three out of five mutant strains i.e., fpr3-t345a, fpr3-y386d and fpr3- F341Y/D342V in spo11 meiotic cells showed decreased Fpr3 polycomplex frequency (33.3%, 22%, and 20% respectively; Figure 5C) compared to spo11 fpr3-f402y, spo11 fpr3-w363l and spo11 FPR3 (58.5%, 50%, and 56.9% respectively; Figure 5C) after 15 hours of sporulation. We note that spo11 fpr3 failed to display any Fpr3 polycomplexes, as expected. 74

85 Taken together our preliminary data, we conclude that the PPIase domain of Fpr3 and not its PPIase activity and/or recombination-checkpoint function per se might be important for promoting Zip1 polycomplex formation. However, the recombination checkpoint activity of Fpr3 might be important for its aggregation in spo11 meiotic mutants (Table 2). 75

86 A! B! ! Fpr3! Fpr3! N-terminal half! C-terminal half with! PPIase activity! F402Y! Y386D! W363L! T345A! F341Y/D342V!!!!! % of meiotic nuclei with! a Zip1 polycomplex! n 50! spo11 spo11 fpr3 spo11 fpr3-f402y spo11 fpr3-w363l spo11 fpr3-t345a spo11 fpr3-y386d spo11 fpr3-f341y/d342v 15H 18H C! D! E! % of meiotic nuclei with! a Fpr3 polycomplex! % of Zip1 polycomplexes! that are linear! n 50! n 50! 60 n 20! spo11 spo11 fpr3 spo11 fpr3-f402y spo11 fpr3-w363l spo11 fpr3-t345a spo11 fpr3-y386d spo11 fpr3-f341y/d342v spo11 spo11 fpr3 spo11 fpr3-f402y spo11 fpr3-w363l spo11 fpr3-t345a spo11 fpr3-y386d spo11 fpr3-f341y/d342v % of meiotic nuclei with! a SUMO polycomplex! 15H! 15H! 40 15H 18H 20 0 spo11 spo11 fpr3 spo11 fpr3-f402y spo11 fpr3-w363l spo11 fpr3-t345a spo11 fpr3-y386d spo11 fpr3-f341y/d342v 76

87 Figure 5. Hydrophobic pocket-residues of Fpr3 s prolyl isomerase domain might be required for Zip1 and/or Fpr3 polycomplex formation. (A) Schematic representation of a Fpr3 protein showing the C-terminus PPIase domain together with the missense mutations that disrupts the in vivo recombination-checkpoint function and/or the in vitro prolyl isomerase (PPIase) activity of Fpr3. (B-D) Bar graph depicts % of meiotic nuclei featuring Zip1 polycomplexes after 15 and 18 hours of sporulation (n 50 for each column, one replicate) (B); Fpr3 polycomplexes (n 50 for each column, one replicate) after 15 hours of sporulation (C); SUMO polycomplexes (n 50 for each column, one replicate) after 15 hours of sporulation (D) in spo11 NDT80+ meiotic cells containing various mutant alleles of Fpr3 that disrupts its recombination-checkpoint and/or prolyl isomerase (PPIase) function. (E) Bar graph represents % of Zip1 polycomplexes that are linear in various spo11 fpr3 mutant alleles labeled in the X-axis after 15 and 18 hours of sporulation (n 18 for each strain per time-point, one replicate). 77

88 3.3.6 Phosphatase component Pph3 promotes Zip1 polycomplex formation together with Rrd1 Earlier studies have shown that Rrd1 can act as an activator for Pph3, a catalytic subunit of protein phosphatase PP4, and both proteins can physically interact during vegetative growth (Keogh et al., 2006; Van Hoof et al., 2005). A recent study revealed a role for Pph3 during meiotic prophase where it dephosphorylates Zip1 downstream of Spo11 signaling (Falk et al., 2010). Therefore, we asked whether Rrd1 acts on Zip1 indirectly, via its downstream effector Pph3 phosphatase. We also investigated whether these regulators of Zip1 aggregation are also required for Fpr3 aggregation. A. Pph3 acts together with Rrd1 to promote Zip1 aggregation into a polycomplex We first investigated whether Pph3 can promote Zip1 polycomplex in spo11 mutant meiotic cells and whether it acts in Rrd1 s pathway. We compared Zip1 polycomplex frequency in spo11, spo11 pph3, spo11 rrd1, and spo11 pph3 rrd1 strains. We noticed that absence of Pph3 activity in spo11 meiotic cells results in significant reduction of Zip1 polycomplex formation: 50.9% ± 7.9% in spo11, 12.3% ± 7.7% in spo11 pph3, and 12.1% ± 4.2% in spo11 rrd1 (n 50 per replicate; total of three independent replicates). Thus, much like Rrd1, Pph3 is also required for robust Zip1 polycomplex in spo11 strains (Figure 6A). The frequency of Zip1 polycomplex formation in spo11 pph3 rrd1 (8.9% ± 7%; n 50 per replicate; total of three replicates) resembles that of spo11 rrd1, and spo11 pph3, suggesting that Pph3 and Rrd1 act in the same pathway to regulate Zip1. B. Pph3 but not Rrd1 partially promote Fpr3 aggregation into a polycomplex 78

89 To test the role of Rrd1 and Pph3 on Fpr3 polycomplex in SPO11-deficient cells, spo11 pph3, spo11 rrd1, and spo11 rrd1 pph3 meiotic mutants were assessed after 15 hour of sporulation. Although spo11 pph3 strains exhibited a reduced level of Fpr3 polycomplex, the diminishment of Fpr3 polycomplex is not as great as the diminishment of Zip1 polycomplex (n 100 per replicate) (Figure 6B). Therefore, we conclude that both Rrd1 and Pph3 are dispensable per se for most Fpr3 polycomplex formation but Pph3 is required for robust Zip1 polycomplex formation. Since spo11 rrd1, spo11 pph3 and spo11 rrd1 pph3 show a similar reduction in Zip1 polycomplex frequency and Rrd1 has been implicated in Pph3 activation in other cellular contexts, we suggest that Rrd1 promotes Zip1 polycomplex formation indirectly by activating Pph3. Pph3 may also partially affect the formation of Zip1 polycomplex by promoting Fpr3 aggregation. To test the idea that Rrd1 is activating Pph3 for Zip1 polycomplex formation, we will overexpress PPH3-MYC in spo11 rrd1 (spo11 rrd1 PPH3-MYC-OE) mutant strains to investigate whether overexpression of Pph3-MYC can rescue the decreased Zip1 polycomplex phenotype in spo11 rrd1 meiotic mutants. C. Zip1-S75 is not a Pph3 substrate for Zip1 polycomplex formation Pph3 is a catalytic component of a serine-threonine phosphatase (PP4) and has been shown in a recent study to target phosphorylated Zip1-S75 (Zip1-S75-P) downstream of Spo11 signaling (Falk et al., 2010; Keogh et al., 2006). Consistent with this observation made by Falk et al., (in SK1 background), we also identified an accumulation of slower migrating bands of Zip1 in mutants lacking Pph3 (in BR background) on a Western blot (Figure 6D). However, we noticed that the appearance of these higher migrating forms of 79

90 Zip1 is dependent on Spo11 function (Figure 6D). Therefore, we wonder whether Pph3 acts on only one phosphorylated serine/threonine residue within Zip1 in spo11 mutant strains. To determine whether Pph3 dephosphorylates Zip1-S75-P to promote Zip1 polycomplex in spo11 mutants, we analyzed Zip1 polycomplex frequency in spo11 pph3 containing zip1-phosphoresistant (S75A) or zip1-phosphomimetic (S75D) mutant alleles, after 15 hours of sporulation. zip1-s75a did not rescue the reduced Zip1 polycomplex phenotype in spo11 pph3 mutants (Figure 6C). Consistent with this observation, we failed to detect Zip1-S75-P bands in spo11 pph3 meiotic cells on a Western blot using an anti-zip1-s75-p antibody (Figure 6E). Together, these data suggest that unphosphorylated Zip1-S75 is not sufficient to promote Zip1 polycomplex. We speculate that some other phospho-serine/threonine site(s) in Zip1 might be a target for Pph3 to regulate Zip1 polycomplex. To test the hypothesis that Rrd1 is acting through Pph3 phosphatase in regulating Zip1 s behavior in pairing-defective cells, we will monitor Zip1 linear assemblies in spo11 zip3 fpr3, and spo11 zip3 fpr3 rrd1 meiotic mutants that are missing Pph3 function. If, spo11 zip3 fpr3 pph3 meiotic cells exhibit increased penetrance of Zip1 linear elaborations like spo11 fpr3 zip3 rrd1 meiotic cells, then it will further substantiate the idea that Rrd1 activates Pph3 in order to regulate Zip1 during recombination-deficient meiosis. Additionally, we will overexpress Pph3 in spo11 and spo11 rrd1 mutants and investigate Zip1 polycomplex formation. An increase in Zip1 polycomplex frequency will further confirm the above hypothesis. 80

91 A! B! % of meiotic nuclei displaying! a Zip1 polycomplex! n 50 per replicate! *! *! *! spo11 spo11 fpr3 spo11 rrd1 spo11 pph3 spo11 pph3 fpr3 spo11 pph3 rrd1 % of meiotic nuclei displaying! a Fpr3 polycomplex! n 100 per replicate! *! spo11 spo11 pph3 spo11 rrd1 spo11 pph3 rrd1 C! % of meiotic nuclei with! a Zip1 polycomplex! ! 67! 100! 60! 160! 155! spo11 spo11 pph3 spo11 pph3 zip1-s75a spo11 zip1-s75d spo11 pph3 zip1-s75d spo11 zip1-s75a Figure 6. Pph3 phosphatase promotes Zip1 and Fpr3 polycomplex formation in spo11 meiotic mutants. (A) Bar graph indicates % of meiotic nuclei displaying a Zip1 polycomplex [n 50 for each strain per replicate; total of three replicates] in various spo11 mutants (mentioned in the X-axis). The strain pair that show statistical significance are as follows: (p value = , , and by two-tailed unpaired t test with Welch s correction for spo11 versus spo11 pph3, spo11 versus spo11 pph3 rrd1 and spo11 versus spo11 pph3 fpr3 respectively). Asterisk represents statistical significance. Error bars indicate mean with SD. (B) Bar graph indicates % of meiotic nuclei containing a Fpr3 polycomplex [n 100 for each strain per replicate; total of two replicates] in different spo11 mutants (labeled in the X-axis). Asterisk represents statistical significance. Error bars indicate mean with SD. (C) Bar graph shows % of meiotic nuclei with a Zip1 polycomplex in spo11 or spo11 pph3 nuclei containing either a phosphoresistant or a phospho-mimetic form of Zip1. Top of each column displays total number of meiotic nuclei scored for each given strain. 81

92 D! E! spo11 rrd1 pph3! rrd1 pph3! spo11 rrd1! rrd1! spo11 pph3! pph3! spo11! WT! zip1! Marker! spo11 pph3! pph3! zip1! Marker! Zip1! *" α Zip1! 250! 150! 100! 75! Zip1-S75-P! Non-specific protein! bands! *" *" *" *" α Zip1-S75-P 250! 150! 100! 75! 50! 37! 25! 20! Figure 6. Pph3 phosphatase promotes Zip1 and Fpr3 polycomplex formation in spo11 meiotic mutants. (D) Western blot displays a Spo11-dependent accumulation of a slower migrating band of Zip1 in mutants lacking Pph3 or Rrd1 (in BR background). The asterisk indicates absence of Zip1 protein expression in rrd1 pph3 strains. (E) Western blot shows a Spo11-dependent appearance of Zip1-S75-P band in pph3 meiotic cells using an anti-zip1-s75-p antibody. Asterisks indicate non-specific protein bands (served as loading control). 82

93 Table 1. Spore viability Distribution of tetrad types (%) Strain Genotype Tetrads Total 4-sv 3-sv 2-sv 1-sv 0-sv Viable Spore dissected spores spores viability PM31 fpr PM28 zip PM32 fpr3 zip PM30 rrd PM36 fpr3 rrd PM29 zip3 rrd PM37 fpr3 zip3 rrd PM62 pph PM179 pph3 rrd PM178 pph3 rrd1/ PM177 rrd1 pph3/ PM219 pph3 zip PM230 pph3 fpr3 zip PM229 pph3 rrd1 fpr3 zip PM9 RRD1-MYC PM10 RRD1-MYC/rrd PM26 SIT4-OE PM97 sit4/sit PM157 sit4 N/A PM94 Pscc1[SIT4]/SIT PM99 Pscc1[SIT4]/Pscc1[SIT4] PM92 YFP-SIT4/SIT

94 Table 2. Zip1 and Fpr3 polycomplex formation in spo11 meiotic cells containing fpr3 mutant alleles that are defective in PPIase and/or recombination-checkpoint function Genotype! Zip1! Fpr3! PPIase! Checkpoint! Polycomplex! Polycomplex! Mutant! Mutant! spo11 fpr3-f402y! Wild-type! Wild-type! Yes! No! spo11 fpr3-w363l! Reduced! Wild-type! Yes! No! spo11 fpr3-t345a! Reduced! Reduced! Yes! Yes! spo11 fpr3-y386d! Reduced! Reduced! No! Yes!! spo11 fpr3-f341y/d342v! Reduced! Reduced! No! Yes! 84

95 3.4 Discussion Zip1 regulation in the absence of double-strand breaks: Co-existence of parallel pathways Distinct pathways, governed by Fpr3 and Rrd1 peptidyl-prolyl isomerases (PPIase), operate for the timely formation of Zip1 polycomplex in absence of recombination and/or homolog pairing. Moreover, Fpr3 and Rrd1, in collaboration with Zip3 (a meiosisspecific E3 SUMO ligase protein), prevent premature SC assemblies on unpaired homologs. Absence of Fpr3 or Rrd1 in a spo11 mutant reduces Zip1 polycomplex formation and instead causes Zip1 to localize to the meiotic nucleoplasm. Missing both Fpr3 and Rrd1 function further reduces Zip1 polycomplex formation in spo11 meiotic cells suggesting that these two prolyl isomerases act in parallel pathways. Moreover, while Fpr3 is a FK506 binding class of PPIase, Rrd1 belongs to a completely separate family of PPIase (Leulliot et al., 2006). Therefore, these two prolyl isomerases, Fpr3 and Rrd1, could work on Zip1 directly or through different protein targets to promote Zip1 polycomplex formation and Zip1 polymerization on unpaired chromosomes. Consistent with this idea, Fpr3 co-localizes with Zip1 polycomplex structures in pairing defective mutants (MacQueen and Roeder, 2009), while epitope-tagged Rrd1 localizes to the meiotic nucleoplasm. Unlike Fpr3, Rrd1 is not detected within a polycomplex. Moreover, Rrd1 is dispensable for Fpr3 to co-localize with Zip1 polycomplex. Together these results suggest that Rrd1 is regulating Zip1 in parallel with Fpr3. While Fpr3 promotes Zip1 polycomplex formation in the absence of DNA breaks, Zip3 acts to diminish Zip1 polycomplex structures (MacQueen and Roeder, 2009). Zip3 85

96 also localizes with Zip1 at centromeres (Tsubouchi et al., 2008). When spo11 cells lack both Fpr3 and Zip3, Zip1 assembles linear stretches from centromeres, on unpaired chromosomes. Absence of Rrd1 in spo11 zip3 fpr3 causes an increased penetrance of aberrant linear Zip1 elaborations on unpaired chromosomes and a decrease in Zip1 polycomplexes. Also, linear Zip1 polycomplexes that are frequently observed in spo11 fpr3 zip3 cells decrease dramatically upon deletion of RRD1 in such mutant strains (spo11 zip3 fpr3 rrd1) as if linear polycomplexes are an intermediate between normal polycomplexes and aberrant SCs. Taken together we suggest that Rrd1, in parallel with Fpr3 and Zip3, regulates the overall nuclear distribution of Zip1 in cells that fail to initiate meiotic recombination. We propose that Fpr3 and Rrd1 might directly or together with molecular chaperones regulate the transition from inactive Zip1 (in polycomplexes/nucleoplasm) to active Zip1 (in SCs). Signal downstream of recombination initiation might prevent Fpr3 and Rrd1 from triggering the formation of Zip1 polycomplex. Absence of recombination signals allows Fpr3 and Rrd1 to promote Zip1 polycomplex formation such that Zip1 does not assemble promiscuously on unpaired chromatin. All these observations raise the possibility that both Fpr3 and Rrd1 (in the nucleoplasm) and Zip3 (at centromeres) might directly or indirectly interact with Zip1 to regulate Zip1 s ability to either form polycomplex or assemble aberrant SC in a recombination deficient cell during meiosis Fpr3 might directly regulate Zip1 to form a polycomplex Prolyl isomerases catalyze the cis-trans isomerization of peptidyl prolines (Pemberton, 2006), and they often function as molecular chaperones (Parsell and 86

97 Lindquist, 1993). Fpr3 belongs to the nuclear FKBP class of peptidyl-prolyl isomerase (PPIase) proteins with a conserved C-terminal PPIase domain ( amino acid residues) that displays in vitro (PPIase) activity (Arevalo-Rodriguez et al., 2004; Benton et al., 1994; Hochwagen et al., 2005). Fpr3 co-stains with Zip1 within a polycomplex in recombination-deficient mutants and when such mutants loose Fpr3 function, majority of Zip1 localize to the nucleoplasm instead of aggregating within a polycomplex (MacQueen and Roeder, 2009). This suggests that Fpr3 might directly regulate Zip1 s nuclear distribution during meiotic prophase. So, how does Fpr3 affect Zip1 polycomplex formation in the absence of DSBs? One might envision that Fpr3 (via its PPIase domain) could directly act on Zip1 and target a proline residue(s) in the N- and/or C-terminal domains of Zip1. Mutation of any three amino acid residues (T345, W363 and F402) that lie within the hydrophobic pocket of Fpr3 s PPIase domain has been shown to individually disrupt its in vitro PPIase function (Hochwagen et al., 2005). We tested all three of these mutant alleles of Fpr3 in spo11 to determine their role in Zip1 polycomplex formation after 15 hours of sporulation. We found that two out of three PPIase mutants of Fpr3 showed reduced Zip1 polycomplex at 15-hour time-point. Interestingly, one of these mutants (T345) also disrupts Fpr3 s recombination checkpoint function (Hochwagen and Amon, 2005). Testing the other two checkpoint mutants of Fpr3 (i.e., fpr3-y386d and fpr3-f341y/d342v) in spo11 revealed that all three of them result in a reduction in Zip1 polycomplex formation at 15-hour time-point. Taken together these preliminary data, we suggest that most of the hydrophobic pocket-residues within the PPIase domain of Fpr3 might be essential for Zip1 polycomplex assembly. While the PPIase or checkpoint function of Fpr3 might not be required for Zip1 regulation per se, 87

98 Fpr3 might utilize its PPIase domain to promote Zip1 aggregation into a polycomplex. We speculate that all these residues within the PPIase domain may make direct contacts with Zip1 to modulate its capacity to form polycomplex structures. However, we noticed that at a later time-point (18 hour), the Zip1 polycomplex formation in these various spo11 fpr3 mutants appears more like that of spo11 mutants. We hypothesize that spo11 fpr3 mutants together with some of the spo11 fpr3 mutant alleles might be delayed in meiotic progression compared to spo11 mutants; therefore in the future we will assess Zip1 polycomplex formation in spo11 mutants containing various missense mutations in FPR3 such as (fpr3-f341y/d342v, fpr3-t345a, fpr3- W363L, fpr3-y386d and fpr3-f402y) at an earlier time-point (12 hour). We will also perform a time-course experiment to measure sporulation efficiency in the aforementioned mutant strains as a read out for meiotic progression. Like Fpr3, Fpr4 also belongs to the nuclear FKBP class of PPIase proteins (Harding et al., 1989; Siekierka et al., 1989). Therefore, while both Fpr3 and Fpr4 share a conserved C-terminal PPIase domain (85% sequence identity) with in vitro PPIase activity, the N- terminal halves of these two proteins only share 58% sequence homology. Unlike Fpr3, absence of Fpr4 function in spo11 mutants does not alter Zip1 polycomplex formation. This further supports the idea that the PPIase activity of Fpr3 might be dispensable for Zip1 polycomplex formation, and residues in the N-terminal acidic domain of Fpr3 might be essential to drive Zip1 aggregation into a polycomplex. Our vegetative yeast two-hybrid studies failed to demonstrate positive interactions between full-length or truncated versions of Fpr3 and Zip1. We reasoned that prolyl isomerizations are enzyme-substrate reactions and therefore could be transient in nature. 88

99 Fpr3 could weakly or transiently interact with Zip1 as most enzyme-substrate reactions and therefore might have escaped detection by our yeast two-hybrid assay. Alternatively, the lack of positive interactions could also result from the fact that Zip1 may undergo post-translational modification(s) (PTMs) for polycomplex formation before becoming a substrate of Fpr3. PTMs can alter protein folding, sometimes render binding pocket of a substrate inaccessible to its interacting partners. Therefore, testing few other smaller domains of Zip1 might be useful. In the future, to investigate direct interactions between Fpr3 and Zip1 undergoing meiosis-specific PTMs, we will assess Zip1-YFP expression in live Spo11-minus meiotic cells (spo11 ndt80 gal4 gal80 P GAL1 [ZIP1-YFP] GAL4-ER/-) using a fluorescence microscope. We will use the Gal4-Gmc2-AD and Gal4-Ecm11- DBD fusions that showed a robust interaction in vegetative yeast two-hybrids (Humphryes et al., 2013) as a positive control for the meiotic yeast two-hybrid assay. Alternatively, one can determine direct interaction between Fpr3 and Zip1 by assaying purified full-length and/or truncated versions of Fpr3 and Zip1 in an in vitro pull down system Rrd1 might indirectly act on Zip1 via serine-threonine phosphatase components to promote polycomplex formation A. Rrd1 might activate Pph3 to promote Zip1 polycomplex formation Previous reports have shown that Rrd1 can function as an activator of Pph3, a catalytic subunit of PP4 phosphatase and interacts physically with it during normal yeast growth (Keogh et al., 2006; Van Hoof et al., 2005). Another study demonstrated Zip1 is a target of Pph3, downstream of Spo11 function (Hochwagen et al., 2005). This led us wonder if 89

100 Rrd1 is acting on Zip1 indirectly through Pph3. We demonstrated that deletion of PPH3 in spo11 severely reduces Zip1 polycomplex similar to spo11 rrd1 mutants, and when both Rrd1 and Pph3 functions are missing in spo11 mutants Zip1 polycomplex is not reduced further. These data suggest that both Rrd1 and Pph3 are acting in a single pathway to promote Zip1 polycomplexes. We propose that Rrd1 activates Pph3 independent of Spo11 and active Pph3 is required for normal Zip1 polycomplex assembly. Although, we failed to notice Rrd1 within polycomplexes, we often found Pph3 co-localizing with polycomplex structures in a Zip1-dependent manner. Therefore, we speculate that Rrd1 might act on Pph3 as a prolyl isomerase for its activation as it does during vegetative growth whereas Pph3 may directly interact with Zip1. To further confirm whether Rrd1 activates Pph3 to promote Zip1 polycomplex formation, we will assess if overexpression of Pph3 in spo11 rrd1 (i.e., spo11 rrd1 PPH3-OE) mutants phenocopies spo11 mutation. Since both Pph3 and Fpr3 co-localize with Zip1 within a polycomplex structure, we speculate that both these proteins might directly interact with Zip1 through binding of separate Zip1 domains. Fpr3 might act on the N- and/or C-terminal domain of Zip1 through proline residues whereas Pph3 may target the SQ/TQ sites that are mostly present within the central coiled-coil domain of Zip1. While Fpr3 exhibits almost 100% co-localization with Zip1 within a polycomplex, we often ( 65%) observed Pph3-MYC co-staining with Zip1 polycomplex structures. Moreover, while Fpr3 aggregation into a polycomplex is Zip1-independent, coaggregation of Pph3-MYC within a polycomplex occurs in a Zip1-dependent manner (Chapter 4). Together these observations support the idea that Fpr3 and Pph3 are acting 90

101 in parallel pathways for Zip1 regulation. We speculate that Fpr3 might act as a protein chaperone for Zip1 within a polycomplex, therefore displaying a strong and steady interaction/staining pattern within a Zip1 polycomplex while Pph3-Zip1 interaction might be weak and transient. Alternatively, the Pph3-Zip1 interaction might often render the C- terminal MYC-epitope tag on Pph3 non-accessible to the anti-c-myc antibody in our chromosome-spread preparations. Pph3 is a serine-threonine phosphatase component and has been shown to target Zip1- S75 downstream of Spo11 function (Falk et al., 2010). We wonder whether Pph3 targets SQ/TQ motifs on Zip1 to promote polycomplex formation. There are nine SQ/TQ motifs in Zip1, majority of them (seven) are present within the middle coiled-coil domain of Zip1, while the remaining two SQ/TQ sites (i.e., S75 and T754) are located in the N- and C-terminal domains of Zip1 respectively. However, our preliminary data show that Pph3 does not act on Zip1-S75 to promote Zip1 polycomplex, and Zip1-S75 phosphorylation depends on Spo11 function. Therefore, we propose that Pph3 might target another phosphorylated serine-threonine residue in Zip1 (apart from S75) to promote Zip1 polycomplexes. To further understand the molecular mechanism underlying Zip1 polycomplex formation, we will test if zip1-9(s/t)a (i.e., S75A, T187A, T434A, S473A, S515A, S546A, S593A, S726A, T754A) can rescue the reduced polycomplex defect of spo11 pph3 meiotic mutants. Alternatively, we can look for Spo11-independent dephosphorylation of Zip1 by Pph3 on a phos-tag gel (spo11 versus spo11 pph3 mutants). We will look for Zip1 mobility on a 1D gel/western blot. Accumulation of slower migrating bands of Zip1 was seen in mutants lacking Pph3 on a Western blot. However, we failed to notice any detectable 91

102 shift in Zip1 mobility in spo11 pph3 mutants on a Western blot. Therefore, we speculate that Pph3 targets only one phospho-site within Zip1 apart from Zip1-S75. Using a phostag gel one can identify a single serine-threonine phosphorylation event (Kinoshita et al., 2009). Furthermore, Pph3 partially affects Fpr3 aggregation into a polycomplex. We observed that Fpr3 aggregation in spo11 meiotic mutants is only partially reduced in absence of Pph3 in an Rrd1-independent manner. We hypothesize that Pph3 s effect on Zip1 polycomplex formation might partially occur through Fpr3. Consistent with this idea, we identified only one SQ/TQ motif (T90) and two consecutive serine residues (S80 and S81) that are predicted sites for phosphorylation within the N-terminal half of Fpr3. We speculate that Pph3 might act on one of these residues to regulate Fpr3 aggregation. B. Rrd1 might inhibit Sit4 to regulate Zip1 s nuclear distribution Sit4 is a catalytic subunit of PP2A, another serine-threonine phosphatase (Janssens and Goris, 2001). Rrd1 displays both genetic and physical interactions with Sit4 and acts on Sit4 as a prolyl isomerase for its activation during vegetative growth (Douville et al., 2004; Mitchell and Sprague, 2001; Van Hoof et al., 2005). Moreover, two lines of evidence have revealed that both these proteins (Rrd1 and Sit4) share the same cellular niche, the cytoplasm during budding yeast mitosis. While Rrd1 localizes to both the nucleus and the cytoplasm, Sit4 has only been observed in the cytoplasm (Douville et al., 2004; Sutton et al., 1991). Our preliminary results have shown that like Rrd1, epitopetagged Sit4 also localizes to the nucleoplasm along with localization to the cytoplasm in a meiotic cell and is not found within the Zip1 polycomplex. This observation suggests that 92

103 Rrd1 and Sit4 could interact during meiosis. Furthermore, overexpression of Sit4 caused an increased penetrance of linear Zip1 elaborations and decreased Zip1 polycomplex formation in spo11 zip3 fpr3. This phenotype mimics deletion of Rrd1 function in spo11 zip3 fpr3, and Sit4 overexpression in spo11 zip3 fpr3 rrd1 does not alter the Zip1 s linear elaboration and polycomplex phenotypes any further. Moreover, Sit4 overexpression in spo11 reduces polycomplex formation like loss-of-function of Rrd1 in spo11, and Sit4- diminution in spo11 does not alter Zip1 polycomplex formation in spo11. Therefore, taken together our observations we propose that Rrd1 might inhibit Sit4 for Zip1 regulation. However, to determine whether Pph3 and Sit4 exhibit redundant functions downstream of Rrd1 for regulating Zip1 s nuclear distribution, we will investigate whether overexpression of Pph3-MYC in spo11 fpr3 zip3 (i.e., spo11 fpr3 zip3 PPH3- MYC-OE) phenocopies loss-of-function of Rrd1 in spo11 fpr3 zip3 similar to Sit4. C. Relationships between Rrd1, Pph3 and Sit4 with respect to Zip1 regulation Based on our observations, we propose several models on the probable relationships between Rrd1 prolyl isomerase, and the catalytic phosphatase components, Pph3 and Sit4, with respect to Zip1 regulation in recombination-deficient meiotic prophase cells. Rrd1, Pph3 and Sit4 might be in a linear pathway for Zip1 regulation. Model 1: Sit4 prevents Zip1 polycomplex formation. Rrd1 activates Pph3 and active forms of Pph3 inhibit Sit4 (Figure 7). Model 2: Pph3 promotes Zip1 polycomplex formation. Rrd1 inhibits Sit4 and Sit4 inhibits Pph3 (Figure 7). 93

104 Alternatively, Pph3 and Sit4 might be parallel downstream targets of Rrd1 in separate cellular compartments (nucleus and cytoplasm) for Zip1 regulation. Model 3: Rrd1 might inactivate Sit4 in the cytoplasm; nuclear pool of inactive forms of Sit4 might fail to act on Zip1 to promote Zip1 s transition from an inactive form to active form. On the other hand, Rrd1 might activate Pph3 in the nucleus, and active forms of Pph3 might promote Zip1 polycomplex formation by preventing the transition of inactive Zip1 to active Zip1 (Figure 7). Together, we speculate that Fpr3 might directly act on the N- or C-terminal domains of Zip1 (that contain all the proline residues) whereas Rrd1 via Pph3 and/or Sit4 phosphatase component(s) might target a serine/threonine residue on the middle coiledcoil domain of Zip1. Thus, Fpr3 and Rrd1 (via Pph3 and/or Sit4) might regulate separate domains of Zip1 at different cellular locations (cytoplasm, nucleus or nucleolus), and that might be the reason why these two prolyl isomerase proteins (Fpr3 and Rrd1) are in separate pathways for Zip1 polycomplex regulation Questions addressed in this study In this chapter, we primarily focused on whether Fpr3 and Rrd1 prolyl isomerases function together or in parallel to regulate Zip1 s nuclear distribution in absence of homologous recombination and/or pairing. We investigated whether Fpr3 promotes Zip1 aggregation into a polycomplex via its PPIase domain, and if Rrd1 regulates Zip1 polycomplex formation through regulation of the phosphatase components Pph3 and/or Sit4. 94

105 3.4.5 Current model Based on the ability of various spo11 meiotic mutants to display Zip1 polycomplex, we propose a model on how the two prolyl isomerases, Fpr3 and Rrd1 (via catalytic subunits of serine-threonine phosphatases: Pph3 and/or Sit4) might regulate the nuclear distribution of Zip1 when budding yeast cells fail to undergo meiotic recombination. We hypothesize that Fpr3 might act directly on Zip1 through residues in its C-terminal half (PPIase domain), but without canonical prolyl isomerase activity, to promote Zip1 aggregation into a polycomplex. On the other hand, we propose that Rrd1 promotes Zip1 polycomplex formation indirectly through the activation of Pph3 and inhibition of Sit4 phosphatase components, and Pph3 and/or Sit4 might act on Zip1 to promote or prevent Zip1 polycomplex formation respectively (Figure 7). 95

106 Unpaired Chromosomes! Spo11! PPIase! Rrd1! Fpr3! Phosphatase! components! Pph3! (PP4)! Fpr3! polycomplex! Sit4! (PP2A)! Zip1! polycomplex! Paired Chromosomes! 1. Rrd1! Pph3! Sit4! 2. Rrd1! Sit4! 3. Rrd1! Pph3! Pph3! Sit4! Zip1 polycomplex! formation! SC Assembly!! In mutant situations where polycomplex formation is diminished,! ectopic SCs appear frequently! Figure 7. A cartoon represents proposed model on how Fpr3 and/or Rrd1 might regulate Zip1 s nuclear distribution via parallel pathways. In absence of recombination and/or homolog pairing, we propose that Fpr3 might directly interact with Zip1 to promote polycomplex formation while Rrd1 might act on Zip1 indirectly via downstream target proteins (Pph3 and/or Sit4). In our working model, we schematically displayed that Fpr3 in parallel with Rrd1 (via activation of Pph3 and/or inhibition of Sit4) might function to regulate Zip1 folding to promote Zip1 polycomplex formation [i.e., by inhibiting the transition of inactive Zip1 (that forms polycomplex or remain diffused in the nucleoplasm) to active Zip1 (that forms Synaptonemal Complex)]. Signal downstream of Spo11 discourages Fpr3 and Rrd1 to promote Zip1 polycomplex and favors linear assemblies of Zip1 on paired homologs. 96

107 Chapter 4 The Relationship Between Zip1 and Its Regulators Within the Polycomplex 97

108 4.1 Abstract During budding yeast meiosis, Fpr3 and Rrd1 prolyl isomerases together with a phosphatase component Pph3 promote Zip1 (an essential component of the SC central region) aggregation into a polycomplex when early steps in recombination initiation and homolog pairing are defective. Here we demonstrated that such Zip1 aggregates localize to the nucleolus and form independently of Pch2, a meiotic checkpoint protein that also shows nucleolar localization. Like Fpr3, Pph3 often co-localizes with Zip1 polycomplex, and relies on Zip1 for its aggregation within a polycomplex. While Zip1 requires Fpr3 for its full capacity to form polycomplex, Fpr3 forms polycomplex independent of Zip1. Such Zip1-independent, nucleolus-anchored Fpr3 polycomplexes are devoid of SUMO (another SC central region protein) and other SC initiation proteins that are normally present within polycomplexes. However, SUMO and the Synapsis Initiation Complex (SIC) proteins are dispensable for polycomplex formation. Taken together, our results are consistent with a model in which Fpr3 forms polycomplex independently of Zip1 and may act directly on Zip1 to promote its aggregation into a polycomplex, while SUMO and the SICs localize to the Fpr3 polycomplexes indirectly via an interaction with Zip Introduction The Synaptonemal Complex (SC) is a multiprotein tripartite structure that forms at the interface of two completely aligned homologs (Page and Hawley, 2004). Zip1, a meiosis-specific protein with a central coiled-coil domain, is an important SC central region as well as central element component (Sym et al., 1993; Sym and Roeder, 1995). Zip1 forms parallel homo-dimers and several such dimers come together and multimerize 98

109 to form a stable full-length SC unit between homolog axes pairs (Dong and Roeder, 2000; Tung and Roeder, 1998). The peptidyl-prolyl isomerases, Fpr3 and Rrd1, along with a serine-threonine phosphatase component Pph3 promote Zip1 aggregation into a polycomplex structure in recombination-deficient meiotic mutants (MacQueen and Roeder, 2009); (Chapter 3). Zip1 also displays a highly ordered, several parallel SC-like structural organization within a polycomplex (Dong and Roeder, 2000). Dong and Roeder showed in an elegant immuno-em experiment that within a polycomplex, gold-conjugated anti-zip1-n antibody staining lie in the center (coinciding with the lightly stained regions) flanked by staining pattern observed with gold-labeled anti-zip1-c antibodies on either ends (coinciding with the densely stained regions). Interestingly, proteins that are normally essential for SC polymerization along the length of aligned homologs, such as SUMO, Zip2, Zip3 and Zip4, are also found associated with such polycomplexes (Agarwal and Roeder, 2000; Cheng et al., 2006; Chua and Roeder, 1998; Tsubouchi et al., 2006). SUMO (Small Ubiquitin like Modifier) is a small peptide that becomes covalently linked to other proteins (Schwartz and Hochstrasser, 2003). SUMO modification regulates protein-protein interaction, protein stability and protein localization (Johnson, 2004; Potts and Yu, 2005; Zhao and Blobel, 2005). During meiotic prophase, SUMO proteins co-localize with SC in a Zip1-dependent manner (Hooker and Roeder, 2006). Recently, via Structured-Illumination Microscopy, SUMO has been identified as a novel candidate protein of the SC central element. Depletion of SUMO during otherwise normal meiotic prophase results in defective SC assembly and formation of Zip1 polycomplex structures (Voelkel-Meiman et al., 2013). 99

110 The Synapsis Initiation Complex (SIC) proteins Zip2, Zip3 and Zip4 localize as multiple discrete foci on meiotic chromosomes during early and mid prophase and are thought to mark the sites of SC/Zip1 elaborations. Meiosis-specific SIC proteins such as Zip2 and Zip4 trigger SC initiation and its polymerization between paired homologs (Chua and Roeder, 1998; Tsubouchi et al., 2006). In zip2 or zip4 meiotic mutants, Zip1 fails to assemble SC on chromosomes and instead localizes to several discrete foci on chromosomes in addition to aggregating into polycomplex. Zip3, another meiosisspecific SIC protein affects SC assembly indirectly by helping Zip2 and Zip4 recruitment to the chromosomes and/or stabilize Zip2-Zip4 association with chromosomes. Moreover, zip3 meiotic cells display defective SC assembly and robust Zip1 polycomplex formation (Agarwal and Roeder, 2000). Polycomplexes and SCs have a similar composition, and both exhibit a higher order organization (Dong and Roeder, 2000). Proteins that vary in their functions with respect to SC assembly (for example SICs and SUMO) usually exhibit different localization patterns within SC structures (Agarwal and Roeder, 2000; Cheng et al., 2006; Chua and Roeder, 1998; Tsubouchi et al., 2006). Consistent with this idea, SICs do not localize in the same way as SUMO within polycomplexes and this might suggest separate function of SICs and SUMO within polycomplexes. SUMO, like Fpr3, localizes uniformly throughout Zip1 polycomplexes (Cheng et al., 2006; MacQueen and Roeder, 2009). Zip3, Zip2 and Zip4 proteins, on the other hand, display unique localization patterns within a polycomplex. Zip3 forms polar extensions in addition to localizing to the entire body of the polycomplex. Zip2 and Zip4 appear enriched at the poles of Zip1 polycomplexes. The polarized distribution of Zip3, Zip2 and Zip4 in polycomplexes is dependent on Zip2 and 100

111 Zip4 functions. On the contrary, Zip2 and Zip4 are mutually dependent on each other but not on Zip3 for their polarized distribution within polycomplex (Tsubouchi et al., 2006). Here, we provide an epistasis model of Zip1 polycomplex formation. We found that Fpr3 aggregation into a polycomplex occurs independent of Zip1 function. Furthermore, SUMO and SIC proteins rely on Zip1 for co-localization to such Fpr3 polycomplex structures. Consistent with this idea, SUMO and the SICs are dispensable for polycomplex formation. We propose that Fpr3 acts upstream of SUMO and SICs in the polycomplex assembly pathway. SUMO and SICs might stabilize and/or contribute to the overall structural organization of the polycomplex. 4.3 Results Fpr3 but not Zip1 depend on Pch2 for their aggregation into a polycomplex at the nucleolus Unlike Zip1 in SCs that are seen at the interface of paired homologs, Zip1 polycomplex is not found associated with chromatin. However, polycomplexes are retained in chromosome spreads unlike most nucleoplasmic structures. We therefore investigated whether Zip1 polycomplex structures associate with the nucleolus. Staining of surface-spread Spo11-deficient meiotic nuclei with Zip1 and nucleolar protein Nop6- specific antibodies revealed co-localization of Zip1 polycomplex structure with the nucleolus [96.5% and 80.8% in ndt80 spo11 (n = 57) and spo11 (n = 52) meiotic nuclei respectively] (Figure 1A). Next, we checked co-localization of Zip1 with Nop6 protein in mutants that display decreased Zip1 polycomplexes. We noticed that, among the few Zip1 polycomplexes that are seen in spo11 pph3 mutants (27 out of 160 nuclei display 101

112 Zip1 polycomplexes), a majority of them are associated with the nucleolus (70.4%, n = 27). Similarly, in ndt80 spo11 fpr3, 80% of Zip1 polycomplexes show nucleolar localization (n = 20). We need to check Zip1-Nop6 co-localization at polycomplex in spo11 rrd1 meiotic mutants. A conserved AAA ATPase Pch2, functions in a meiotic checkpoint, and often localizes to the nucleolus in both vegetative and meiotic cells (San-Segundo and Roeder, 1999; Wu and Burgess, 2006; Erzberger and Berger, 2006; Borner et al., 2008). Moreover, Pch2 co-aggregates with Zip1 within a polycomplex in pairing-defective meiotic cells (San-Segundo and Roeder, 1999). To ask whether Zip1 polycomplex formation depends on Pch2, we looked at Zip1 polycomplex frequency in spo11 pch2. We found that Zip1 polycomplex frequency in spo11 remains unaltered in the absence of Pch2 (Figure 1B). However, we observed that Fpr3 polycomplexes are drastically reduced in spo11 pch2 (23.5%, n = 51) compared to spo11 (56.9%, n = 51) (Figure 1B). This data on Fpr3 polycomplex formation is derived from a single experiment, therefore another replicate is required to confirm this result. Thus, in absence of recombination, SC central element protein, Zip1, is sequestered to the nucleolus independent of Pch2 and localization of Fpr3 to the nucleolus may depend on Pch2. 102

113 A! spo11 ndt80! B! DAPI Zip1 Nop6! % of meiotic nuclei with a Zip1 polycomplex! spo11 spo11 ndt80 n 50 per replicate! n 50! 80 spo11 % of Zip1 polycomplex! with Nop6! spo11 pch2 n 50! % of meiotic nuclei with a Fpr3 polycomplex! spo11 Co-localized/Adjacent Apart spo11 pch2 Figure 1. Fpr3 but not Zip1 rely on Pch2 for their aggregation into a polycomplex at the nucleolus in pairing-defective meiotic nuclei. (A) Representative image of an ndt80 spo11 meiotic nucleus showing co-localization of Zip1 polycomplex structure with the nucleolar protein Nop6 (left). Scale bar represents 1 micron. Bar graph (right) represents % Zip1 polycomplex that are either associated (co-localized/adjacent) or not associated (apart) with the nucleolus in spo11 and spo11 ndt80 (n 50, one replicate). (B) Bar graph shows % spo11 and spo11 pch2 meiotic nuclei with a Zip1 polycomplex (n 50 for each strain per replicate, total of two replicates) (left) and a Fpr3 polycomplex (n 50 for each strain, one replicate) (right). 103

114 4.3.2 Fpr3 aggregation into polycomplex occurs independently of Zip1, but requires Zip1 for co-localization with SUMO and Synapsis Initiation Complex (SIC) proteins In a homolog pairing-defective meiotic mutant such as spo11, robust Zip1 polycomplex assembly relies on Fpr3. Moreover, Fpr3 and Zip1 co-localize within polycomplex (MacQueen and Roeder, 2009). We wondered whether Fpr3 and Zip1 are mutually dependent for their co-aggregation into polycomplex. We found that 67.7% ± 6.2% of surface-spread ndt80 spo11 zip1 meiotic nuclei form Fpr3 polycomplex (n 50 per replicate). This frequency of Fpr3 polycomplex formation matches that of ndt80 spo11 meiotic nuclei (66.2% ± 4.1%, n 50 per replicate) (Figure 2A), indicating that Fpr3 protein aggregates into a polycomplex independently of Zip1. As expected, Fpr3 polycomplex was completely abolished in ndt80 spo11 zip1 fpr3 meiotic strains (0%, n 50 per replicate). Moreover, we noticed that like Zip1 polycomplexes, Zip1-independent Fpr3 polycomplexes also localize adjacent to nucleolar protein Nop6 (97.2%, n = 36) (Figure 2B). Next, we investigated dependency relationships between proteins that co-aggregate with Zip1 into a polycomplex. SUMO (Small Ubiquitin like Modifier) protein colocalizes with Zip1 polycomplex in spo11 cells and with linear Zip1 stretches in wildtype meiotic cells (Cheng et al., 2006; Hooker and Roeder, 2006; Watts and Hoffmann, 2011). Recently, SUMO was shown to be another central element component of the SC (Voelkel-Meiman et al., 2013). To investigate whether the SUMO present in Fpr3 polycomplex structures is dependent on Zip1, ndt80 spo11 and ndt80 spo11 zip1 strains were stained with SUMO specific antibodies. In ndt80 spo11, out of 34 Fpr3 polycomplexes, 32 of them were associated with SUMO. Whereas in ndt80 spo11 zip1, 104

115 out of 93 Fpr3 polycomplexes (in a replicate of two), 13 were only partially associated with SUMO and the remaining 80 Fpr3 polycomplexes were not associated with SUMO (Figure 2C). However, SUMO was found to be associated with chromatin in a patchy manner in both ndt80 spo11 and ndt80 spo11 zip1 meiotic mutants (Figure 2C). We note that 31% of ndt80 spo11 zip1 meiotic nuclei (n = 100) displayed independent SUMO polycomplexes that are not associated with Fpr3 (image not shown). Therefore, we conclude that SUMO is dependent on Zip1 for its localization to Fpr3 polycomplexes. The members of the Synapsis Initiation Complex (SIC) proteins (Zip2, Zip3 and Zip4) also associate with Zip1 polycomplex (Agarwal and Roeder, 2000; Chua and Roeder, 1998; Tsubouchi et al., 2006). To determine whether the association of meiosis-specific Zip2, Zip3 and Zip4 proteins with Fpr3 polycomplex is dependent on Zip1, spo11 zip1 ZIP2-GFP, spo11 zip1 ZIP3-MYC, and spo11 zip1 ZIP4-HA strains were stained with anti-gfp, anti-c-myc and anti-ha antibodies respectively. In spo11 zip1 meiotic mutants, like SUMO, each of these SIC proteins failed to co-localize with the Fpr3 polycomplex structures (Figure 2C). From these data we propose that Fpr3 forms polycomplex independently of Zip1, and perhaps directly interacts with Zip1 to promote its aggregation into polycomplex. Zip1 links nucleolus-anchored Fpr3 polycomplex with SUMO and the SIC proteins. We speculate that Fpr3 might be important for recruitment and/or anchoring of majority of Zip1 to the nucleolus whereas SUMO and the SICs might help stabilize the overall polycomplex structure. 105

116 ndt80 spo11 ZIP1+! ndt80 spo11 zip1! A! DAPI Fpr3! DAPI Fpr3! DAPI Fpr3! % of meiotic nuclei with! a Fpr3 polycomplex! n 50! ndt80 spo11 ndt80 spo11 zip1 ndt80 spo11 zip1 fpr3 ndt80 spo11 zip1! DAPI Fpr3 Nop6! B! DAPI Fpr3 SUMO! C! DAPI Fpr3 Zip3-MYC! DAPI Fpr3 Zip2-GFP! DAPI Fpr3 Zip4-HA! zip1! ZIP1+! spo11! spo11 ZIP3-MYC! spo11 ZIP2-GFP! spo11 ZIP4-HA! Figure 2. Zip1-independent Fpr3 polycomplexes require Zip1 for co-localization with SUMO and Synapsis Initiation Complexes (SICs). All meiotic surface-spreads were at least stained with anti-fpr3 and anti-hop1 antibodies, and only Hop1 (a meiotic marker) positive nuclei were considered for analysis. (A) Representative images (left) 106

117 display either a conventional Fpr3 polycomplex as seen in ndt80 spo11 or a Zip1- independent Fpr3 polycomplex as observed in ndt80 spo11 zip1 meiotic nuclei. Scale bar represents 1 micron. Bar graph (right) indicates % of meiotic nuclei displaying an Fpr3 polycomplex in ndt80 spo11 and ndt80 spo11 zip1 after 18 hours of sporulation (n 50; for each strain per replicate; total of two replicates). (B) Representative image shows colocalization of Fpr3 polycomplex with Nop6 (97.2%, n = 36; one replicate). Scale bar represents 1 micron. (C) Representative images show co-localization of Fpr3 polycomplex with either SUMO (94.1%, n = 34; one replicate), Zip2-GFP (51.6%, n = 31; one replicate), Zip3-MYC (100%, n = 42; one replicate) or Zip4-HA (60%, n = 15; one replicate) in ndt80 spo11 meiotic cells (top panels). Representative images show Zip1-independent Fpr3 polycomplex that is devoid of detectable SUMO (86%, n = 93; two replicates), Zip2 (93.5%, n = 31; one replicate), Zip3 (88%, n = 25; one replicate) or Zip4 (92%, n = 25; one replicate) in ndt80 spo11 zip1 meiotic cells (bottom panels). Scale bar represents 1 micron. Meiotic cells were spread after 18 and 15 hours of sporulation for Fpr3-SUMO and Fpr3-Zip2/Zip3/Zip4 co-localization experiments respectively. 107

118 4.3.3 SUMO and the SIC proteins are dispensable for Fpr3 and Zip1 aggregation into a polycomplex To ask if SUMO is required for Zip1 and Fpr3 aggregation into a polycomplex, we compared SUMO-plus spo11 (spo11 SMT3+) with SUMO-diminished spo11 (spo11 P SCC1 [SMT3]/smt3Δ) meiotic cells after 15 hours of sporulation. To do this, we created a SUMO-diminished strain that is homozygous for NDT80 and SPO11 deletion. In our SUMO-diminished strain, one copy of the SMT3 gene (that encodes budding yeast SUMO) is deleted while the other copy is placed under a vegetative-specific promoter (P SCC1 ) (Voelkel-Meiman et al., 2013). Surface-spread spo11 (SUMO-plus and SUMOdiminished) meiotic cells were labeled with anti-smt3 and anti-zip1 or anti-fpr3 antibodies to measure Zip1 or Fpr3 polycomplexes respectively. spo11 P SCC1 [SMT3]/smt3Δ showed a frequency of Zip1 and Fpr3 polycomplexes similar to spo11 SMT3+ meiotic strains. However, SUMO was absent from most Zip1 and Fpr3 polycomplexes in SUMO-diminished strains. Based on these data, we suggest that SUMO is dispensable for Zip1 and Fpr3 aggregation into a polycomplex in spo11 meiotic cells (Figure 3, A and B). However, we note that SUMO may not be completely absent from polycomplexes in SUMO-diminished strain. Interestingly, the area and intensity of Zip1 polycomplex decreases in a spo11 SUMO-diminished strain (Figure 3, C and D) whereas the area of Fpr3 polycomplex remains unaltered (Figure 3C). Therefore, we propose that SUMO may be a structural component of Zip1 polycomplex. Polymerization of Zip1 between closely apposed homologs relies on SIC proteins (Zip2 and Zip4 but not Zip3) (Agarwal and Roeder, 2000; Chua and Roeder, 1998; Tsubouchi et al., 2006). To ask whether Zip1 and Fpr3 polycomplex formation relies on 108

119 SICs in spo11 mutant cells, spo11 ndt80 strains lacking SIC function (Zip2 or Zip3 or Zip4) were assessed for the frequency of Zip1 and Fpr3 polycomplexes after 17 hours of sporulation. ndt80 spo11 zip2, ndt80 spo11 zip3, and ndt80 spo11 zip4 exhibited 69.8% (n = 53 ), 88.3% (n = 60) and 70.1% (n = 87) Zip1 polycomplex respectively similar to ndt80 spo11 (56.9%; n = 51) (Figure 3E). The frequency of Fpr3 polycomplexes was similar between ndt80 spo11 (37%; n = 54), ndt80 spo11 zip2 (47.1%; n = 51), and ndt80 spo11 zip4 (50%; n = 52) meiotic cells whereas ndt80 spo11 zip3 (78.6%; n = 52) strains exhibited an increased frequency of Fpr3 polycomplexes (Figure 3F). Consistent with the polycomplex epistasis data, the SICs (at least Zip2 and Zip4), like SUMO, are dispensable for both Fpr3 and Zip1 polycomplex structures. SUMO localization to polycomplex structures also remain unperturbed in spo11 meiotic mutants lacking either SIC (Zip2 or Zip3 or Zip4) activity (data not shown). This further suggests that SUMO functions upstream of, or in a parallel pathway with SICs in the polycomplex epistasis model. In accord with previous findings (MacQueen and Roeder, 2009), we note that Zip1 polycomplex structures become more discrete in shape in spo11 when Zip3 is absent, and in a majority of the cases (58.5%; n = 53) the size of such a polycomplex increases in two-dimensions (both in length and breadth) compared to spo11 (10.9%; n = 56) cells. On the contrary, mostly linear Zip1 polycomplexes (size increases in onedimension, only lengthwise) are observed in case of loss-of-function of Zip2 (46%; n = 37) and Zip4 (43.5%; n = 98) in spo11 meiotic cells compared to spo11 (8.9%; n = 56) single mutants (Figure 3G). Together, these data suggest that the SICs can affect higher order architecture of the SC central element proteins within a polycomplex. 109

120 DAPI Zip1 SUMO! DAPI Fpr3 SUMO! A! DAPI Zip1 SUMO! DAPI Fpr3 SUMO! B! % of meiotic nuclei with! a polycomplex! spo11! SMT3+/SMT3+! n 50 per replicate! ndt80! spo11! SUMO+! ndt80! spo11! SUMO-Diminished! n 50 per replicate! ndt80! spo11! SUMO+! ndt80! spo11! SUMO-Diminished! spo11! P SCC1 [SMT3]/smt3Δ! n 50 per replicate! Zip1 Polycomplex! Fpr3 Polycomplex! SUMO Polycomplex! ndt80! spo11! SUMO+! ndt80! spo11! SUMO-Diminished! C! D! Total area (short axis long axis)! in square microns! Zip1 Polycomplex! n = 120! Mean = 0.71! n = 102! Mean = 0.26! ndt80 spo11 SMT3+/SMT3+" ndt80 spo11 P SCC1 [SMT3]/smt3Δ" Zip1 Polycomplex! Total area (short axis long axis)! in square microns! Fpr3 Polycomplex! n = 50! Mean = 0.72! n = 52! Mean = 0.47! ndt80 spo11 SMT3+/SMT3+" ndt80 spo11 P SCC1 [SMT3]/smt3Δ" Total intensity of the! best z-section (4 4 box)! n = 58! Mean = 29848! n = 31! Mean = 6875! ndt80 spo11 SMT3+/SMT3+" ndt80 spo11 P SCC1 [SMT3]/smt3Δ" 110

121 E! F! % of meiotic nuclei! with a Zip1 polycomplex! ndt80 spo11 n 50 per replicate! ndt80 spo11 zip3 ndt80 spo11 zip2 ndt80 spo11 zip4 % of meiotic nuclei! with a Fpr3 polycomplex! ndt80 spo11 n 50 per replicate! ndt80 spo11 zip3 ndt80 spo11 zip2 ndt80 spo11 zip4 G! DAPI Zip1! ndt80 spo11! DAPI Zip1! DAPI Zip1! ndt80 spo11 zip3! DAPI Zip1! % of Zip1 polycomplexes! that are linear! ndt80 spo11 n 18 per replicate! ndt80 spo11 zip3 ndt80 spo11 zip2 ndt80 spo11 zip4 ndt80 spo11 zip2! ndt80 spo11 zip4! Figure 3. SUMO and the Synapsis Initiation Complex (SIC) proteins are dispensable for Fpr3 and Zip1 aggregation into polycomplexes. (A) Representative images in the top panels show either a Zip1 or Fpr3 (red) polycomplex with associated SUMO (green) signal in SUMO-plus spo11 meiotic nuclei. Bottom panels depict representative image of either a Zip1 or Fpr3 (red) polycomplex devoid of detectable SUMO (green) signal in SUMO-diminished spo11 meiotic nuclei. Scale bar represents 1 micron. (B) Bar graph indicates % of meiotic nuclear spreads displaying either a Zip1 polycomplex (left, black box), Fpr3 polycomplex (middle, red box) and SUMO polycomplex (right, blue box) in spo11 cells that are either SMT3+ or carry P SCC1 [SMT3]/smt3Δ (n 50 for each column per replicate; total of two replicates). (C) Scatter plot shows total area (long short axis) of Zip1 and Fpr3 polycomplexes in spo11 SMT3+ and spo11 P SCC1 [SMT3]/smt3Δ nuclei in square microns. Horizontal black bar represents mean. (D) Scatter plot shows maximum intensity of Zip1 polycomplex. Black and red dots represent spo11 SMT3+ and spo11 P SCC1 [SMT3]/smt3Δ nuclei respectively. Images of Zip1 polycomplex (Cy3 111

122 channel) were taken at constant exposure (0.1s). 7 nuclear sections for each strain were taken (each section is 0.2 micron apart). The best z-section (with the highest intensity) was selected for analysis. Region of interest (ROI) box (4 4 pixels; 1 pixel = μm) was placed at the center of the Zip1 polycomplex for every nucleus analyzed. Horizontal black bar represents mean. (E-F) Bar graph shows % of meiotic nuclei displaying a Zip1 polycomplex (E) and a Fpr3 polycomplex (F) in ndt80 spo11 cells lacking ZIP2 or ZIP3 or ZIP4 function (n 50 for each column per replicate; total of two replicates). (G) Representative images show big and linear Zip1 polycomplexes in ndt80 spo11 nuclei lacking ZIP3 and ZIP2 or ZIP4 respectively. Scale bar represents 1 micron. Bar graph shows % of Zip1 polycomplexes that are linear in ndt80 spo11 cells missing ZIP2 or ZIP3 or ZIP4 (n 18 for each column per replicate; total of two replicates). 112

123 4.3.4 Pph3-MYC often localizes to polycomplex structures in a Zip1-dependent manner In absence of the meiotic recombination machinery, both Fpr3 and Rrd1 prolyl isomerases have been shown to facilitate Zip1 aggregation into a polycomplex. Unlike Fpr3, functional Rrd1-MYC was not detected in such polycomplexes (MacQueen and Roeder, 2009); (preliminary data, Chapter 3). Pph3, a catalytic subunit of PP4 phosphatase, is a downstream target of Rrd1 (Keogh et al., 2006; Van Hoof et al., 2005). Like Rrd1, the phosphatase component Pph3 also promotes Zip1 polycomplex formation (Chapter 3). We therefore wondered whether Pph3 phosphatase would localize to Zip1 polycomplex structures. To study the localization pattern of the phosphatase component Pph3 in spo11 meiotic nuclei, we tagged PPH3 with a MYC epitope at its C-termini. We also checked epitopetagging of Pph3 by monitoring Pph3-MYC mobility in a modified strain (where PPH3 is placed under an inducible promoter P GAL1 ) via immunoblot (data not shown). After confirmation of epitope-tagging, we tested whether the tagged version of Pph3 functions normally during meiotic prophase. Since deletion of PPH3 in spo11 results in reduced Zip1 polycomplex formation (data presented in Chapter 3), we determined Zip1 polycomplex frequency in spo11 (positive control) versus spo11 PPH3-MYC. We found that the frequency of Zip1 polycomplex remained unaltered between spo11 (56.1% ± 11.2%, n 50 per replicate) and spo11 PPH3-MYC (52.8% ± 12.4%, n 50 per replicate) (Figure 4A). Consistent with our previous observation, spo11 fpr3 PPH3-MYC and spo11 rrd1 PPH3-MYC meiotic nuclei displayed reduced Zip1 polycomplexes (36% and 23.5% respectively, n 50). Therefore, we conclude that epitope-tagged Pph3 113

124 remains functional during meiosis in terms of its role in Zip1 polycomplex formation. We then determined if functional Pph3-MYC localizes within a polycomplex in spo11 meiotic nuclei. Surface-spread spo11 and spo11 PPH3-MYC meiotic nuclei were stained with anti-zip1 and anti-c-myc antibodies. spo11 PPH3+ strains served as a negative control for c-myc-staining in this experiment. We noticed that, unlike Rrd1 prolyl isomerase that localizes to the nucleoplasm during meiotic prophase, functional MYCtagged Pph3 often co-localizes with Zip1 within a polycomplex in spo11 meiotic nuclei (64.3%, n = 28) (Figure 4B). We next determined whether the absence of Fpr3 and Rrd1 functions affect Pph3 s localization to Zip1 polycomplexes. To look for the association of Pph3-MYC with Zip1 polycomplexes in spo11 lacking either prolyl isomerase activity, surface-spread spo11 PPH3-MYC, spo11 fpr3 PPH3-MYC, and spo11 rrd1 PPH3-MYC meiotic nuclei were stained with anti-zip1 and anti-c-myc antibodies. We found that Pph3-MYC often ( 45%) co-localized with Zip1 polycomplexes in spo11 fpr3 PPH3-MYC and spo11 rrd1 PPH3-MYC meiotic mutants (Figure 4C). Taken together, these data suggest that localization of Pph3-MYC to Zip1 polycomplexes neither depends on Fpr3 nor on Rrd1. Zip1 polycomplex formation depends on Pph3 (Chapter 3). We investigated whether Zip1 and Pph3 are mutually dependent on each other for their aggregation into a polycomplex. Since Fpr3 forms polycomplex structures independent of Zip1, we analyzed Fpr3 polycomplexes in spo11 PPH3-MYC (positive control), and spo11 zip1 PPH3-MYC to determine the presence of Pph3-MYC signal on such polycomplexes. We labeled the surface-spread meiotic nuclei with anti-fpr3 and anti-c-myc antibodies. Surprisingly, we noticed that Pph3-MYC staining was completely absent from Fpr3 114

125 polycomplexes in spo11 zip1 PPH3-MYC meiotic mutants (Figure 4D). We conclude that while Pph3 is required for robust Zip1 polycomplex formation, Pph3 depends on Zip1 for its sometimes localization within a polycomplex. However, we need to test Pph3-MYC protein level on a Western blot in spo11 zip1 PPH3-MYC meiotic mutants to confirm the expression of Pph3-MYC in such strains. 115

126 A" % of meiotic nuclei " with a Zip1 polycomplex" n 50 per replicate" spo11 spo11 PPH3-MYC B" P GAL1 [PPH3-MYC]/+! + " + " β-estradiol" - " + " Pph3-MYC" α c-myc" B! DAPI Zip1! DAPI Pph3-MYC! Zip1 Pph3-MYC! D! DAPI! Fpr3! DAPI! Fpr3! Pph3-MYC! Pph3-MYC! DAPI Zip1! DAPI Pph3-MYC! Zip1 Pph3-MYC! spo11 PPH3-MYC! spo11 zip1 PPH3-MYC! spo11 PPH3-MYC! C! % of Zip1 polycomplex! with Pph3-MYC! ! spo11 PPH3+ 26! 28! 37! 30! spo11 spo11 zip3 spo11 fpr3 PPH3-MYC! spo11 rrd1 % of Fpr3 polycomplex! with Pph3-MYC! ! spo11 PPH3+ 107! spo11 spo11 zip3 127! 78! PPH3-MYC! spo11 zip1 Figure 4. Pph3-MYC often localizes to polycomplex structures in a Zip1-dependent manner. (A) Bar graph represents % spo11 and spo11 PPH3-MYC meiotic nuclei with a Zip1 polycomplex (n 50 for each strain per replicate, total of two replicates). (B) Meiotic chromosome-spread images of spo11 nuclei showing co-localization of MYCtagged Pph3 (green) with Zip1 (red) polycomplex; the frequency of co-localization of Zip1 polycomplex with Pph3-MYC is 64.3% (n = 28). Scale bar represents 1 micron. (C) Bar graph shows % of Zip1 polycomplex with Pph3-MYC in various spo11 PPH3-MYC meiotic mutants (n 25 for each strain, one replicate). (D) Representative images (top) show Fpr3 polycomplexes (green) either associated with Pph3-MYC (red) in a spo11 116

127 meiotic nucleus (left) or devoid of detectable Pph3-MYC staining in a spo11 meiotic nucleus harboring a ZIP1 deletion. Scale bar represents 1 micron. Bar graph (bottom) indicates % of Pph3-MYC-associated Fpr3 polycomplex in various spo11 PPH3-MYC meiotic nuclei (n 45 for each strain, average value of three replicates). 117

128 4.3.5 Investigating interactions between Fpr3 (or other SC regulators) and Zip1 using a vegetative yeast two-hybrid system A yeast two-hybrid assay can reveal a binary interaction between two proteins in vivo (Fields and Song, 1989). Fpr3 promotes Zip1 polycomplex assembly in the absence of homologous recombination and both these proteins co-aggregate within the polycomplex structure at the nucleolus. Overproduction of Fpr3 alters SC assembly on chromosomes during meiotic prophase (Chapter 5). Together, these observations suggest that Fpr3 might directly interact with Zip1. Additionally, this study suggests that Rrd1 could regulate Zip1 s capacity to assemble as a polycomplex in spo11 indirectly via its downstream effector Pph3 phosphatase. Moreover, Pph3 often co-aggregates with Zip1 within a polycomplex. To test for direct interactions between Fpr3 (or other SC regulators) and Zip1, we employed a yeast two-hybrid assay using either full-length or truncated versions (N- or C-terminal domain) of Fpr3 (or other SC regulators) and Zip1 fused to the Gal4 transcription factor at its C-termini (Figure 5A, schematics of specific domains). We then performed growth (spotting) assay on SC-Leu-Trp-His triple dropout plates to assess interactions between any two given Gal4-AD (Activating Domain) and Gal4-DBD (DNA Binding Domain) fusions using serial dilutions ranging from 1 to Growth on SC- Leu-Trp double dropout plates was used as a control to monitor for plasmid loss. We have tested several different combinations of Gal4-AD/DBD fusions of Zip1 with the corresponding Gal4-AD/DBD fusions of Zip1 regulators (such as Fpr3, Pph3, Rrd1, Zip3 and SUMO), and compared them with a positive control (either Sir2-Δ109-AD and Net1- DBD (Hickman et al., 2007) or Gmc2-AD and Ecm11-DBD (Humphryes et al., 2013) 118

129 and a negative control (an empty poad and pobd2 vectors) at each time an interaction was tested. Additionally, we have investigated interactions between Gal4-AD/DBD fusions of Fpr3-FL (full-length), Fpr3-N (N-terminal half) and Fpr3-C (Cterminal half with PPIase domain) with the corresponding Gal4-AD/DBD fusions of Zip1-FL (full-length), Zip1-C [SUMO Interacting Motif (SIM) domain], and Zip1- N (N-terminal domain with a portion of coiled-coil) (Table 1). The Gal4-AD and Gal4-DBD fusion constructs created and/or used in our study are listed in Table P1. Unfortunately, so far we have not observed any positive interactions between Zip1 and the above-mentioned SC regulators (Figure 5, B and C). However, we were successful in recapitulating positive interactions that have already been documented in the literature such as [Zip1(FL)-AD and Zip1(FL)-BD; Zip1-N(1-451)-AD and Zip1-N(1-451)-BD] using a tighter serial dilution regime ranging from 1 to 3-5 (Figure 5C). This gave us confidence regarding the overall yeast two-hybrid system. Because we did not see a positive interaction between Fpr3 and Zip1, we wonder whether the testable proteins might require post-translational modifications (PTMs) for their function/interaction with their binding partners since many of these proteins are meiosis specific. Therefore in the future, we will employ a yeast two-hybrid assay in meiotic cells to assess protein-protein interaction using the Gal4-AD and Gal4-DBD fusions generated for this study. 119

130 A! N 1 C! ! Zip1 (Full-length)! N-terminal! domain! Coiled-coil domain! C-terminal! domain! Zip1-N1-175 (N-terminal domain)! Zip1-C (C-terminal domain with a portion of coiled-coil)! Zip1-C (SUMO Interacting Motif [SIM] domain)! Zip1-N1-451 (N-terminal domain with a portion of coiled-coil)! Zip1-M (Coiled-coil domain)! Zip1-C (C-terminal domain)! N 1 C! ! Fpr3 (Full-length)! Fpr3-N1-299 (N-terminal half with nucleolar localization sequence)! Fpr3-C (C-terminal half with PPIase domain)! B! ! ! Serial dilutions:! poad + pobd2! +/-! Sir2-Δ109-AD + Net1-BD! +++! Zip1-N(1-175)-AD + Fpr3(FL)-BD! +/-! Zip1-C( )-AD + Fpr3(FL)-BD! +/-! Zip1-(FL)-AD + Fpr3(FL)-BD! +/-! Zip1-N(1-175)-AD + Fpr3-N(1-299)-BD! +/-! Zip1-C( )-AD + Fpr3-N(1-299)-BD! +/-! Zip1-(FL)-AD + Fpr3-N(1-299)-BD! +/-! SC-Leu-Trp! SC-Leu-Trp-His! 120

131 C! ! ! Serial dilutions:! poad + pobd2! Gmc2-AD + Ecm11-BD! Zip1(FL)-AD + Zip1-N(1-451)-BD! Zip1-N(1-451)-AD + Zip1(FL)-BD! Zip1-N(1-451)-AD + Fpr3(FL)-BD! Zip1-N(1-451)-AD + Fpr3-N(1-299)-BD! Zip1-N(1-451)-AD + Fpr3-C( )-BD! Zip1-N(1-451)-AD + Rrd1-(FL)-BD! poad + pobd2! Zip1(FL)-AD + Zip1-(FL)-BD! Zip1-N(1-175)-AD + Zip1-(FL)-BD! Zip1(FL)-AD + Zip1-N(1-175)-BD! Zip1(FL)-AD + Zip1-C( )-BD! Zip1-N(1-451)-AD + Zip1-N(1-175)-BD! Zip1-N(1-451)-AD + Zip1-C( )-BD! Zip1-N(1-451)-AD + Zip1-N(1-451)-BD! SC-Leu-Trp! SC-Leu-Trp-His! +/-! +++! +++! +++! +/-! +/-! +/-! +/-! +/-! +++! +/-! +/-! +/-! +/-! +/-! +++! *Frogging assay: Courtesy of Yashna Thapetta D! N C! ! N-terminal! domain! Coiled-coil domain! C-terminal! domain!! Zip1-FL (Full-length)! Interaction! Zip1-N (N-terminal domain with a portion of coiled-coil)! Figure 5. Investigating interactions between Fpr3 (or other SC regulators) and the SC protein Zip1 using a vegetative yeast two-hybrid system. (A) Schematic representation of full-length or specific domain(s) of Zip1 and Fpr3 proteins. (B-C) Interactions between Gal4-AD fusions of full-length or specific-domain of Fpr3 (or other protein regulators of SC) and Gal4-DBD fusions of full-length or specific-domain of Zip1, and vice versa, are being tested using traditional yeast two-hybrid assay for HIS3 121

132 reporter system. Representative images (from one replicate) show growth on SC-Leu-Trp (double dropout) plates (left) and SC-Leu-Trp-His (triple dropout) plates (right). Positive interactions: (+++). Basal/negative interactions: (+/-). Serial dilutions used for (B) and (C) are (1/1, 1/10, 1/100, 1/1000, 1/10,000, 1/100,000) and (1/1, 1/3, 1/9, 1/27, 1/81, 1/243) respectively. Dropout plates were incubated at 30 C for 2-3 days before acquiring images. (D) Schematic representation of the Zip1 interactome. 122

133 Table 1. A vegetative yeast two-hybrid (Y2H) assay for HIS3 reporter system Gal4-AD Fusions Gal4-BD Fusions Fpr3- AD (FL) Fpr3- N AD Fpr3- C AD Zip1- AD (FL) Zip1- N AD Zip1- N AD Zip1- C AD Zip1- C AD Rrd1- AD (FL) Pph3- AD (FL) Zip3- AD (FL) Smt3- AD (FL) poad (Empty vector) Fpr3-BD (FL) NI NI NI NI NI NI NI NI NI NI NI NI NI Fpr3-N BD NI NI NI NI NI NI NI NI NI NI NI NI NI Fpr3-C BD NI NI NI NI NI NI NI NI NI NI NI NI NI Zip1-BD (FL) NI NI NI SI NI SI NI TBD NI NI NI NI NI Zip1-N BD NI NI NI NI NI NI NI TBD NI NI NI TBD NI Zip1-N BD NI NI NI SI TBD SI TBD TBD NI NI TBD TBD TBD Zip1-C BD NI NI NI NI NI TBD NI TBD NI NI TBD NI NI Zip1-C BD NI NI NI TBD TBD TBD TBD TBD NI NI TBD NI TBD Rrd1-BD (FL) NI NI NI NI NI NI NI NI NI NI TBD TBD NI Pph3-BD (FL) CA CA CA CA CA CA CA CA CA CA CA CA CA Zip3-BD (FL) NI NI NI NI NI TBD TBD TBD TBD NI NI TBD NI Smt3-BD (FL) NI NI NI NI TBD TBD NI NI TBD NI TBD NI NI pobd2 (Empty vector) NI NI NI NI NI TBD NI TBD NI NI NI NI NI Acronyms for yeast two-hybrid (Y2H) interactions: 1) Strong Interaction (SI) 2) No Interaction (NI) 3) Constitutively Active (CA) 4) To Be Determined (TBD) 123

134 4.4 Discussion Fpr3 might act as a nucleolar anchor for Zip1 at the polycomplex Unlike SCs that lie between closely apposed homolog axes, Zip1 polycomplexes in recombination-deficient meiotic nuclei usually localize in a DAPI-deprived region. Zip1 polycomplexes mostly localize adjacent to the meiotic nucleolus. We believe that the few polycomplexes that are found unassociated with the nucleolus on a surface-spread might be initially nucleolus anchored. The mechanical/physical shear generated during the chromosome spreading process might eventually dislodge them from the nucleolus. Although Zip1 mostly relies on Fpr3 for its aggregation into a polycomplex, we have demonstrated that Fpr3 is capable of forming polycomplexes on its own (without requiring Zip1 function) at the nucleolus. It is intriguing how Fpr3 is primarily nucleolusbound during vegetative growth but as cells enter meiosis Fpr3 begins to accumulate in the nucleoplasm (Hochwagen et al., 2005). However, when DNA breaks fail to occur during meiosis, a majority of Fpr3 protein shows a robust staining at the nucleolus along with Zip1. Moreover, loss of Fpr3 function in spo11 exacerbates Zip1 polycomplex formation, and a majority of Zip1 leaves the nucleolus and localizes to the nucleoplasm in spo11 fpr3 meiotic mutants (MacQueen and Roeder, 2009). Taken together, these observations might suggest Fpr3 s role as a molecular/nucleolar anchor for Zip1 within a polycomplex. We identified earlier that loss-of-function of Fpr3 in spo11 results in linear Zip1 polycomplexes. Interestingly, when Zip3 function is compromised in spo11 fpr3 the frequency of linear Zip1 polycomplexes is elevated. We propose that Fpr3 not only promotes Zip1 polycomplex formation but also regulates/maintains the higher order 124

135 architecture of the Zip1 polycomplex structures in parallel with Zip3. Since the few Zip1 polycomplexes that form in spo11 fpr3 still localize adjacent to the nucleolus and co-stain with SUMO, we propose that some other protein might act as a molecular anchor for Zip1 polycomplex in absence of, or together with, Fpr3. This could be the phosphatase component Pph3, since Pph3 (a downstream effector of Rrd1) often aggregates within a polycomplex in a Zip1-dependent manner but independently of Fpr3 function. We propose that the interaction of Pph3 with proteins, which aggregate within a polycomplex might be transient and therefore, unlike Fpr3, Pph3 fails to show 100% co-localization with Zip1 polycomplex. Pch2, an AAA+ ATPase is also found in the nucleolus during normal meiosis and it causes an arrest of zip1 cells via its meiotic checkpoint function (San-Segundo and Roeder, 1999; Wu and Burgess, 2006; Erzberger and Berger, 2006; Borner et al., 2008). Moreover, Pch2 co-localizes with Zip1 polycomplex in pairing-defective meiotic cells (San-Segundo and Roeder, 1999). However, we found that Pch2 is dispensable for Zip1 polycomplex formation, suggesting that Pch2 might function downstream of Zip1 within a polycomplex. Therefore, we propose that not all proteins that typically localize to the nucleolus or co-localize with Zip1 within a polycomplex promote Zip1 polycomplex formation. On the other hand, our preliminary data show that Pch2 is required for the formation of a majority of Fpr3 polycomplexes, suggesting a direct interplay between Fpr3 and Pch2. One way we can reconcile this is by considering that Zip1 polycomplex is only reduced by 40% but not completely diminished in spo11 fpr3. Therefore Zip1 polycomplex formation is not entirely dependent on Fpr3, and Fpr3 polycomplexes are not absolutely abolished in spo11 pch2 meiotic mutants. Alternatively, we propose that a 125

136 parallel pathway might be responsible for Zip1 polycomplex formation in spo11 pch2 meiotic nuclei or the reduction of Fpr3 polycomplexes in spo11 pch2 might be an artifact of our antibody staining SUMO might be a structural component of Zip1 polycomplex Like Zip1, other SC central region proteins such as SUMO (Cheng et al., 2006), Ecm11 and Gmc2 (Humphryes et al., 2013) also co-aggregate within a polycomplex. Moreover, SUMO and Ecm11 have recently been shown as components of the SC central element and lack/diminishment of either protein function severely affects SC assembly (Humphryes et al., 2013; Voelkel-Meiman et al., 2013). Humphryes et al., (2013) showed that loss-of-function of Ecm11 in spo11 completely abolishes Zip1 polycomplex formation. Consistent with this, Drosophila SC central element protein Corona is also essential for polycomplex formation in fly oocytes (Page et al., 2008). Cheng and colleagues (2006) proposed that interaction of Zip1 with SUMO polymers is important for polycomplex formation. We therefore wondered whether the other SC central element protein, SUMO, is involved in polycomplex regulation. Although, SUMO diminishment in spo11 does not affect the frequency of Zip1 polycomplex formation per se, however the overall size and intensity of such Zip1 polycomplexes are greatly reduced. On the other hand, the frequency and size of Fpr3 polycomplexes remain unaffected upon SUMO diminution. Interestingly, detectable SUMO signal was absent from either Zip1 or Fpr3 polycomplexes in spo11 SUMO-down strains. Although some degree of chromosomal SUMO staining was observed probably due to residual SUMO level within such meiotic cells. The fact that SUMO-down spo11 strains show Zip1 polycomplexes 126

137 that are reduced in size and intensity, and devoid of detectable SUMO favors the idea that SUMO might be a structural component of Zip1 polycomplex (like it is in case of SCs). This idea is further supported by an elegant experiment that demonstrated that maximum down-regulation of SUMO in SPO11+ meiotic strains often produce Zip1 polycomplex with undefined shape and absence of SUMO staining (Voelkel-Meiman et al., 2013). Here, we have shown that when Zip1 function is abolished in spo11, SUMO fails to localize within Zip1-independent Fpr3 polycomplexes that are formed at the nucleolus. This observation is reminiscent of Zip1-dependence of SUMO in SCs (Hooker and Roeder, 2006), and is consistent with the idea that Zip1 is a preferred SUMO substrate during meiosis, even at the polycomplex (Cheng et al., 2006). Taken together, we propose that while majority of the SUMO is acting downstream of Zip1 in polycomplex epistasis and is dispensable for promoting Zip1 polycomplex formation, some amount of SUMO is required for the proper assembly of Zip1 polycomplex and/or for maintaining its structural integrity. SUMO might also be engaged in regulating other proteins within the polycomplex such as Ecm SICs might regulate Zip1 polycomplex formation and its higher order organization SIC proteins that are essential to initiate and/or maintain Zip1 polymerization are also seen within a polycomplex (Agarwal and Roeder, 2000; Chua and Roeder, 1998; Tsubouchi et al., 2006). Interestingly, unlike Fpr3, Pph3 and SUMO, SICs display an unique staining pattern within polycomplexes (Agarwal and Roeder, 2000; Cheng et al., 2006; Chua and Roeder, 1998; MacQueen and Roeder, 2009; Tsubouchi et al., 2006). 127

138 Zip2 and Zip4 are seen at both poles of a polycomplex whereas Zip3 covers the entire polycomplex along with capping both ends (Agarwal and Roeder, 2000; Chua and Roeder, 1998; Tsubouchi et al., 2006). This observation suggests that SICs might interact with separate domains/regions of Zip1 within a polycomplex. Consistent with this idea, such SIC staining at polycomplex is lost in absence of Zip1 function. Like Zip3 loading at centromeres, Zip3 loading within a polycomplex is dependent on Zip1 while Zip3 loading at non-centromeric chromosome sites is Zip1-independent suggesting that the epistasis of Zip3 localization varies within different nuclear locations. While Zip3 depends on Zip2/4, Zip2/4 are mutually dependent on each other for their bi-polar localization within a polycomplex. In absence of Zip2 or Zip4 function, Zip2/4 stains the entire polycomplex (Tsubouchi et al., 2006). Tsubouchi et al. suggested that Zip3 might help to crosslink Zip2/4 with Zip1 within a polycomplex. We found that Zip1 connects Zip2, Zip3 and Zip4 with Fpr3 polycomplexes. We wonder what role do SICs play within a Zip1 polycomplex. We asked whether SICs regulate polycomplex formation or do they maintain polycomplex structures. To study these we carried out mutation analysis together with epistasis analysis of SICs in spo11 mutants where half of the cell population typically displays a Zip1 polycomplex. It was shown previously that Zip3 inhibits polycomplex formation (MacQueen and Roeder, 2009). We noticed that lack of either SIC function (Zip2 or Zip4) in spo11 cause a subtle increase in Zip1 polycomplex frequency. Although such an increase in Zip1 polycomplex frequency is not as robust as zip3 mutation. Based on the increased polycomplex frequency data in spo11 missing either SIC protein function, it is probable that the SICs (Zip2 and Zip4) prevent Zip1 polycomplex formation. We also observed that these mutants exhibit either bigger 128

139 or linear Zip1 polycomplexes. Even in spo11 fpr3 mutants that typically display linear polycomplexes, zip3 mutation further causes an increase in linear Zip1 polycomplexes in such mutants. This is consistent with the polycomplex capping phenotype. We believe that Zip2/4 acts as a barricade for Zip1 polycomplex by capping its ends. Therefore when either Zip2/4 is missing Zip1 polycomplex usually elongates bi-directionally. Similarly when Zip3 is absent polycomplexes grow bigger in size, as if the polar and surface barricades/interactions are needed to maintain overall polycomplex shape/size. Therefore it is apparent that the SICs contribute to the higher order structures of the Zip1 polycomplexes. This further suggests that SC initiation/polymerization and polycomplex formation is somehow linked and the SICs may bridge these two opposite phenomenon by promoting one and preventing the other at the same time via direct or indirect mechanisms. Together, we propose that a polycomplex is neither a random occurrence nor a garbage center but rather significant, a highly ordered structure. The polycomplex could serve as a storage house for proteins that will eventually be incorporated into a future SC structure. The assembly of polycomplexes is well orchestrated with multiple protein components (some of which are meiosis-specific) playing important functions at different stages of its formation. The prolyl isomerases and phosphatase components might be involved in its regulation whereas the SC initiation complexes as well as the SC central element proteins (such as SUMO) might be required for its structural integrity and/or stabilization. 129

140 4.4.4 Questions addressed in this study In this chapter, we investigated the overall architecture of the polycomplex. First, we identified the physical location where polycomplexes form within the meiotic nucleus. We asked whether Zip1 (an important component of the polycomplex) and its regulator Fpr3 are mutually dependent on each other for localization within a polycomplex. We studied the dependency relationships between proteins that are part of the polycomplex, and finally, we investigated interactions between protein components that comprise the polycomplex structure using a vegetative two-hybrid system Current model Fpr3 aggregates into polycomplex at the nucleolus (perhaps through interacting mechanisms that partially relies on checkpoint functions) in absence of recombination and/or homolog pairing. Fpr3 in parallel with Rrd1 (via Pph3 and/or Sit4) sequester Zip1 from the nucleoplasmic pool and promotes its stable localization to the nucleolus. Nucleolus-anchored Zip1 then bridges another SC central element protein SUMO and Synapsis Initiation Complex proteins to the nucleolus-associated Fpr3. SUMO and/or SICs might confer higher order organization to Zip1 polycomplexes (Figure 6). 130

141 In absence of recombination initiation and/or homolog pairing:! Zip2! Zip4! Zip3! SUMO! Pph3! Ecm11?! Fpr3! Zip1! Sit4! Pph3! Rrd1! Fpr3! Nucleolus! Figure 6. Current model for Zip1 polycomplex formation in absence of recombination and/or homolog pairing during budding yeast meiosis. Prior to, and/or in absence of meiotic recombination and/or homolog pairing, Fpr3 is recruited to the nucleolus. Fpr3 in parallel with Rrd1 (via Pph3/Sit4) sequester Zip1 to the nucleolus from the nucleoplasm. Zip1 then links Pph3, SUMO and Synapsis Initiation Complexes such as Zip2, Zip3 and Zip4 with the nucleolus-associated Fpr3. 131

142 Chapter 5 Fpr3-Overexpression Results in a Pch2-Dependent Defect in Early-Meiotic Prophase Progression, SC Assembly and Meiotic Spore Formation 132

143 5.1 Abstract Fpr3 is a peptidyl-prolyl isomerase protein that is involved in a recombination checkpoint during meiosis in budding yeast (Hochwagen et al., 2005). Independent of recombination initiation, Fpr3 regulates the nuclear distribution of the SC component Zip1, and co-localizes with Zip1 at polycomplex structures (MacQueen and Roeder, 2009). Here, we employed an Fpr3-overexpression system in order to ask whether Fpr3 can promote Zip1 polycomplex formation, at the expense of SC assembly, during an otherwise wild-type meiosis. We found that overexpression of Fpr3 delays meiotic spore formation. This delay in meiotic progression is dependent on Pch2, a meiosis-specific AAA+ ATPase required for the recombination/synapsis checkpoint (San-Segundo and Roeder, 1999; Wu and Burgess, 2006; Erzberger and Berger, 2006; Borner et al., 2008). We furthermore observed that overexpression of Fpr3 causes reduced Zip1 polymerization on paired homologs. However, deletion of PCH2 in Fpr3-overexpressing meiotic cells alleviates the delay in SC assembly associated with Fpr3 overexpression. Taken together, our results suggest that the effect of Fpr3 overexpression on SC assembly during meiotic prophase is an indirect consequence of cell cycle checkpoint activation. 5.2 Introduction Homolog pairing, promoted in large part by Spo11-catalyzed double strand breaks (DSBs), are ultimately reinforced by the assembly of SC, a tripartite higher-order protein structure (Page and Hawley, 2004). Expression of Zip1, a meiosis-specific SC central region component, initiates prior to DSB formation during early meiotic prophase, and Zip1 is mostly found localized to the centromeres prior to DSB formation (Tsubouchi and 133

144 Roeder, 2005). Zip1 protein expression peaks at mid-meiotic prophase when Zip1 functions in building SC structures between paired homologs (Sym et al., 1993). Fpr3 is a peptidyl-prolyl isomerase protein. In vitro, Fpr3 catalyzes the cis-trans isomerization of prolines within peptides (Benton et al., 1994). During vegetative growth Fpr3 is usually found localized within the nucleolus, but at the onset of meiosis Fpr3 diffuses to the nucleoplasm (Hochwagen et al., 2005). Fpr3 protein expression remains steady throughout meiosis (Hochwagen et al., 2005). Notably, in the absence of DSBs Fpr3 aggregates with Zip1 into a polycomplex structure (Chapter 4). In the absence of meiotic recombination and/or homolog pairing (such as in spo11 mutants), Fpr3 influences the amount of Zip1 that forms polycomplex within a meiotic nucleus. In spo11 mutant meiotic cells, Zip1 frequently aggregates into a polycomplex at the nucleolus. However, when spo11 mutants lack the function of Fpr3 prolyl isomerase, the frequency of Zip1 polycomplex formation is reduced. Instead, Zip1 protein often disperses throughout the nucleoplasm. Since Fpr3 and Zip1 co-localize within polycomplex (MacQueen and Roeder, 2009), Fpr3 might directly interact with Zip1 to promote its aggregation into a polycomplex. Checkpoint mechanisms function during meiotic prophase in budding yeast. Such meiotic checkpoints usually monitor accumulation of aberrant recombination and/or synapsis products such as unrepaired break intermediates and/or defective SCs respectively, and stall/delay cell-cycle progression thereby allowing for their timely repair. This prevents disjunction of defective homologs and therefore maintains overall reproductive health (MacQueen and Hochwagen, 2011; Roeder and Bailis, 2000). 134

145 Fpr3 exhibits recombination checkpoint activity during meiotic prophase (Hochwagen et al., 2005). The absence of a meiosis-specific strand invasion protein Dmc1 (bacterial RecA homolog) results in the accumulation of unrepaired DNA DSB intermediates and causes meiotic cell-cycle arrest (Bishop et al., 1992; San-Segundo and Roeder, 1999). The recombination-checkpoint arrest seen in dmc1 meiotic cells is partially bypassed by the deletion of FPR3 (Hochwagen et al., 2005). Absence of Zip1 results in unsynapsed homologs with only homolog axes linked together at certain positions (axial associations), and a severe reduction in meiotic spore formation due to a mid-meiotic prophase arrest (Sym et al., 1993; Tung and Roeder, 1998). Such an arrest in meiotic prophase progression stems from a Pch2-dependent recombination/synapsis checkpoint activity (San-Segundo and Roeder, 1999). Pch2, a conserved AAA+ ATPase, often localizes to the nucleolus, and as discrete foci on meiotic chromosomes during late zygotene and pachytene stages of meiosis (which coincides with SC assembly), and is speculated that Pch2 might interact with SC component Zip1 (San-Segundo and Roeder, 1999; Wu and Burgess, 2006; Erzberger and Berger, 2006; Borner et al., 2008). Consistent with this, Pch2 protein expression profile coincides with expression of Zip1 protein (San-Segundo and Roeder, 1999). However, in zip1 mutants Pch2 solely localizes to the meiotic nucleolus. Therefore, it is thought that the nucleolar localization of Pch2 is important for its meiotic recombination/synapsis checkpoint function (Borner et al., 2008; San-Segundo and Roeder, 1999). While a pch2 mutation completely rescues the cell cycle arrest in zip1 mutants (in both SK1 and BR1919 strain backgrounds), deletion of PCH2 fails to, or only slightly rescues the cellcycle arrest triggered in dmc1 mutants, at least in the SK1 strain background (San- 135

146 Segundo and Roeder, 1999; Hochwagen et al., 2005). On the other hand, Fpr3 mutation does not bypass the prophase arrest triggered in zip1 meiotic mutants (Hochwagen et al., 2005). Together these observations suggest that Fpr3 and Pch2 have separate checkpoint functions. However, since both Fpr3 and Pch2 co-localize with Zip1 within polycomplex structures and are associated with the nucleolar region, these proteins may function together during meiosis (Hochwagen et al., 2005; MacQueen and Roeder, 2009; San- Segundo and Roeder, 1999). Here, we have characterized the effect of Fpr3- overexpression on meiotic progression and SC assembly. We found that overexpression of Fpr3 prolyl isomerase causes a delay in the formation of meiotic haploid products (spores). We also noticed that overproduction of Fpr3 interferes with Zip1 s ability to assemble SCs on paired homologs. Both the delay in sporulation and the defect in SC assembly are rescued by the deletion of a meiotic recombination/synapsis checkpoint protein, Pch2. These data suggest that cells are susceptible to a Pch2-dependent checkpoint pathway at even earlier meiotic prophase stages than previously thought. 5.3 Results FPR3-overexpression causes a PCH2-dependent defect in meiotic spore formation In order to overexpress Fpr3 we constructed a heterozygous diploid strain, PM237, where one copy of FPR3 is under the control of an β-estradiol inducible GAL1 promoter (P GAL1 ) from budding yeast (Longtine et al., 1998). The strain also contained one copy of a Gal4 transcription factor-estrogen receptor chimera. Sporulating meiotic samples were collected at 9 and 20 hour and Trichloroacetic acid (TCA) samples were prepared for 136

147 Western blot analysis (for each replicate) to ensure overexpression of Fpr3 protein in the induced samples (Figure 1D). Robust Fpr3 was observed in induced samples whereas only a faint Fpr3 band was detected in uninduced samples (as expected since only one copy of FPR3 is expressed under an endogenous promoter) at both 9 and 20 hour. Zip1 protein was also detected in both uninduced and induced samples at 9 and 20 hour timepoints, confirming that the P GAL1 [FPR3]/+ cells have entered meiosis (Figure 1D). To test if FPR3-overexpression alters meiotic cell-cycle progression, we performed a sporulation time-course experiment. We used 1µM final concentration of β-estradiol to induce FPR3 expression through activation of the Gal4-ER chimera (Figure 1A). At each time-point ranging from 0-62 hours (i.e., 0, 9, 20, 24, 26, 28, 30, 40, 47, 50 and 62 hour), at least 700 sporulating meiotic cells (per replicate) were scored for monads, dyads, and triads/tetrads in both uninduced (UI) and induced (I) strains and % sporulation (% dyads and triads/tetrads) was determined. Spore viability was measured using sporulated samples collected from 47-hour time-point via standard dissection techniques. At least 150 asci/tetrads were dissected per strain. We found that sporulation is partially arrested in the induced P GAL1 [FPR3]/+ meiotic cells relative to their uninduced counterparts ( 45% sporulation in the induced strains versus 65% in the uninduced strains at 62 hours of sporulation; Figure 1B) while spore viability remains similar in both uninduced and induced strains (Table 1). We conclude that meiotic spore formation is partially blocked upon overexpression of FPR3. The partial reduction in sporulation efficiency in FPR3 overexpressing strains could suggest activation of meiotic checkpoint response by a subset of cells. We therefore determined whether the deletion of a protein required for a late meiotic prophase 137

148 checkpoint, Pch2, could bypass the partial sporulation arrest caused by FPR3 overexpression. An identical sporulation time-course experiment was executed using PM388 diploid strain that is isogenic to PM237 but homozygous for PCH2-deletion (pch2 P GAL1 [FPR3]/+ GAL4-ER/- ZIP1 NDT80). Spore viability was assessed for both uninduced and induced strains as before. Deletion of PCH2 rescues the partial sporulation arrest in meiotic cells overexpressing FPR3 (Figure 1C). Interestingly, spore viability is slightly lowered in the induced strain compared to the uninduced counterpart (Table 1). Fpr3-induction in pch2 P GAL1 [FPR3]/+ strains was also confirmed via Western blot (Figure 1D). Taken together, we conclude that deletion of PCH2 alleviates the partial arrest in meiotic cell-cycle progression upon FPR3-overexpression. 138

149 A! D! 0H! 9H! 62H! Meiotic cell-cycle progression! Fpr3! Induction! Assess sporulation! P GAL1! FPR3/+! PCH2! β-estradiol! Zip1! Fpr3! Early-meiotic! prophase (9H)! Mid-meiotic! prophase (20H)! ! ! ! zip1δ! Tubulin! Ponceau! (Total protein)! B" C" % Sporulation" P GAL1 [FPR3]/+ ZIP1+ NDT80+! pch2 P GAL1 [FPR3]/+ ZIP1+ NDT80+! n 700 per replicate" n 700 per replicate" Uninduced" Induced" % Sporulation" Uninduced" Induced" Hours in sporulation medium" Hours in sporulation medium" Figure 1. Overexpression of FPR3 causes a Pch2-dependent defect in meiotic cellcycle progression. (A) Cartoon depicts the experimental strategy for sporulation timecourse. (B-C) Linear bar graph represents % sporulation in P GAL1 [FPR3]/+ GAL4-ER/- (B) and pch2 P GAL1 [FPR3]/+ GAL4-ER/- (C) strains at various time intervals ranging from 0 to 62 hours. Both P GAL1 [FPR3]/+ GAL4-ER/- and pch2 P GAL1 [FPR3]/+ GAL4- ER/- strains were induced at t = 0 hour, sporulated (in 2% KAc) and assessed for the presence of monads, dyads, triads or tetrads (haploid spore products) under the light microscope at various time intervals together with the uninduced (UI) strains served as a control. X-axis indicates hours in sporulation medium. Uninduced (UI) strains: PCH2+ 139

150 (blue line), pch2δ (red line); induced (I) strains: PCH2+ (orange line), pch2δ (black line). n 700 for each uninduced (UI) and induced (I) strains per time-point per replicate; total of two replicates. Error bars indicate standard deviation of the mean. (D) Western blot shows an increase in Fpr3 protein level upon induction with β-estradiol. In both P GAL1 [FPR3]/+ and pch2 P GAL1 [FPR3]/+ strains, uninduced (UI) and induced (I) samples from late time-point (20 hour) showed more Zip1 protein compared to the early timepoint (9 hour). Ponceau S stain was used to visualize total protein and uniform loading per lane. 140

151 5.3.2 Overexpression of Fpr3 causes a defect in early prophase progression and SC assembly during meiotic prophase We wondered whether the delay in meiotic spore formation is due to a defect in SC assembly caused by Fpr3 overproduction. The observations that Fpr3 is required for Zip1 polycomplex formation in spo11 meiotic nuclei and Fpr3 co-localizes with Zip1 within a polycomplex suggest that Fpr3 might act as a molecular chaperone directly regulating Zip1 folding (MacQueen and Roeder, 2009). If Fpr3 directly binds Zip1, perhaps overexpression of Fpr3 will alter the behavior of Zip1 in prophase cells undergoing otherwise normal meiosis. To study the effect of FPR3-overexpression on SC assembly, we constructed a diploid strain PM115 that is isogeneic to PM237 but homozygous for ZIP1-GFP and NDT80-deletion (P GAL1 [FPR3]/+ ZIP1-GFP/ZIP1-GFP ndt80/ndt80 GAL4-ER/-). We conducted the Fpr3-overexpression experiment, in duplicate, with 4 time points (10, 13, 16 and 19 hour) using 1µM final concentration of β-estradiol (Figure 2A). At each time-point, we collected meiotic samples for chromosome spreads as well as for Western blot analysis (using TCA precipitation of total protein extract). Fixed, surface-spread meiotic nuclei were stained with anti-zip1/gfp and anti-red1 antibodies. For both uninduced and induced strains at each given time-point, we imaged selected nuclei based on DAPI staining and assessed for Red1 and Zip1 staining patterns in both uninduced and induced samples as a read out for meiotic prophase progression and SC assembly (n 50). We also measured the number of Zip1 stretches per nucleus (n = 50 per replicate; total of two replicates) as well as cumulative length of Zip1 stretches (in microns) per nucleus (n 45 per replicate; total of two replicates) to further obtain a detailed analysis of SC assembly. 141

152 We noticed that overexpression of one copy of FPR3 (P GAL1 [FPR3]/+) using an estradiol-inducible promoter in induced strains causes a delay in Zip1 loading on chromosomes during early-meiotic (13 hour) and near-mid-meiotic (19 hour) prophase when uninduced nuclei normally exhibit low/moderate and robust Zip1 loading respectively. At 13 hour, while 50% of uninduced strains showed dotty-linear Zip1 staining induced strains mostly showed either dotty Zip1 or Zip1 foci/no Zip1 staining. At 19 hour, 50% of nuclei in uninduced strains showed linear Zip1 whereas induced strains mostly ( 45%) exhibited dotty-linear Zip1 staining with few linear Zip1 (Figure 2C). Furthermore, we observed that both the number of SCs per nucleus and the cumulative lengths of SC per nucleus are reduced in the induced strains compared to their uninduced counterparts at each given time-points (Figure 2, D and E). During meiotic prophase, leptotene/zygotene nuclei typically exhibit dotty (multiple foci) Red1 staining, whereas pachytene (mid-prophase) nuclei display dotty-linear (a combination of foci and short/long discontinuous stretches) to linear (mostly continuous long stretches) (Mitra and Roeder, 2007; Smith and Roeder, 1997). We found that Red1 exhibited at 13 hour is primarily dotty to dotty-linear in induced strains versus dotty-linear (with few linear) in uninduced strains, and at 19 hour, Red1 looks dotty to dotty-linear in induced strains versus dotty-linear to linear in uninduced strains (Figure 2C). These results suggest that overexpression of Fpr3 delays or arrests early (prepachytene) prophase progression and SC assembly in a subset of cells during meiotic prophase. Consistent with these observations, we detected a 2-fold decrease in Zip1 protein level between uninduced and induced samples on a Western blot at 13, 19 and 24 hour 142

153 (Figure 2B). We also noticed that overproduced Fpr3 protein level gradually decreases over time. A 2-fold reduction in Fpr3 protein level was noticed after every 5-6 hour time intervals (i.e., between 13 and 24 hour) in the induced samples (Figure 2B). Taken together, we conclude that Fpr3 overexpression results in a delay or arrest in early meiotic (pre-pachytene) prophase progression in a subset of cells. Alternatively, Fpr3 overexpression results in reduced SC protein levels that elicit a checkpoint response, thereby delaying or partially arresting early meiotic (pre-pachytene) prophase progression. This eventually delays or partially blocks SC protein loading on chromosomes and SC assembly. 143

154 A! 0H! 10H! 19H! Meiotic prophase progression! FPR3/+! P GAL1! FPR3/+! P GAL1! Fpr3! induction! Chromosome! spread! Zip1 Assembly! Uninduced! (UI)! Zip1?! Induced! (I)! ooo! B! Early-meiotic! prophase! Mid-meiotic! prophase! 24H! 13H! 19H! 24H! Duration of sporulation! zip1δ! ! ! ! P GAL1! FPR3/+! PCH2! β-estradiol! Zip1-GFP! *! *! Red1! Fpr3! Tubulin! Zip1-GFP and Red1 levels! normalized to Tubulin! UI 13H I 13H UI 19H I 19H UI 24H I 24H UI 24H Zip1-GFP Red1 Fpr3 level! normalized to Tubulin! pch2! P GAL1 [FPR3]/+! P GAL1 [FPR3]/+! P GAL1 [FPR3]/+! UI 13H I 13H UI 19H I 19H UI 24H I 24H UI 24H Fpr3 pch2! P GAL1 [FPR3]/+! 144

155 C! DAPI Red1! Foci/None! Dotty! Dotty-Linear! Linear! Linear! DAPI Zip1-GFP! Foci/None! Dotty! Dotty-Linear! Linear! Linear! P GAL1 [FPR3]/+ ndt80 ZIP1-GFP! P GAL1 [FPR3]/+ ndt80 ZIP1-GFP! % nuclei with a specific " Zip1 staining pattern" Foci/None Dotty-Linear UI 13H I 13H UI 19H Dotty Linear I 19H n 50" % nuclei with a specific " Red1 staining pattern" Foci/None Dotty-Linear UI 13H I 13H Dotty Linear n 50" UI 19H I 19H D! E! # of Zip1 stretches per nucleus! Early-meiotic! prophase! P GAL1 [FPR3]/+ ndt80 ZIP1-GFP! n = 100! UI 10H! I 10H! UI 13H! I 13H! UI 16H! I 16H! Mid-meiotic! prophase! UI 19H! I 19H! Cumulative length of! Zip1 stretches (in microns) per nucleus! Early-meiotic! prophase! P GAL1 [FPR3]/+ ndt80 ZIP1-GFP! n 90! UI 10H! I 10H! UI 13H! I 13H! UI 16H! I 16H! Mid-meiotic! prophase! UI 19H! I 19H! 145

156 Figure 2. Overexpression of FPR3 causes a defect in early prophase progression and SC assembly in meiotic prophase cells. (A) Cartoon depicts the experimental strategy for Fpr3-overexpression. P GAL1 [FPR3]/+ cells were induced with β-estradiol at t = 0 hour; meiotic chromosomes were fixed, surface-spread and analyzed after 10, 13, 16 and 19 hours of sporulation. (B) Western blot (top) shows Zip1-GFP, Red1, Fpr3 and Tubulin protein level at various time intervals in uninduced (UI) and induced (I) P GAL1 [FPR3]/+ strains. Fpr3 protein level increased upon induction whereas uninduced (UI) strains displayed more Zip1 protein compared to the induced (I) strains. Tubulin served as a loading (internal) control. Asterisks indicate non-specific bands. Bar graph (bottom) shows normalized Zip1-GFP, Red1 and Fpr3 protein levels relative to Tubulin at various time intervals in uninduced (UI) and induced (I) P GAL1 [FPR3]/+ strains. (C) Representative images (top) demonstrating specific Red1 and Zip1 staining patterns: Foci/None, Dotty, Dotty-Linear and Linear. Bar (stacked) graph (bottom) displays % nuclei with a specific Zip1 (black) and Red1 (red) staining pattern in uninduced (UI) and induced (I) P GAL1 [FPR3]/+ strains at 13 and 19 hour (n 50). (D-E) Scatter plot indicates number of Zip1 stretches per nucleus (D) (n 50 per replicate; total of two replicates) and cumulative length of Zip1 stretches (in microns) per nucleus (E) (n 45 per replicate; total of two replicates) at various time intervals in uninduced (UI) and induced (I) P GAL1 [FPR3]/+ strains. X-axis shows duration of induction conditions. Blue and orange dots correspond to uninduced (UI) and induced (I) nuclei respectively. Horizontal black bar represents mean with standard error of mean. 146

157 5.3.3 Deletion of PCH2 rescues the defect in early prophase progression and SC assembly caused by Fpr3-overexpression Based on the above results, we hypothesize that Fpr3 overexpression alters an early prophase event (such as recombination or SC protein expression) that elicits an early prophase checkpoint response and delays SC assembly. Since the deletion of PCH2 alleviates the delay in meiotic spore formation caused by Fpr3-overexpression and Pch2 generally functions as a recombination/synapsis checkpoint protein, we wondered whether a PCH2 deletion bypasses the synapsis (SC assembly) defect caused by FPR3- overexpression. To test this, we generated a diploid strain PM531 that is isogenic to PM115 but homozygous for PCH2 deletion (pch2/pch2 P GAL1 [FPR3]/+ ZIP1-GFP/ZIP1- GFP ndt80/ndt80 GAL4-ER/-). We performed an identical Fpr3-overexpression experiment (as before) in a pch2 mutant background (in duplicate) with 3 different time-points (13, 19 and 24 hour) to assess SC assembly (Figure 3A). Similar to our previous experiment, at each given timepoint we collected samples for surface chromosome-spread and TCA preparation for performing Western blot. Surface-spread meiotic nuclei were stained with anti-gfp and anti-red1 antibodies for the determination of Red1 and Zip1 staining patterns and measurement of SC at each given time-point. We found that deletion of PCH2 in strains overexpressing one copy of FPR3 (pch2 P GAL1 [FPR3]/+) rescues the defect in Red1 and Zip1 loading on chromosomes during early-meiotic prophase and SC assembly during mid-meiotic prophase. We observed that the majority of nuclei from both uninduced and induced strains display dotty Red1 staining at 13 hour, dotty-linear Red1 staining at 19 hour and linear Red1 staining at

158 hour (n 50 per replicate; total of two replicates) (Figure 3C). Additionally, we noticed that the number of SCs per nucleus remain similar between uninduced and induced strains at each given time-point (n 50 per replicate; total of two replicates) (Figure 3D). However, our Western blot analysis revealed reduced Zip1 protein level in the induced strains compared to their uninduced counterparts at 13, 19 and 24 hour (Figure 3B). Consistent with our previous observation, we also noticed a gradual decrease in overproduced Fpr3 protein level over time in the induced pch2 P GAL1 [FPR3]/+ meiotic cells (Figure 3B). We conclude that deletion of PCH2 bypasses the early prophase progression defect as well as the SC assembly defect in Fpr3-overexpressing meiotic cells. Taken together, these observations support the idea that overproduction of Fpr3 might alter the overall nuclear Zip1 and Red1 levels, and cause a Pch2 induced partial arrest in early-meiotic prophase progression, SC assembly and meiotic spore formation. 148

159 A! 0H! 13H! 24H! Meiotic prophase progression! FPR3/+! pch2 P GAL1! FPR3/+! pch2 P GAL1! Fpr3! induction! Chromosome! spread! Zip1 Assembly! Uninduced! (UI)! Zip1?! Induced! (I)! ooo! B! zip1δ! 24H! Early-meiotic! prophase! 13H! 19H! 24H! Mid-meiotic! prophase! ! ! ! Duration of sporulation! P GAL1! PCH2! FPR3/+! β-estradiol! Zip1-GFP! Red1! Fpr3! Tubulin! Zip1-GFP and Red1 levels! normalized to Tubulin! UI 13H I 13H UI 19H I 19H UI 24H I 24H UI 24H Zip1-GFP Red1 Fpr3 level! normalized to Tubulin! UI 13H I 13H UI 19H I 19H UI 24H I 24H UI 24H Fpr3 pch2 P GAL1 [FPR3]/+! P GAL1 [FPR3]/+! pch2 P GAL1 [FPR3]/+! P GAL1 [FPR3]/+! 149

160 C! n 50 per replicate! n 50 per replicate! Foci/None Dotty Foci/None 100 Dotty-Linear Linear 100 Dotty-Linear % nuclei with a specific! Zip1 staining pattern! UI 13H I 13H UI 19H I 19H UI 24H I 24H UI 13H I 13H UI 19H I 19H UI 24H I 24H % nuclei with a specific! Red1 staining pattern! UI 13H I 13H UI 19H I 19H UI 24H I 24H Dotty Linear UI 13H I 13H UI 19H I 19H UI 24H I 24H P GAL1 [FPR3]/+! pch2! P GAL1 [FPR3]/+! P GAL1 [FPR3]/+! pch2! P GAL1 [FPR3]/+! D" # of Zip1 stretches per nucleus" Early-meiotic" prophase " n 50 per replicate" Mid-meiotic" prophase " P GAL1 [FPR3]/+ ndt80 ZIP1-GFP (UI)! P GAL1 [FPR3]/+ ndt80 ZIP1-GFP (I)! pch2 P GAL1 [FPR3]/+ ndt80 ZIP1-GFP (UI)! pch2 P GAL1 [FPR3]/+ ndt80 ZIP1-GFP (I)! Figure 3. Deletion of PCH2 rescues the early prophase progression and SC assembly defect in Fpr3-overexpressing meiotic cells. (A) Cartoon shows Fpr3-overexpression experimental strategy in pch2. pch2 P GAL1 [FPR3]/+ cells were induced with β-estradiol at t = 0 hour; meiotic chromosomes were surface-spread and analyzed after 13, 19 and 24 hours of sporulation. (B) Western blot (top) shows the amount of Zip1-GFP, Red1, Fpr3 and Tubulin (loading control) protein at different time intervals in both uninduced (UI) and induced (I) pch2 P GAL1 [FPR3]/+ strains. Induced (I) strains showed an elevated Fpr3 protein level at all three (13, 19 and 24 hour) time-points. Bar graph (bottom) indicates normalized Zip1-GFP, Red1 and Fpr3 protein levels relative to Tubulin at various time 150