Lecture 2. The Blast2GO annotation framework
|
|
- Timothy Cunningham
- 6 years ago
- Views:
Transcription
1 Lecture 2 The Blast2GO annotation framework Annotation steps Modulation of annotation intensity Export/Import Functions Sequence Selection Additional Tools
2 Functional assignment Annotation Transference Empirical Literature reference Filogeny Molecular interactions Gene/protein expression Biochemical assay Structure Comparison Identification of folds Sequence analysis Sequence homology Motif identification
3 Blast2GO site
4 Start Blast2GO
5 Start Blast2GO
6 Input data (in FASTA format, AA or nt) >my_favourite_species_seq1 still unknown gtgatggaaaagaaaagttttgttatcgtcgacgcatatgggtttctttttcgcgcgtattatgcgctgcctggattaagcacctcatacaattttcctgtaggaggtgtatatggtttt ataaacatacttttgaaacatctctctttccacgatgcagattatttagttgtggtatttgattcggggtcgaaaaattttcgtcacactatgtattccgaatacaaaactaatcgccc taaagcaccagaggatctgtcactacaatgtgctccgctacgtgaggctgttgaagcgtttaatattgtaagtgaagaagtgcttaactacgaagcagacgacgtaatagct acactctgtacaaaatatgcatctagtaatgttggagtgagaatactgtcagcagataaggatttactacaactcctaaatgataatgttcaagtttacgaccctataaaaagc agatacctcaccaatgaatacgttttagaaaaatttggtgtttcatcagataagttgcatattgatacggttgcatcgagttataatgagaaaattattctcagctaagctgtacac cgtttattacacactcgaaaggccgttag as >my_favourite_species_seq2 no clue df ttgttagctaaaaaggaagactttcacacctttggtaatggtgttggctctgctggaacaggtggagttgtagtttctgcatccatgttgtctgcggatttttcaaatcttagagaag agatagcagcggttagtacggctggtgcagattggttacacattgatgtgatggatgggtgcttcgtccccagtttgactatgggtcctgtggtgatttccggcattaggaaatgt acaaatatgtttcttgatgtgcatttgatgattaatcgcccaggcgatcatctgaagagtgtggtagatgctggagctgataagatagagcacattcgcaagatgatagagga asdf aagctcatcaaccgcgaaaatcgctgttgatggtggtgtttcaacggataatgcccgggctgttatcgaggcaggtgcgaatatactcgttgttggaacggcgctgtttgctgc tgacgatatgagtaaagttgtaagaactttaaaatcattttaa >my_favourite_species_seq3 just sequenced gtgggactgctcatccctgtaggcagggtggctattttttgtgtaaaggcagtctttcatagtcttgtaccgccatactatctatggataactacaaagcagttttttgaggtgtggtt tttctctcttcctatagtagcagttacatctttgtttacgggaggcgcgttagcccttcaggataccctcgtgggaagcgctaaagtatcagggtaatggagtttttactcctgcaa gatgtaatagagggtctggtaaaagctgtatcgtttgggctggtaatttcgctagttgggtgttacaacgggtatcactgtgagataggcgcaaggggtgtaggaacagcga caacaaaaacttcggtagcagcttctatgctcataattttgttaaactatataattactgttttttacgcgta >my_favourite_species_seq4 we will see soon... atgtacgctgtatctctttcaaatttgcatgtctctttcaacaacaaggaggttttgaaaggtgttgacttggacatagcatggggggattccctggttatactgggagaatctggt agtggaaagtctgtactaacaaaggttgtattgggtctaatagtgccccaagagggaagtgttactgtagatggcaccaatattcttgagaataggcagggcatcaagaatt ttagtgttttgtttcaaaactgtgcgttatttgacagtcttacgatttgggaaaatgtagtattcaatttccgtaggaggcttcgtttagataaggataatgccaaggctttggctttac ggggattggagcttgtgggattggacgccagtgtaatgaacgtgtatcctgtggagctatcaggcgggatgaaaaagcgcgtagctttggcaagagctattataggtagtcc caaaattctaattttggatgagccaacttcgggattggatcctataatgtcttcagtggt
7 Blast2GO PRO Your Login: b2goeiras Your Password: b2goeiras2012
8 Blast2GO Application (1) Blast (2) Mapping (3) Annotation Main Sequence Table Any operation will only affect to selected sequences!!!! Application statistics Blast results Application messages Graph visualisation
9 The First Check Click on the green arrow to check you can connect to DB A GO graph should appear
10 Load Sequences
11 Run BLAST search BLAST against NCBI or locally Choose different DBs In combination with URL Limit to query-hit overlap Recommended to save as XML Text mining on BLAST hit description
12 Choose other DB at NCBI Set at blast2go.properties file
13 BLAST Results RED
14 Blast Distribution Charts Evaluate the similarity of your sequences with public DBs
15 Single Sequence Menu Single Sequence Menu
16 Mapping Results GREEN
17 Resources for mapping Gene Ontology Database NCBI data-files: gene2accession ( entries) gene_info ( entries) Protein Information Resource (PIR): Non-Redundant Reference Protein Database including PSD, UniProt, Swiss-Prot, TrEMBL, RefSeq, GenPept and PDB BLAST Hit IDs ACCs/GIs Gene-Symbols EC Mapping Resources GO terms sim %
18 Annotation Menu BLAST based annotation Other Annotation modes Validation and Annex
19 Annotation Allows to set a minimum percentage of the HIT sequence which should be expand by the QUERY sequence This helps to avoid the problem of cis-annotation
20 Annotation Result BLUE
21 Graph Visualization Root GO term Intermediate GO term Source/Hit GO term Annotated GO term
22 Annotation Charts
23 Annotation Charts Commonly, level 5 is the most abundant specificity level in the Gene Ontology
24 Additional Annotation: ANNEX Recovers implicit biological process and cellular component GO terms based on molecular function annotations Molecular Function is involved in Biological Process Myhre et al, Bioinformatics 2006 acts in Cellular Component
25 Additional Annotation: InterProScan Runs InterProScan searches at the EBI through Blast2GO Once you have completed your InterPro annotation, results can be transformed to GO terms and merged to Blast annotation Results are stored at your computer as XML files. You can upload them later
26 InterProScan Results Column with InterProScan results
27 Additional Annotation: GOSlim GOSlim is a reduction of the Gene Ontology to a more reduced vocabulary Helps to summarize information After GOSlim transformation sequences get YELLOW Different GOSlims available at Blast2GO
28 Enzyme annotation and Kegg Maps GO Enzyme Codes KEGG maps
29 Additional Annotation: Manual Curation You can modify manually annotation of particular sequences If you click in this box, curated sequences get purple
30 Export Results Saves the complete B2G project (heavy) Export annotation results in different formats
31 Export formats.annot C04018C10 C04018C10 C04018A12 C04018A12 GO: EC: GO: GO: mitogen-activated protein kinase 3 Also for import! class iv chitinase GeneSpring Format C04013E10 response to water deprivation; regulation ofnucleus; transcription; multicellular organismal transcription development; factorresponse activity; to abscisic acid stimulus; C04013A12 translation; ribosome; plastid; structural constituent of ribosome; C04013C12 galactose metabolic process; plastid; aldose 1-epimerase activity; carbohydrate binding; GoStat C04018C10 C04018A12 C04018C ,9409,6979,10200,5524, ,272, ,12505,8233 By Seq C04018A02 C04018C02 C04018G02 glyoxalase i metallothionein-like protein protein phosphatase GO: GO: GO: F:lactoylglutathione lyase activity F:metal ion binding C:protein serine/threonine phosphatase complex
32 More export formats Export Sequence Table Seq. Name C04018C12 C04018E12 C04018G12 C04018A02 C04018C02 C04018E02 C04018G02 C04018C04 C04018E04 C04018G04 C04018A06 Seq. Description Seq. Length #Hits min. evaluemean Similarity#GOs GOs Enzyme Codes InterProScan cysteine proteinase inhibitor % 3 F:GO: ; C:GO: ; F:GO: IPR000010; IPR protein phosphatase 2c % 2 N:GO: ; F:GO: IPR001932; IPR alpha beta fold family protein % 4 F:GO: ; C:GO: ; C:GO: ; noipr P:GO:00 glyoxalase i % 2 P:GO: ; F:GO: EC: IPR004360; noipr metallothionein-like protein % 1 F:GO: IPR haemolysin-iii related familyexpressed % 1 C:GO: noipr protein phosphataseexpressed % 5 C:GO: ; N:GO: ; P:GO: ; no IPS match C:GO:00 phosphoglycerate bisphosphoglycerate mutase 780 family 20 protein % 2 P:GO: ; F:GO: IPR001345; IPR polyubiquitin % 2 P:GO: ; C:GO: IPR000626; IPR meiotic recombination % 21 C:GO: ; P:GO: ; F:GO: ; IPR003701; IPR F:GO:000 late embryogenesis-abundant protein % 2 P:GO: ; P:GO: no IPS match Export BestHit Data Sequence name C04018C10 C04018E10 C04018G10 C04018A12 C04018C12 C04018E12 C04018G12 C04018A02 C04018C02 Sequence desc. Sequence lengthhit desc. Hit ACC E-Value Similarity Score Alignment lengthpositives mitogen-activated protein kinase gi gb ABM mitogen-activated ABM E-123 protein kinase99 [Citrus sinensis] NA--706 gi emb CAO unnamed CAO62459 protein 2.69E-036 product [Vitis83 vinifera] protein 620 gi gb ABI ABI52743 kda putative 7.47E-015 secreted protein 63 [Argas monolakensis] class iv chitinase 715 gi gb AAC chitinase AAC35981 CHI1 1.45E-061 [Citrus sinensis] cysteine proteinase inhibitor 663 gi gb AAF AF265551_1cysteine AAF E-025 protease inhibitor 83 [Manihot esculenta] protein phosphatase 2c 663 gi gb AAS protein AAS86762 phosphatase 2.76E-077 2C [Lycopersicon esculentum] alpha beta fold family protein 578 gi emb CAN hypothetical CAN E-084 protein [Vitis vinifera] >gi emb CAO unnam glyoxalase i 600 gi emb CAB hypothetical CAB09799 protein 2.16E-064 [Citrus x paradisi] metallothionein-like protein 625 gi dbj BAA metallothionein-like BAA E-014 protein [Citrus100 unshiu]
33 Sequence Selection Sequence Selection tool to obtain a selection based on annotation status
34 Sequence Selection By Name/Description By Function
35 View Menu Functions to switch between displaying IDs or descriptions for GO annotation or InterPro results
36 Other Tools Permits to reduce the project size Manipulation of sequence desc. Merging.annot and.dat projects Get more out of your memory Check when connection problems
Genome Annotation. Bioinformatics and Computational Biology. Genome sequencing Assembly. Gene prediction. Protein targeting.
Genome Annotation Bioinformatics and Computational Biology Genome Annotation Frank Oliver Glöckner 1 Genome Analysis Roadmap Genome sequencing Assembly Gene prediction Protein targeting trna prediction
More informationSABIO-RK Integration and Curation of Reaction Kinetics Data Ulrike Wittig
SABIO-RK Integration and Curation of Reaction Kinetics Data http://sabio.villa-bosch.de/sabiork Ulrike Wittig Overview Introduction /Motivation Database content /User interface Data integration Curation
More informationGene Ontology and overrepresentation analysis
Gene Ontology and overrepresentation analysis Kjell Petersen J Express Microarray analysis course Oslo December 2009 Presentation adapted from Endre Anderssen and Vidar Beisvåg NMC Trondheim Overview How
More informationATLAS of Biochemistry
ATLAS of Biochemistry USER GUIDE http://lcsb-databases.epfl.ch/atlas/ CONTENT 1 2 3 GET STARTED Create your user account NAVIGATE Curated KEGG reactions ATLAS reactions Pathways Maps USE IT! Fill a gap
More informationEBI web resources II: Ensembl and InterPro
EBI web resources II: Ensembl and InterPro Yanbin Yin http://www.ebi.ac.uk/training/online/course/ 1 Homework 3 Go to http://www.ebi.ac.uk/interpro/training.htmland finish the second online training course
More information-max_target_seqs: maximum number of targets to report
Review of exercise 1 tblastn -num_threads 2 -db contig -query DH10B.fasta -out blastout.xls -evalue 1e-10 -outfmt "6 qseqid sseqid qstart qend sstart send length nident pident evalue" Other options: -max_target_seqs:
More informationFunctional Annotation
Functional Annotation Outline Introduction Strategy Pipeline Databases Now, what s next? Functional Annotation Adding the layers of analysis and interpretation necessary to extract its biological significance
More informationHands-On Nine The PAX6 Gene and Protein
Hands-On Nine The PAX6 Gene and Protein Main Purpose of Hands-On Activity: Using bioinformatics tools to examine the sequences, homology, and disease relevance of the Pax6: a master gene of eye formation.
More informationComparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis
Title Comparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis Author list Yu Han 1, Huihua Wan 1, Tangren Cheng 1, Jia Wang 1, Weiru Yang 1, Huitang Pan 1* & Qixiang
More informationA Protein Ontology from Large-scale Textmining?
A Protein Ontology from Large-scale Textmining? Protege-Workshop Manchester, 07-07-2003 Kai Kumpf, Juliane Fluck and Martin Hofmann Instructive mistakes: a narrative Aim: Protein ontology that supports
More informationDATA ACQUISITION FROM BIO-DATABASES AND BLAST. Natapol Pornputtapong 18 January 2018
DATA ACQUISITION FROM BIO-DATABASES AND BLAST Natapol Pornputtapong 18 January 2018 DATABASE Collections of data To share multi-user interface To prevent data loss To make sure to get the right things
More informationSupplementary Information 16
Supplementary Information 16 Cellular Component % of Genes 50 45 40 35 30 25 20 15 10 5 0 human mouse extracellular other membranes plasma membrane cytosol cytoskeleton mitochondrion ER/Golgi translational
More informationProtein function prediction based on sequence analysis
Performing sequence searches Post-Blast analysis, Using profiles and pattern-matching Protein function prediction based on sequence analysis Slides from a lecture on MOL204 - Applied Bioinformatics 18-Oct-2005
More informationAnnotation Error in Public Databases ALEXANDRA SCHNOES UNIVERSITY OF CALIFORNIA, SAN FRANCISCO OCTOBER 25, 2010
Annotation Error in Public Databases ALEXANDRA SCHNOES UNIVERSITY OF CALIFORNIA, SAN FRANCISCO OCTOBER 25, 2010 1 New genomes (and metagenomes) sequenced every day... 2 3 3 3 3 3 3 3 3 3 Computational
More informationNetworks & pathways. Hedi Peterson MTAT Bioinformatics
Networks & pathways Hedi Peterson (peterson@quretec.com) MTAT.03.239 Bioinformatics 03.11.2010 Networks are graphs Nodes Edges Edges Directed, undirected, weighted Nodes Genes Proteins Metabolites Enzymes
More informationWeek 10: Homology Modelling (II) - HHpred
Week 10: Homology Modelling (II) - HHpred Course: Tools for Structural Biology Fabian Glaser BKU - Technion 1 2 Identify and align related structures by sequence methods is not an easy task All comparative
More informationIntegration of functional genomics data
Integration of functional genomics data Laboratoire Bordelais de Recherche en Informatique (UMR) Centre de Bioinformatique de Bordeaux (Plateforme) Rennes Oct. 2006 1 Observations and motivations Genomics
More informationBioinformatics: Investigating Molecular/Biochemical Evidence for Evolution
Bioinformatics: Investigating Molecular/Biochemical Evidence for Evolution Background How does an evolutionary biologist decide how closely related two different species are? The simplest way is to compare
More informationCSCE555 Bioinformatics. Protein Function Annotation
CSCE555 Bioinformatics Protein Function Annotation Why we need to do function annotation? Fig from: Network-based prediction of protein function. Molecular Systems Biology 3:88. 2007 What s function? The
More informationChapter 5. Proteomics and the analysis of protein sequence Ⅱ
Proteomics Chapter 5. Proteomics and the analysis of protein sequence Ⅱ 1 Pairwise similarity searching (1) Figure 5.5: manual alignment One of the amino acids in the top sequence has no equivalent and
More informationProteins: Structure & Function. Ulf Leser
Proteins: Structure & Function Ulf Leser This Lecture Proteins Structure Function Databases Predicting Protein Secondary Structure Many figures from Zvelebil, M. and Baum, J. O. (2008). "Understanding
More information- conserved in Eukaryotes. - proteins in the cluster have identifiable conserved domains. - human gene should be included in the cluster.
NCBI BLAST Services DELTA-BLAST BLAST (http://blast.ncbi.nlm.nih.gov/), Basic Local Alignment Search tool, is a suite of programs for finding similarities between biological sequences. DELTA-BLAST is a
More informationEBI web resources II: Ensembl and InterPro. Yanbin Yin Spring 2013
EBI web resources II: Ensembl and InterPro Yanbin Yin Spring 2013 1 Outline Intro to genome annotation Protein family/domain databases InterPro, Pfam, Superfamily etc. Genome browser Ensembl Hands on Practice
More informationUpdate on human genome completion and annotations: Protein information resource
UPDATE ON GENOME COMPLETION AND ANNOTATIONS Update on human genome completion and annotations: Protein information resource Cathy Wu 1 and Daniel W. Nebert 2 * 1 Director of PIR, Department of Biochemistry
More informationBioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
More informationBMD645. Integration of Omics
BMD645 Integration of Omics Shu-Jen Chen, Chang Gung University Dec. 11, 2009 1 Traditional Biology vs. Systems Biology Traditional biology : Single genes or proteins Systems biology: Simultaneously study
More informationDe novo assembly of the pepper transcriptome (Capsicum annuum): a benchmark for in silico discovery of SNPs, SSRs and candidate genes
Additional_file Ashrafi_et_al_0_Pepper_Annotation_Supp_0070.docx A Microsoft-Word 007 file with figures comparing the results of BlastGO for GeneChip (Sanger-EST) and transcriptome assemlies of pepper
More informationWe have: We will: Assembled six genomes Made predictions of most likely gene locations. Add a layers of biological meaning to the sequences
Recap We have: Assembled six genomes Made predictions of most likely gene locations We will: Add a layers of biological meaning to the sequences Start with Biology This will motivate the choices we make
More informationBIOINFORMATICS LAB AP BIOLOGY
BIOINFORMATICS LAB AP BIOLOGY Bioinformatics is the science of collecting and analyzing complex biological data. Bioinformatics combines computer science, statistics and biology to allow scientists to
More informationComparing whole genomes
BioNumerics Tutorial: Comparing whole genomes 1 Aim The Chromosome Comparison window in BioNumerics has been designed for large-scale comparison of sequences of unlimited length. In this tutorial you will
More informationCS612 - Algorithms in Bioinformatics
Fall 2017 Databases and Protein Structure Representation October 2, 2017 Molecular Biology as Information Science > 12, 000 genomes sequenced, mostly bacterial (2013) > 5x10 6 unique sequences available
More informationAndrogen-independent prostate cancer
The following tutorial walks through the identification of biological themes in a microarray dataset examining androgen-independent. Visit the GeneSifter Data Center (www.genesifter.net/web/datacenter.html)
More informationUpdate on genome completion and annotations: Protein Information Resource
UPDATE ON GENOME COMPLETION AND ANNOTATIONS Update on genome completion and annotations: Protein Information Resource Cathy Wu 1 and Daniel W. Nebert 2 * 1 Director of PIR, Department of Biochemistry and
More informationBioinformatics Exercises
Bioinformatics Exercises AP Biology Teachers Workshop Susan Cates, Ph.D. Evolution of Species Phylogenetic Trees show the relatedness of organisms Common Ancestor (Root of the tree) 1 Rooted vs. Unrooted
More informationRGP finder: prediction of Genomic Islands
Training courses on MicroScope platform RGP finder: prediction of Genomic Islands Dynamics of bacterial genomes Gene gain Horizontal gene transfer Gene loss Deletion of one or several genes Duplication
More informationSynteny Portal Documentation
Synteny Portal Documentation Synteny Portal is a web application portal for visualizing, browsing, searching and building synteny blocks. Synteny Portal provides four main web applications: SynCircos,
More information08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega
BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments
More informationBrowsing Genomic Information with Ensembl Plants
Browsing Genomic Information with Ensembl Plants Etienne de Villiers, PhD (Adapted from slides by Bert Overduin EMBL-EBI) Outline of workshop Brief introduction to Ensembl Plants History Content Tutorial
More informationEBI web resources II: Ensembl and InterPro
EBI web resources II: Ensembl and InterPro Yanbin Yin Fall 2015 h.p://www.ebi.ac.uk/training/online/course/ 1 Homework 3 Go to h.p://www.ebi.ac.uk/interpro/training.html and finish the second online training
More informationBioinformatics. Proteins II. - Pattern, Profile, & Structure Database Searching. Robert Latek, Ph.D. Bioinformatics, Biocomputing
Bioinformatics Proteins II. - Pattern, Profile, & Structure Database Searching Robert Latek, Ph.D. Bioinformatics, Biocomputing WIBR Bioinformatics Course, Whitehead Institute, 2002 1 Proteins I.-III.
More informationSupplemental Materials
JOURNAL OF MICROBIOLOGY & BIOLOGY EDUCATION, May 2013, p. 107-109 DOI: http://dx.doi.org/10.1128/jmbe.v14i1.496 Supplemental Materials for Engaging Students in a Bioinformatics Activity to Introduce Gene
More informationStructure to Function. Molecular Bioinformatics, X3, 2006
Structure to Function Molecular Bioinformatics, X3, 2006 Structural GeNOMICS Structural Genomics project aims at determination of 3D structures of all proteins: - organize known proteins into families
More informationIdentifying Signaling Pathways
These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by Anthony Gitter, Mark Craven, Colin Dewey Identifying Signaling Pathways BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018
More informationIntroduction to Bioinformatics Online Course: IBT
Introduction to Bioinformatics Online Course: IBT Multiple Sequence Alignment Building Multiple Sequence Alignment Lec1 Building a Multiple Sequence Alignment Learning Outcomes 1- Understanding Why multiple
More informationExamples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE
Examples of Protein Modeling Protein Modeling Visualization Examination of an experimental structure to gain insight about a research question Dynamics To examine the dynamics of protein structures To
More informationAdvanced practical course in genome bioinformatics DAY 6: Functional annotation. Petri Törönen Earlier version Patrik Koskinen
Advanced practical course in genome bioinformatics DAY 6: Functional annotation Petri Törönen Earlier version Patrik Koskinen Genome project roadmap After experimental design and preparations a genome
More informationBioinformatics tools for phylogeny and visualization. Yanbin Yin
Bioinformatics tools for phylogeny and visualization Yanbin Yin 1 Homework assignment 5 1. Take the MAFFT alignment http://cys.bios.niu.edu/yyin/teach/pbb/purdue.cellwall.list.lignin.f a.aln as input and
More informationJMJ14-HA. Col. Col. jmj14-1. jmj14-1 JMJ14ΔFYR-HA. Methylene Blue. Methylene Blue
Fig. S1 JMJ14 JMJ14 JMJ14ΔFYR Methylene Blue Col jmj14-1 JMJ14-HA Methylene Blue Col jmj14-1 JMJ14ΔFYR-HA Fig. S1. The expression level of JMJ14 and truncated JMJ14 with FYR (FYRN + FYRC) domain deletion
More informationUnderstanding Sequence, Structure and Function Relationships and the Resulting Redundancy
Understanding Sequence, Structure and Function Relationships and the Resulting Redundancy many slides by Philip E. Bourne Department of Pharmacology, UCSD Agenda Understand the relationship between sequence,
More informationToxiCat: Hybrid Named Entity Recognition services to support curation of the Comparative Toxicogenomic Database
ToxiCat: Hybrid Named Entity Recognition services to support curation of the Comparative Toxicogenomic Database Dina Vishnyakova 1,2, 4, *, Julien Gobeill 1,3,4, Emilie Pasche 1,2,3,4 and Patrick Ruch
More informationProject Manual Bio3055. Apoptosis: Caspase-1
Project Manual Bio3055 Apoptosis: Caspase-1 Bednarski 2003 Funded by HHMI Apoptosis: Caspase-1 Introduction: Apoptosis is another name for programmed cell death. It is a series of events in a cell that
More informationHomology. and. Information Gathering and Domain Annotation for Proteins
Homology and Information Gathering and Domain Annotation for Proteins Outline WHAT IS HOMOLOGY? HOW TO GATHER KNOWN PROTEIN INFORMATION? HOW TO ANNOTATE PROTEIN DOMAINS? EXAMPLES AND EXERCISES Homology
More informationRELATIONSHIPS BETWEEN GENES/PROTEINS HOMOLOGUES
Molecular Biology-2018 1 Definitions: RELATIONSHIPS BETWEEN GENES/PROTEINS HOMOLOGUES Heterologues: Genes or proteins that possess different sequences and activities. Homologues: Genes or proteins that
More informationSequence analysis and comparison
The aim with sequence identification: Sequence analysis and comparison Marjolein Thunnissen Lund September 2012 Is there any known protein sequence that is homologous to mine? Are there any other species
More information86 Part 4 SUMMARY INTRODUCTION
86 Part 4 Chapter # AN INTEGRATION OF THE DESCRIPTIONS OF GENE NETWORKS AND THEIR MODELS PRESENTED IN SIGMOID (CELLERATOR) AND GENENET Podkolodny N.L. *1, 2, Podkolodnaya N.N. 1, Miginsky D.S. 1, Poplavsky
More informationModels of transcriptional regulation
Models of transcriptional regulation We have already discussed four simple mechanisms of transcriptional regulation, nuclear exclusion nuclear concentration modification of bound activator redirection
More informationOECD QSAR Toolbox v.3.3. Step-by-step example of how to build a userdefined
OECD QSAR Toolbox v.3.3 Step-by-step example of how to build a userdefined QSAR Background Objectives The exercise Workflow of the exercise Outlook 2 Background This is a step-by-step presentation designed
More informationobjective functions...
objective functions... COFFEE (Notredame et al. 1998) measures column by column similarity between pairwise and multiple sequence alignments assumes that the pairwise alignments are optimal assumes a set
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. Schematic pipeline for single-cell genome assembly, cleaning and annotation. a. The assembly process was optimized to account for multiple cells putatively
More informationComparative genomics: Overview & Tools + MUMmer algorithm
Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first
More informationV14 Graph connectivity Metabolic networks
V14 Graph connectivity Metabolic networks In the first half of this lecture section, we use the theory of network flows to give constructive proofs of Menger s theorem. These proofs lead directly to algorithms
More information2MHR. Protein structure classification is important because it organizes the protein structure universe that is independent of sequence similarity.
Protein structure classification is important because it organizes the protein structure universe that is independent of sequence similarity. A global picture of the protein universe will help us to understand
More informationSequencing alignment Ameer Effat M. Elfarash
Sequencing alignment Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. aelfarash@aun.edu.eg Why perform a multiple sequence alignment? MSAs are at the heart of comparative genomics
More informationMerging and semantics of biochemical models
Merging and semantics of biochemical models Wolfram Liebermeister Institut für Biochemie, Charite Universitätsmedizin Berlin wolfram.liebermeister@charite.de Bottom up Vision 1: Join existing kinetic models
More informationSupplementary Materials for mplr-loc Web-server
Supplementary Materials for mplr-loc Web-server Shibiao Wan and Man-Wai Mak email: shibiao.wan@connect.polyu.hk, enmwmak@polyu.edu.hk June 2014 Back to mplr-loc Server Contents 1 Introduction to mplr-loc
More informationEnsembl focuses on metazoan (animal) genomes. The genomes currently available at the Ensembl site are:
Comparative genomics and proteomics Species available Ensembl focuses on metazoan (animal) genomes. The genomes currently available at the Ensembl site are: Vertebrates: human, chimpanzee, mouse, rat,
More informationComparative Features of Multicellular Eukaryotic Genomes
Comparative Features of Multicellular Eukaryotic Genomes C elegans A thaliana O. Sativa D. melanogaster M. musculus H. sapiens Size (Mb) 97 115 389 120 2500 2900 # Genes 18,425 25,498 37,544 13,601 30,000
More informationProtein Structure Prediction and Display
Protein Structure Prediction and Display Goal Take primary structure (sequence) and, using rules derived from known structures, predict the secondary structure that is most likely to be adopted by each
More informationMetabolic modelling. Metabolic networks, reconstruction and analysis. Esa Pitkänen Computational Methods for Systems Biology 1 December 2009
Metabolic modelling Metabolic networks, reconstruction and analysis Esa Pitkänen Computational Methods for Systems Biology 1 December 2009 Department of Computer Science, University of Helsinki Metabolic
More informationCh. 9 Multiple Sequence Alignment (MSA)
Ch. 9 Multiple Sequence Alignment (MSA) - gather seqs. to make MSA - doing MSA with ClustalW - doing MSA with Tcoffee - comparing seqs. that cannot align Introduction - from pairwise alignment to MSA -
More informationBLAST. Varieties of BLAST
BLAST Basic Local Alignment Search Tool (1990) Altschul, Gish, Miller, Myers, & Lipman Uses short-cuts or heuristics to improve search speed Like speed-reading, does not examine every nucleotide of database
More informationGenome sequence of Plasmopara viticola and insight into the pathogenic mechanism
Genome sequence of Plasmopara viticola and insight into the pathogenic mechanism Ling Yin 1,3,, Yunhe An 1,2,, Junjie Qu 3,, Xinlong Li 1, Yali Zhang 1, Ian Dry 5, Huijun Wu 2*, Jiang Lu 1,4** 1 College
More informationMotifs, Profiles and Domains. Michael Tress Protein Design Group Centro Nacional de Biotecnología, CSIC
Motifs, Profiles and Domains Michael Tress Protein Design Group Centro Nacional de Biotecnología, CSIC Comparing Two Proteins Sequence Alignment Determining the pattern of evolution and identifying conserved
More informationLarge-Scale Genomic Surveys
Bioinformatics Subtopics Fold Recognition Secondary Structure Prediction Docking & Drug Design Protein Geometry Protein Flexibility Homology Modeling Sequence Alignment Structure Classification Gene Prediction
More informationS1 Gene ontology (GO) analysis of the network alignment results
1 Supplementary Material for Effective comparative analysis of protein-protein interaction networks by measuring the steady-state network flow using a Markov model Hyundoo Jeong 1, Xiaoning Qian 1 and
More informationTUTORIAL EXERCISES WITH ANSWERS
TUTORIAL EXERCISES WITH ANSWERS Tutorial 1 Settings 1. What is the exact monoisotopic mass difference for peptides carrying a 13 C (and NO additional 15 N) labelled C-terminal lysine residue? a. 6.020129
More informationBIOINFORMATICS: An Introduction
BIOINFORMATICS: An Introduction What is Bioinformatics? The term was first coined in 1988 by Dr. Hwa Lim The original definition was : a collective term for data compilation, organisation, analysis and
More informationCISC 889 Bioinformatics (Spring 2004) Sequence pairwise alignment (I)
CISC 889 Bioinformatics (Spring 2004) Sequence pairwise alignment (I) Contents Alignment algorithms Needleman-Wunsch (global alignment) Smith-Waterman (local alignment) Heuristic algorithms FASTA BLAST
More informationPatterns and profiles applications of multiple alignments. Tore Samuelsson March 2013
Patterns and profiles applications of multiple alignments Tore Samuelsson March 3 Protein patterns and the PROSITE database Proteins that bind the nucleotides ATP or GTP share a short sequence motif Entry
More informationSequencing alignment Ameer Effat M. Elfarash
Sequencing alignment Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. amir_effat@yahoo.com Why perform a multiple sequence alignment? MSAs are at the heart of comparative genomics
More informationComparative Network Analysis
Comparative Network Analysis BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2016 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by
More informationCOMP 598 Advanced Computational Biology Methods & Research. Introduction. Jérôme Waldispühl School of Computer Science McGill University
COMP 598 Advanced Computational Biology Methods & Research Introduction Jérôme Waldispühl School of Computer Science McGill University General informations (1) Office hours: by appointment Office: TR3018
More informationCATEGORY a TERM COUNT b P VALUE GENE FAMILIES: REPRESENTATIVE GENE SYMBOLS c. Annotation Cluster 1 Enrichment Score: 1.
Table S7 GO term and functional classification enrichment analysis using DAVID for gene families that are expanded in the Drosophila suzukii genome as compared to 14 Drosophila species analyzed in this
More informationGOSAP: Gene Ontology Based Semantic Alignment of Biological Pathways
GOSAP: Gene Ontology Based Semantic Alignment of Biological Pathways Jonas Gamalielsson and Björn Olsson Systems Biology Group, Skövde University, Box 407, Skövde, 54128, Sweden, [jonas.gamalielsson][bjorn.olsson]@his.se,
More informationST-Links. SpatialKit. Version 3.0.x. For ArcMap. ArcMap Extension for Directly Connecting to Spatial Databases. ST-Links Corporation.
ST-Links SpatialKit For ArcMap Version 3.0.x ArcMap Extension for Directly Connecting to Spatial Databases ST-Links Corporation www.st-links.com 2012 Contents Introduction... 3 Installation... 3 Database
More informationGenome-wide metabolic (re-) annotation of Kluyveromyces lactis
Dias et al. BMC Genomics 2012, 13:517 RESEARCH ARTICLE Open Access Genome-wide metabolic (re-) annotation of Kluyveromyces lactis Oscar Dias 1, Andreas K Gombert 2, Eugénio C Ferreira 1 and Isabel Rocha
More informationLigand Scout Tutorials
Ligand Scout Tutorials Step : Creating a pharmacophore from a protein-ligand complex. Type ke6 in the upper right area of the screen and press the button Download *+. The protein will be downloaded and
More informationIn-Silico Approach for Hypothetical Protein Function Prediction
In-Silico Approach for Hypothetical Protein Function Prediction Shabanam Khatoon Department of Computer Science, Faculty of Natural Sciences Jamia Millia Islamia, New Delhi Suraiya Jabin Department of
More informationGENE ONTOLOGY (GO) Wilver Martínez Martínez Giovanny Silva Rincón
GENE ONTOLOGY (GO) Wilver Martínez Martínez Giovanny Silva Rincón What is GO? The Gene Ontology (GO) project is a collaborative effort to address the need for consistent descriptions of gene products in
More informationSupplementary Figure 1 The number of differentially expressed genes for uniparental males (green), uniparental females (yellow), biparental males
Supplementary Figure 1 The number of differentially expressed genes for males (green), females (yellow), males (red), and females (blue) in caring vs. control comparisons in the caring gene set and the
More informationChemical Data Retrieval and Management
Chemical Data Retrieval and Management ChEMBL, ChEBI, and the Chemistry Development Kit Stephan A. Beisken What is EMBL-EBI? Part of the European Molecular Biology Laboratory International, non-profit
More informationThe EcoCyc Database. January 25, de Nitrógeno, UNAM,Cuernavaca, A.P. 565-A, Morelos, 62100, Mexico;
The EcoCyc Database Peter D. Karp, Monica Riley, Milton Saier,IanT.Paulsen +, Julio Collado-Vides + Suzanne M. Paley, Alida Pellegrini-Toole,César Bonavides ++, and Socorro Gama-Castro ++ January 25, 2002
More informationJournal of Proteomics & Bioinformatics - Open Access
Abstract Methodology for Phylogenetic Tree Construction Kudipudi Srinivas 2, Allam Appa Rao 1, GR Sridhar 3, Srinubabu Gedela 1* 1 International Center for Bioinformatics & Center for Biotechnology, Andhra
More informationV14 extreme pathways
V14 extreme pathways A torch is directed at an open door and shines into a dark room... What area is lighted? Instead of marking all lighted points individually, it would be sufficient to characterize
More informationMathangi Thiagarajan Rice Genome Annotation Workshop May 23rd, 2007
-2 Transcript Alignment Assembly and Automated Gene Structure Improvements Using PASA-2 Mathangi Thiagarajan mathangi@jcvi.org Rice Genome Annotation Workshop May 23rd, 2007 About PASA PASA is an open
More informationV19 Metabolic Networks - Overview
V19 Metabolic Networks - Overview There exist different levels of computational methods for describing metabolic networks: - stoichiometry/kinetics of classical biochemical pathways (glycolysis, TCA cycle,...
More informationInformation Extraction from Biomedical Text. BMI/CS 776 Mark Craven
Information Extraction from Biomedical Text BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2012 Goals for Lecture the key concepts to understand are the following! named-entity
More informationComputational Molecular Biology (
Computational Molecular Biology (http://cmgm cmgm.stanford.edu/biochem218/) Biochemistry 218/Medical Information Sciences 231 Douglas L. Brutlag, Lee Kozar Jimmy Huang, Josh Silverman Lecture Syllabus
More informationThe Developmental Transcriptome of the Mosquito Aedes aegypti, an invasive species and major arbovirus vector.
The Developmental Transcriptome of the Mosquito Aedes aegypti, an invasive species and major arbovirus vector. Omar S. Akbari*, Igor Antoshechkin*, Henry Amrhein, Brian Williams, Race Diloreto, Jeremy
More informationProtein Interaction Mapping: Use of Osprey to map Survival of Motor Neuron Protein interactions
Protein Interaction Mapping: Use of Osprey to map Survival of Motor Neuron Protein interactions Presented by: Meg Barnhart Computational Biosciences Arizona State University The Spinal Muscular Atrophy
More information