The Potassium Transporter Trk and External Potassium Modulate Salmonella enterica Protein Secretion and Virulence

Transcription

1 INFECTION AND IMMUNITY, Feb. 2009, p Vol. 77, No /09/$ doi: /iai Copyright 2009, American Society for Microbiology. All Rights Reserved. The Potassium Transporter Trk and External Potassium Modulate Salmonella enterica Protein Secretion and Virulence Jing Su, 1,2 Hao Gong, 1 Jeff Lai, 1 Andrew Main, 1 and Sangwei Lu 1 * Program in Infectious Diseases and Immunity, School of Public Health, University of California, Berkeley, California 94720, 1 and Department of Bioscience and Technology, School of Life Science, Nanjing University, Nanjing, Jiangsu, People s Republic of China 2 Received 18 August 2008/Returned for modification 17 September 2008/Accepted 31 October 2008 Potassium (K ) is the most abundant intracellular cation and is essential for many physiological functions of all living organisms; however, its role in the pathogenesis of human pathogens is not well understood. In this study, we characterized the functions of the bacterial Trk K transport system and external K in the pathogenesis of Salmonella enterica, a major food-borne bacterial pathogen. Here we report that Trk is important for Salmonella to invade and grow inside epithelial cells. It is also necessary for the full virulence of Salmonella in an animal infection model. Analysis of proteins of Salmonella indicated that Trk is involved in the expression and secretion of effector proteins of the type III secretion system (TTSS) encoded by Salmonella pathogenicity island 1 (SPI1) that were previously shown to be necessary for Salmonella invasion. In addition to the role of the Trk transporter in the pathogenesis of Salmonella, we discovered that external K modulates the pathogenic properties of Salmonella by increasing the expression and secretion of effector proteins of the SPI1-encoded TTSS and by enhancing epithelial cell invasion. Our studies demonstrated that K is actively involved in the pathogenesis of Salmonella and indicated that Salmonella may take advantage of the high K content inside host cells and in the intestinal fluid during diarrhea to become more virulent. Potassium (K ) is the most abundant intracellular cation in all living organisms, including bacteria (22). Previous studies on K have focused mostly on its role in the physiology of eukaryotic and prokaryotic organisms, while its role, if any, in the pathogenesis of human pathogens has not been well characterized. Human pathogens often need to survive and grow in conditions with a wide range of K concentrations, from environmental niches such as rivers, soil, and sewage with low K concentrations to inside host cells with high K concentrations (100 to 160 mm) (22). Therefore, it is important to understand how pathogens adapt to various K concentrations and how K affects pathogens. Bacteria maintain a relatively constant intracellular K concentration (300 to 500 mm) for many essential cellular functions, including maintenance of cell turgor and homeostasis, adaptation of cells to osmotic conditions, and activation of cytoplasmic enzymes (8, 15). Since bacteria are exposed to a wide range of external K concentrations, they use a number of transporters and efflux pumps to maintain their intracellular K concentrations. The best-characterized K transport systems include the Trk, Kdp, and Kup K transport systems in gram-negative bacteria. The Trk system is a low-affinity, rapidtransport system that is the main K transporter at neutral or alkaline ph (7, 15, 43). It is a multiunit protein complex formed by gene products that are constitutively expressed. The Kdp system is a high-affinity K transport system that is induced in low-k environments (K concentration, 5 mm or less) (15, 17). The Kup system has an affinity for K similar to that of the Trk system and is believed to be the major K * Corresponding author. Mailing address: 16 Barker Hall, University of California, Berkeley, CA Phone: (510) Fax: (510) sangwei@berkeley.edu. Published ahead of print on 10 November transport system under acidic conditions (44, 48). Previous studies showed that Salmonella trka (sapg), which encodes an essential NAD binding subunit of the Trk system, was necessary for resistance to antimicrobial peptides (37). TrkA of Vibrio vulnificus has been reported to be required for serum, protamine, and polymyxin B resistance (9). These results suggest that intracellular K is important for the virulence characteristics of bacterial pathogens. Salmonella enterica is a gram-negative bacterium and a major human pathogen that causes significant mortality and morbidity worldwide. In this study, we analyzed the role of the Trk K transport system in the pathogenesis of Salmonella and investigated the influence of external K on the virulence characteristics of Salmonella. Our results demonstrate that both intracellular K and external K modulate the virulence characteristics of Salmonella. MATERIALS AND METHODS Reagents. Growth media for bacteria and HeLa cells were purchased from BD Diagnostics (Sparks, MD) and Invitrogen (Carlsbad, CA), respectively. Chemicals and antibiotics were obtained from Sigma-Aldrich (St. Louis, MO) unless otherwise indicated. Restriction and modifying enzymes for manipulation of DNA were obtained from New England Biolabs (Ipswich, MA). Custom oligonucleotides were purchased from Sigma Genosys (The Woodlands, TX). Bacterial strains and culture conditions. S. enterica serovar Enteritidis isolate SE2472 (a clinical isolate) was used as the wild-type parental strain in all experiments (Table 1) (30 32). Escherichia coli DH5 was used for construction of recombinant plasmid DNA (Table 1). All bacteria were routinely cultured in Luria-Bertani (LB) broth at 37 C with shaking at 225 rpm (3). A minimal K medium consisting of 6.78 g of Na 2 HPO 4 / liter, g of NaH 2 PO 4 H 2 O/liter, 10 g of NaCl/liter, 1gofNH 4 Cl/liter, 4 g of glucose/liter, 2 mm MgSO 4, and 0.2 mm CaCl 2 (ph 7) was used to examine the role of K in bacterial growth. Although no K was added to the medium, the medium contained approximately 0.2 mm K from K contaminants in the salts used, as measured with a K -selective electrode (Denver Instruments, Denver, CO). Antibiotics were added when necessary. Growth curves and stress resistance assays. The growth and survival of bacteria in various media and with various chemicals were determined as previously 667

2 668 SU ET AL. INFECT. IMMUN. TABLE 1. Bacterial strains and plasmids Strain or plasmid Characteristics Source or reference E. coli DH5 F 80dlacZ M15 (laczya-argf)u169 deor reca1 enda1 hsdr17(r k m k ) phoa supe44 thi-1 gyra96 rela1 Invitrogen S. enterica serovar Enteritidis strains SE2472 Clinical isolate 32 trka SE2472 trka::kan This study trka-comp SE2472 trka::kan transformed with prb3-trka This study SipA(HF) SE2472 sipa::his-flag, SipA This study SipC(HF) SE2472 sipc::his-flag, SipC This study SopB(HF) SE2472 sopb::his-flag, SopB This study SipA(HF) trka SipA(HF) trka::kan This study SipC(HF) trka SipC(HF) trka::kan This study SopB(HF) trka SopB(HF) trka::kan This study SipA(HF) trka-comp SipA(HF) trka transformed with prb3-trka This study SipC(HF) trka-comp SipC(HF) trka transformed with prb3-trka This study SopB(HF) trka-comp SopB(HF) trka transformed with prb3-trka This study Plasmids puc-h1pf1 Ap r, derivative of puc19 containing Kan r, FLAG, and His 6 This study pkd4 Ap r Kan r orir 12 pkd46 Ap r, contains the Red recombinase of phage 12 pcp20 Ap r cat cl857 Pr flp psc101 orits 12 prb3-273c Ap r, low- to medium-copy-number plasmid for Salmonella 12 prb3-trka Derivative of prb3-273c containing trka This study described (32). The following media and conditions were used to determine the growth and stress resistance of bacteria: Dulbecco s modified Eagle s medium (DMEM) supplemented with 10% fetal bovine serum, mouse serum, LB broth, LB broth containing 5% sodium dodecyl sulfate (SDS) or 1 M NaCl, and LB broth at ph 4.0. Survival of bacteria at 50 C was determined in LB broth incubated at 50 C without shaking. Potassium chloride was added as a K supplement when appropriate. In each assay, bacterial concentrations were determined by plating appropriately diluted aliquots onto LB agar plates. Invasion of HeLa cells by Salmonella and intracellular growth of Salmonella in HeLa cells. A HeLa cell invasion assay was performed as described previously (32). Briefly, all Salmonella strains were cultured in LB broth overnight at 37 C without shaking. Antibiotics were added when appropriate. An overnight culture of bacteria was added to HeLa cells at multiplicities of infection of 5:10 to 10:1, and intracellular bacteria were quantified after 1 or 2 h of incubation for invasion, which was followed by incubation in the presence of 50 g/ml of gentamicin to kill extracellular bacteria. The invasiveness of Salmonella was measured by determining the ratio of intracellular bacteria, which was calculated as follows: (number of intracellular bacteria/number of input bacteria) 100. The intracellular growth of Salmonella in HeLa cells was determined by infecting HeLa cells with Salmonella for 1 h. The HeLa cells were then washed with phosphate-buffered saline to remove extracellular bacteria and incubated in fresh medium containing 50 g/ml of gentamicin for 1htokill extracellular bacteria. A set of cells was washed and lysed to quantify the intracellular bacteria and used as the zero-time sample. Additional sets of cells were harvested after an additional 4 or 8 h of incubation to quantify intracellular Salmonella (4- and 8-h samples). The growth of Salmonella inside HeLa cells was measured by determining the increase in the number of intracellular Salmonella cells, which was calculated by dividing the quantity of intracellular bacteria in a 4- or 8-h sample by the quantity of intracellular bacteria in the zero-time sample. Epitope tagging of Salmonella proteins and analysis of tagged proteins. Protein tagging was carried out as described by Uzzau et al. (45), except that both six-his and FLAG tags were used. First, plasmid puc-h1pf1 was constructed as a template. This plasmid was designed to contain a kanamycin resistance cassette (Kan r ) and the DNA sequence encoding the six-his and FLAG small epitope tags (45). Kan r in plasmid pkd4 (Table 1) was amplified by PCR using primers H1PF1(fwd) and H1PF1(rev) (Table 2). Primer H1PF1(fwd) contained a BamHI linker, the sequence encoding the six-his and FLAG epitopes, and the sequence corresponding to nucleotides 31 to 49 of plasmid pkd4. Primer H1PF1(rev) contained an EcoRI linker and the sequence corresponding to nucleotides 1485 to 1507 of plasmid pkd4. The PCR product was then cloned into plasmid puc19 (New England Biolabs, Ipswich, MA) between the BamHI and EcoRI sites. The sequence of the resulting plasmid, puc-h1pf1, was verified, and this plasmid was used as template in PCRs with SipA-, SipC-, or SopB-specific primers listed in Table 2. Each PCR produced a DNA module consisting of the 3 end of the target gene, FLAG and six-his tag nucleotides, the stop codon, Kan r, and the target gene sequence immediately following the stop codon. The DNA module was introduced into the Salmonella genome, the sequence was verified, and the module was transduced into fresh SE2472 (12). Kan r was subsequently removed using plasmid pcp20 (12), and the sequence of the resulting strain was verified. When necessary, mutations were transduced into strains with epitope tags by general transduction with phage P22, and phage-free colonies were used for analysis of expression (35). The levels of the tagged proteins in bacterial lysates and culture supernatant were determined by Western blot analysis. Bacterial lysates were prepared by centrifuging bacterial cultures, resuspending the bacterial pellets in sodium dodecyl sulfate (SDS) sample buffer (50 mm Tris-HCl [ph 6.8], 100 mm dithiothreitol, 2% SDS, 10% glycerol, 0.1% bromophenol blue), and boiling the preparations for 10 min (42). Secreted proteins were prepared as described by Komoriya et al. (23). For Western blot analysis, a monoclonal anti-flag antibody (Sigma-Aldrich, St. Louis, MO) was used at a 1:1,000 dilution as the primary antibody, and horseradish peroxidase-conjugated sheep anti-mouse immunoglobulin G (GE Healthcare, Piscataway, NJ) was used at a 1:2,000 dilution as the secondary antibody. The signal was visualized by the enhanced chemiluminescence method (GE Healthcare, Piscataway, NJ). Coomassie blue-stained gels were used for comparison of protein bands. Mutagenesis of trka and complementation of the mutant. A trka deletion ( trka) mutant of SE2472 was constructed using the one-step mutagenesis method of Datsenko and Wanner, as described previously (12, 30). Primers TrkA5KO and TrkA3KO were used to replace the trka sequence between nucleotides 91 and 1270 with Kan r (Table 2). The deletion mutation was subsequently transduced into fresh SE2472 by general transduction using phage P22 (35), and phage-free colonies were used for further analysis. A nonpolar trka mutant was also generated as described by Datsenko and Wanner (12). To complement the trka mutant of SE2472, we cloned the wild-type allele of trka into plasmid prb3-273c (6). Primers TrkA5H3 and TrkA3H3 were used to amplify trka from SE2472 (Table 2), and the PCR product was digested with HindIII and cloned into prb3-273c at the HindIII site. The sequence of the resulting plasmid, prb3-trka, was confirmed, and the plasmid was transformed into the trka mutant of SE2472 to complement the deletion mutation (30). Vector prb3-273c was also transformed into the trka mutant of SE2472 as a control for any possible effect of the plasmid transformation alone (30). Infection of mice with Salmonella. Salmonella cultured overnight in LB broth at 37 C with shaking at 225 rpm was used in all animal infection experiments. Mice were infected intragastrically or intraperitoneally, and the 50% lethal dose

3 VOL. 77, 2009 ROLE OF POTASSIUM IN SALMONELLA PATHOGENESIS 669 Primer TABLE 2. Oligonucleotide primers Sequence H1PF1(fwd)...5 -CGCGGATCCGATTACAAGGATGACGACGATAAGGAGAATTTGTATTTTCAGGGACAC CACCACCACCACCACTGATGTGTAGGCTGGAGCTGCTT-3 H1PF1(rev)...5 -CCGGAATTCCATATGAATATCCTCCTTAGTTC-3 SipA(fwd)...5 -GCCCGGCTTACGAGTCATACCTGAATAAACCTGGCGTGGATCGGGTTATTACTACCGT TGATGGCTTGCACATGCAGCGTGATTACAAGGATGACGACGA-3 SipA(rev)...5 -ACATCAACGGCAATACAGGAGGTGATCACTTTTTTGACTCTTGCTTCAATATCCATATT CATCGCATCTTTCCCGGTTAACATATGAATATCCTCCTTAGTT-3 SipC(fwd)...5 -AGGAAATGCTGAAAACAATGGAGAGCATTAACCAGTCGAAAGCATCCGCACTTGCTG CTATCGCAGGCAATATTCGCGCTGATTACAAGGATGACGACGA-3 SipC(rev)...5 -TATTAAGCATAATATCCCCAGTTCGCCATCAGGAGCGCGATTAAATCACACCCATGAT GGCGTATAGATGACCTTTCAGACATATGAATATCCTCCTTAGTT-3 SopB(fwd)...5 -TCAATCTTTCCTATCAAAAACGAGTTGGGGATGAAAATATTTGGCAGTCAGTAAAAG GCATTTCTTCATTAATCACATCTGATTACAAGGATGACGACGA-3 SopB(rev)...5 -GTGGCTCATCTTCTGGCGCATCCAGGCCTAACGCGTCATATAAACGATTTAATAGACT TTCCATATAGTTACCTCAAGACCATATGAATATCCTCCTTAGTT-3 TrkA5KO...5 -TCATACTGGG CGCAGGGCAA GTTGGCGGAA CACTGGCGGA AAACCTGGTC GGCG AAAACAACGACATCAC GGTGGTTGAT CATATGAATATCCTCCTTAG-3 TrkA3KO...5 -CAGACGTTCGACGTCGGTAATAAACTTTTTATCGGTCAAAAACATAATGACGTGATCG CCTTGTTCAATGCGCAAATTGT GTGTAGGCTG GAGCTGCTTC-3 TrkA5H AGACCAGGAAGCTTGATGAAAATTATCATACTGGG-3 TrkA3H ATAGCAACAAGCTTTTAGAGGAAGAAAGGACTTG-3 (LD 50) was determined by infecting groups of five mice with 10-fold dilutions of bacteria in phosphate-buffered saline (32, 41). RESULTS Construction of a Salmonella trka mutant and analysis of its growth properties. To determine the roles of K transport systems in the pathogenesis of Salmonella, we constructed a deletion mutant with a mutation in the low-affinity Trk K transport system of S. enterica serovar Enteritidis SE2472 ( trka) (32). In the trka mutant of SE2472, the trka open reading frame, which encodes a subunit essential for the Trk function, was replaced by Kan r (12, 30). The trka mutant formed smaller colonies on LB agar but otherwise had the same colony morphology as wild-type strain SE2472 (data not shown). To determine if TrkA is necessary for the growth of bacteria, we constructed growth curves for the trka mutant and wildtype strain SE2472 grown in LB broth, minimal K medium, and minimal K medium supplemented with various concentrations of potassium chloride (KCl) as the source of K. Using a K -selective electrode (Denver Instruments, Denver, CO), the concentration of K in LB broth was determined to be approximately 8 mm (data not shown), a concentration at which Trk is expected to be the main K transporter. Minimal K medium was prepared without any K salt; however, it contained approximately 0.2 mm K due to K contamination in the salts used for the medium (data not shown). In LB broth, minimal K medium, or minimal K medium supplemented with less than 10 mm K, the growth of the trka mutant was similar to the growth of wild-type strain SE2472 (data not shown). When more than 10 mm supplemental K was used, the trka mutant displayed a small but consistent growth delay compared to the wild-type strain between 4 to 8 h of growth (Fig. 1). The trka mutant appeared to have the same lag phase as wild-type strain SE2472, but it had a lower growth rate in the log phase of growth (Fig. 1). The growth delay was observed at all K concentrations that we tested (10 to 100 mm), and the delay was rescued by transforming the trka mutant with plasmid prb3-trka, which contained a wild-type allele of trka in plasmid vector prb3-273c (Fig. 1) (6). Transformation with the prb3-273c vector alone had no effect (data not shown). These results indicate that TrkA is involved in optimal growth of Salmonella at relatively high concentrations of K. The resistance of the trka mutant to general stress conditions was tested to determine the overall fitness of this mutant. The trka mutant was exposed to salt (1 M NaCl), detergent (5% SDS), heat (incubation at 50 C), and acidic medium (ph 4). No difference in bacterial growth or survival was observed between the trka mutant and wild-type strain SE2472 (data now shown). Since the TrkA protein of V. vulnificus was reported to be necessary for serum resistance (9), we tested the FIG. 1. Growth of the trka mutant of Salmonella with a high concentration of potassium. Wild-type strain SE2472, the trka mutant, and the complemented mutant ( trka-comp) were cultured in minimal K medium supplemented with 50 mm KCl. Bacterial concentrations were determined by plating. At least three experiments were performed, and the results of a representative experiment performed in triplicate are shown. The error bars indicate standard deviations.

4 670 SU ET AL. INFECT. IMMUN. FIG. 2. Epithelial cell invasion and intracellular growth of the wild-type strain and the trka mutant of Salmonella. (A) Invasion of HeLa cells. The ratio of the number of intracellular bacteria to the number of input bacteria was determined for wild-type strain SE2472 (WT), the trka mutant, and the complemented mutant ( trka-comp). The ratio for wild-type strain SE2472 at 1 h postinfection was arbitrarily defined as 100%, and the ratios for other samples were expressed as relative values. (B) Growth inside HeLa cells. Intracellular wild-type strain SE2472, trka mutant, and complemented mutant ( trka-comp) bacteria were quantified, and the results were compared to the initial number of bacteria at zero time. The increase was calculated by dividing the number of intracellular bacteria at 4 or 8 h by the number of intracellular bacteria at zero time. The data are the averages of three experiments performed in triplicate. The error bars indicate standard deviations. survival and growth of the trka mutant of SE2472 in mouse serum, and we detected no defect in the trka mutant (data not shown). TrkA is necessary for the invasion of epithelial cells by Salmonella. Since epithelial cell invasion is crucial in natural infection by Salmonella, we examined whether TrkA affects the ability of Salmonella to invade epithelial cells. The invasion of HeLa cells by the trka mutant and wild-type strain SE2472 was assayed, and the ratio of the number of intracellular bacteria to the number of input bacteria was determined after 1 or 2 h of incubation. The ratio obtained for wild-type strain SE2472 intracellular bacteria at 1 h postinfection was arbitrarily defined as 100%, and ratios of intracellular bacteria for other samples were expressed as relative values (Fig. 2A). At both 1 and 2 h postinfection, the ratios for the intracellular trka mutant were approximately 35 to 40% of those for wild-type strain SE2472 (Fig. 2A). The invasion defect of the trka mutant was rescued by transformation with plasmid prb3-trka (Fig. 2A), while transformation with the vector alone had no effect (data not shown). The invasion defect of the trka mutant was not due to a growth defect in the medium used for the assay (DMEM with 10% fetal bovine serum), as the trka mutant grew as well as wild-type strain SE2472 in this medium (data not shown). DMEM contains approximately 5 mm K as measured with a K -selective electrode (data not shown); therefore, the normal growth of the trka mutant in DMEM is consistent with the previous observation that the trka mutant had no growth defect when the K concentration was less than 10 mm. The trka mutant of Salmonella is defective for growth inside HeLa cells. In addition to determining the ability of the trka mutant of SE2472 to invade, we also examined the growth of the trka mutant inside HeLa cells and compared it to the growth of wild-type strain SE2472. Since the trka mutant was less invasive than wild-type strain SE2472 (Fig. 2A), the trka mutant and wild-type strain SE2472 were used to infect HeLa cells at multiplicities of infection of 10:1 and 2:1, respectively, in order to obtain similar numbers of intracellular bacteria immediately after invasion. The infected HeLa cells were incubated for up to 8 h in the presence of gentamicin to stop further bacterial invasion, and the intracellular bacteria were quantified to determine the growth of the trka mutant and wild-type strain SE2472 inside HeLa cells. Compared to the initial levels of intracellular bacteria at zero time, the levels of wild-type strain SE2472 were and fold higher at 4 and 8 h postinfection, respectively, while the levels of the trka mutant were only and fold higher, respectively (Fig. 2B). Complementation with plasmid prb3-trka partially rescued the growth defect of the trka mutant inside HeLa cells (Fig. 2B). The assay was terminated at 8 h, when the number of bacteria started to decrease, possibly because HeLa cells were being damaged by intracellular Salmonella and Salmonella was exposed to the gentamicin in the medium (data not shown). The defective intracellular growth of the trka mutant was not due to increased susceptibility to the gentamicin used in the assay, as the trka mutant had the same susceptibility as the wildtype Salmonella strain to all of the antibiotics that we tested, including ampicillin, chloramphenicol, gentamicin, and tetracycline (data not shown). The observed intracellular growth defect is consistent with the delayed growth the trka mutant observed at K concentrations higher than 10 mm, since host cells have high concentrations of K. The trka mutant of Salmonella is less virulent in infection of mice. To determine if TrkA is important for the virulence of Salmonella, we infected mice with the trka mutant and wildtype strain SE2472 and determined the LD 50 for intragastric and intraperitoneal infections. For both infection routes, the trka mutant had a higher LD 50 and was less virulent than wild-type strain SE2472 (P 0.05, Student s t test) (Table 3). The virulence defect was rescued in the complemented mutant by plasmid prb3-trka, and the difference in LD 50 between the complemented trka mutant and wild-type strain SE2472 was statistically insignificant (P 0.4, Student s t test) (Table 3), suggesting that deletion of trka was responsible for the decreased virulence of the trka Salmonella mutant.

5 VOL. 77, 2009 ROLE OF POTASSIUM IN SALMONELLA PATHOGENESIS 671 TABLE 3. LD 50 of Salmonella wild-type strain SE2472 and the trka mutant in intragastric and intraperitoneal infections of mice Strain LD 50 (CFU) Intragastric infection Intraperitoneal infection SE trka trka-comp TrkA is important for expression and secretion of selected effector proteins of the SPI1-encoded TTSS of Salmonella. We next investigated how Trk contributes to the epithelial cell invasion by and virulence of Salmonella. Since invasion of epithelial cells by Salmonella is dependent on the effector proteins of the type III secretion system (TTSS) encoded by Salmonella pathogenicity island 1 (SPI1), we reasoned that the expression and secretion of the effector proteins of the SPI1- encoded TTSS could be altered in the trka mutant. We selected SipA, SipC, and SopB for this analysis because these proteins have previously been shown to have important functions in host cell invasion and in the modulation of the host cytoskeleton to facilitate Salmonella infection (20, 21, 40). To monitor the levels of these proteins, we introduced into the chromosome a tandem tag consisting of six histidines and a FLAG tag fused in frame to the C terminus of each protein (45) to generate tagged strains SipA(HF), SipC(HF), and Sop- B(HF) (Table 1). No difference between the tagged strains and parental strain SE2472 was observed for growth in vitro and for virulence in mouse infections, suggesting that tagging did not have deleterious effects (data not shown). The trka mutation was transduced into each tagged strain, and the mutant strains were complemented by transformation with plasmid prb3- trka. Equal quantities of proteins from both whole-cell lysate and culture supernatant were used for each strain. Since less protein was recovered from the culture supernatant of the trka mutant, proteins obtained from larger volumes of cultures were used to ensure that the total quantities of proteins from each strain were equivalent (data not shown). The levels of each tagged protein in the whole bacterial lysates and culture supernatants of the corresponding set of tagged strains with the wild-type, mutant, or complemented trka allele were analyzed by Western hybridization using an anti-flag antibody (Fig. 3). We analyzed SipA, SipC, and SopB, and SipA was detected in both the whole bacterial lysate and the culture supernatant, while SipC and SopB were detected only in the culture supernatant (Fig. 3). Compared to the results for the parental strains with the wild-type trka allele, the level of SipA was lower in the whole bacterial lysate of the trka mutant (Fig. 3A) and the levels of SipA, SipC, and SopB were lower in the culture supernatant of the trka mutant (Fig. 3B). In each complemented trka mutant strain, the level of SipA, SipC, or SopB was restored to the level in the parental strain (Fig. 3). Potassium and sodium enhance the invasion of epithelial cells by Salmonella. We showed in the experiments described above that the Trk K transport system is necessary for Salmonella to invade and grow in epithelial cells and for expression and secretion of effector proteins of the SPI1-encoded TTSS. Next we examined the effect of external K on Salmonella and whether external K modulated the invasion of Salmonella and the expression of effector proteins of the TTSS. The invasion of HeLa cells by bacteria cultured with various concentrations of KCl was analyzed, and the results were compared with the results for organisms cultured in LB broth alone. We chose moderate K concentrations (50 and 100 mm) that are in the physiological range that Salmonella may encounter in its hosts. When cultured in the presence of either concentration of supplemental KCl, both the wild type and the trka mutant showed enhanced invasion of HeLa cells (Fig. 4A). The level of invasion of HeLa cells by the trka mutant cultured with supplemental KCl increased to the level of invasion by wild-type strain SE2472 cultured without the supplement, although the trka mutant was consistently less invasive than wild-type strain SE2472 cultured in the same medium (Fig. 4A). To determine if the enhanced invasion of HeLa cells by Salmonella could also be modulated by other cations that have physiological relevance, we determined the effect of supplemental NaCl on the invasiveness of Salmonella. Na is the most abundant extracellular cation, and the plasma level of this cation in humans is 135 to 145 mm. As shown in Fig. 4B, the presence of supplemental NaCl increased the invasiveness of both wild-type SE2472 and the trka mutant of SE2472, although the increase in invasion after addition of supplemental NaCl was not as pronounced as the increase in invasion after addition of KCl (Fig. 4A and 4B). This suggests that Salmonella responds to physiological concentrations of both Na and K and that K is likely to have a greater effect on the invasion of HeLa cells by Salmonella. FIG. 3. Expression and secretion of selected effector proteins of the SPI1-encoded TTSS by the wild-type strain and trka mutant of Salmonella. Epitope-tagged strains SipA(HF), SipC(HF), and SopB(HF) with the wild-type (WT) or trka mutant allele and the trka mutant transformed with plasmid prb3-trka ( trka-comp) were cultured in LB broth. The bacterial lysates or cultural supernatants were analyzed to determine the levels of SipA, SipC, and SopB in the tagged strains. (A) Western blot analysis of the SipA levels in whole-cell lysates. (B) Western blot analysis of the levels of SipA, SipC, and SopB in culture supernatants. The trka allele in each sample is indicated above the lane. The effector proteins analyzed in the blots are indicated on the right.

6 672 SU ET AL. INFECT. IMMUN. FIG. 4. Effects of external potassium and sodium chloride on the invasion of HeLa cells by the wild-type strain and trka mutant of Salmonella. Salmonella wild-type strain SE2472 (WT) or the trka mutant was cultured overnight in LB broth or LB broth supplemented with 50 or 100 mm KCl (A) or 50 or 100 mm NaCl (B) and used to infect HeLa cells. Intracellular Salmonella was quantified 1 h after infection, and the ratios of the number of intracellular bacteria to the number of input bacteria (expressed as percentages) were determined. The ratio for wild-type strain SE2472 grown without a supplement was arbitrarily defined as 100%, and the ratios for the other samples were expressed as relative values. The data are the averages of three experiments performed in triplicate. The error bars indicate standard deviations. Potassium and sodium chloride have overlapping yet distinct effects on effector proteins of the SPI1-encoded TTSS in the trka mutant of Salmonella. Since Na and K enhanced the invasiveness of Salmonella in the HeLa cell invasion assay, we examined the effects of Na and K on the expression and secretion of effector proteins of the SPI1-encoded TTSS. The wild-type and trka mutant SE2472 strains were cultured in LB broth supplemented with 50 or 100 mm KCl or NaCl, and the levels of SipA, SipC, and SopB in the bacterial lysates and secreted proteins were analyzed as described above (Fig. 5). Both KCl and NaCl induced expression and secretion of SipA, SipC, and SopB in wild-type strain SE2472 (Fig. 5A). In this strain addition of potassium chloride appeared to result in stronger induction of expression of SipA and secretion of SopB than addition of NaCl, and KCl and NaCl had similar effects on secretion of SipA and SipC. In the trka mutant, however, addition of both 50 and 100 mm KCl resulted in stronger induction of all proteins. The expression of SipA and secretion of SopB were induced only by KCl and not by NaCl, while the secretion of SipA and SipC was induced less by NaCl than by KCl, especially at a concentration of 100 mm. This demonstrated that both KCl and NaCl modulate the expression and secretion of effector proteins of the SPI1-encoded TTSS; however, the effects of KCl and NaCl were not identical, suggesting that the alteration of the expression and secretion of TTSS FIG. 5. Comparison of the effects of external potassium and sodium chloride on the expression and secretion of selected effector proteins of the SPI1-encoded TTSS by the wild-type strain (WT) and the trka mutant of Salmonella. Epitope-tagged strains SipA(HF), SipC(HF), and SopB(HF) with the wild-type trka or trka mutant allele were cultured in LB broth supplemented with 50 or 100 mm KCl or 50 or 100 mm NaCl (indicated above the lanes). The bacterial lysates or culture supernatants were analyzed to determine the levels of SipA, SipC, and SopB in the strains. (A) Western blot analysis of the SipA levels in whole-cell lysates. (B) Western blot analysis of the levels of SipA, SipC, and SopB in culture supernatants. The effector proteins analyzed in the blots are indicated on the right.

7 VOL. 77, 2009 ROLE OF POTASSIUM IN SALMONELLA PATHOGENESIS 673 effector proteins was not simply due to a change in the osmotic pressure, especially in the trka mutant of Salmonella. DISCUSSION The importance of K for bacterial physiology has been studied by several investigators (for a review, see reference 15); however, the function of intracellular and external K in the pathogenicity of bacteria has not been well characterized. In this report, we provide direct evidence that maintaining a proper intracellular K level is important for the pathogenicity of Salmonella and that external K regulates the virulence characteristics of Salmonella. Salmonella lacking the low-affinity K transporter Trk invaded epithelial cells less, was less virulent in mouse infections, and expressed and secreted smaller amounts of effector proteins of the SPI1-encoded TTSS (Fig. 2 and 3, and Table 3), while addition of K improved epithelial cell invasion and the expression and secretion of the same set of the effector proteins (Fig. 4 and 5). To our knowledge, this is the first study demonstrating that both intracellular K and external K influence the virulence characteristics of a pathogenic bacterium. The only other example of the effect of K on human pathogens is a recent report by Kumar et al., who demonstrated that exposure of Plasmodium sporozoites to the intracellular concentration of K enhances infectivity and reduces cell passage activity (24). The effect of K on human pathogens is not unexpected, since K is the most abundant cation inside human cells, where the concentrations are more than 100 mm, while the extracellular concentrations are usually less than 10 mm (22). The K concentration inside Salmonella-containing vacuoles has not been reported; however, the K concentration inside Mycobacterium-containing vacuoles inside macrophages is approximately 20 to 50 mm and is in the range of K concentrations that we used in this analysis (47). In the human small intestine where Salmonella infection occurs, the K concentration has been reported to be approximately 6 mm (16). However, during diarrhea, the K concentration is likely to be much higher due to electrolytes released from damaged intestinal mucosa. Although results of in vitro assays may not be directly applicable to natural infections, our results indicate that it is possible that Salmonella benefits from the increased K concentration in the intestinal fluid when diarrhea occurs and becomes more invasive. In addition to the results for K, we have also shown that Na, the most abundant extracellular cation, increased the invasion of epithelial cells by Salmonella and the expression and secretion of effector proteins of the SPI1-encoded TTSS (Fig. 4B and 5). The concentrations of Na that we used are within the range of the normal plasma concentration of Na (135 mm), suggesting that Na may modulate the infectivity of Salmonella during systemic infection. It has been reported previously that invasion by Salmonella is modulated by oxygen, acids (acetic and butyric acids), bile, and formate in the distal ileum (19, 27, 39, 46). Taken together, these results suggest that Salmonella responds to multiple signals in vivo in order to regulate its invasion and pathogenesis in different organs, and the ability to respond to a wide spectrum of external signals is likely a factor that contributes to Salmonella s success as a human pathogen. In gram-negative bacteria, the intracellular concentration of K is regulated by multiple K transport systems, including the Trk and Kup low-affinity systems and the Kdp high-affinity system (for a review, see reference 15). Since the trka mutant has normal growth properties except at high concentrations of K, we believe that the trka mutant has relatively normal physiology and that other K transport systems can compensate for the lack of Trk. We do not know yet which K transport system(s) compensates for the function of Trk in the trka mutant of Salmonella or the extent of the compensation. At high concentrations of K (10 mm or higher), Kdp is repressed, which probably explains why the trka mutant grew more slowly in the log phase (2, 17, 25, 34) (Fig. 1). Both Kup and Kdp likely contribute to maintaining the K homeostasis in the absence of Trk at lower K concentrations. In E. coli and Salmonella, the kdp operon is normally repressed at a K concentration of 5 mm or higher; however, this operon can be expressed at K concentrations around 10 mm in the absence of Trk (2, 17, 25, 34). Our preliminary analysis of the Kup transport system indicated that a kup trka double mutant was more defective in growth, protein secretion, and pathogenesis than either single mutant (unpublished results). A thorough analysis of mutants with deletions in multiple K transport systems should provide insight into the specific functions of each K transport system. The SPI1-encoded TTSS is regulated by multiple signals in a highly complex regulatory network (for a review, see reference 14). Factors that have been reported to directly regulate the SPI-encoded TTSS are HilA (1, 4, 13, 28, 29) and InvF (10, 11, 13). Factors that indirectly regulate SPI1 through HilA and InvF include PhoQ/PhoP, HilE, HilC, HilD, RtsA, FimZY, PhoR/PhoB, Fur, BarA/SirA, and EnvZ/OmpR (for a review, see reference 14). Perhaps more relevant for the pathogenesis of Salmonella are the environmental conditions that regulate genes of the SPI1-encoded TTSS, including ph, oxygen, osmolarity, growth phase, and bile (5, 18, 26 28, 33, 38, 39), some of which have been shown to directly affect the invasiveness of Salmonella. For example, low oxygen tension and acetic acid were shown to enhance Salmonella invasion, while bile and butyric acid reduce invasion (27, 39, 46). Our direct comparison of the expression and secretion of the SipA, SipC, and SopB proteins in the presence of KCl and NaCl and the invasiveness of Salmonella cultured with supplemental KCl or NaCl indicated that both KCl and NaCl regulated the effector proteins of the SPI1-encoded TTSS; however, the effects were not identical (Fig. 4 and 5). Addition of potassium chloride resulted in stronger induction of the proteins overall, especially in the trka mutant, whereas addition of NaCl had little or no effect on the expression of SipA and the secretion of SipC and SopB (Fig. 4 and 5). This suggests that the signaling pathways involved were not identical for KCl and NaCl, and the induction of the effector proteins of the SPI1-encoded TTSS by NaCl was at least partially dependent on Trk. However, the molecular mechanisms that determine the different effects that KCl and NaCl have on the TTSS of Salmonella lacking the Trk system have not been characterized yet. One hypothesis to explain the difference between supplemental KCl and supplemental NaCl is that they may affect the alternative K transporter(s) that Salmonella uses in the absence of the major K transporter Trk. Without Trk, the high-affinity Kdp transporter and the low-affinity Kup transporter likely substitute for Trk,

8 674 SU ET AL. INFECT. IMMUN. and K downregulates Kdp but not Kup. As a result, Kup may be more active with supplemental K than with supplemental Na, leading to a state more similar to that of the wild-type bacteria. After we performed the experiments reported here, Mizusaki et al. reported that the secretion of Sips was induced by sucrose and several salts, including NaCl and KCl, and that NaCl-induced secretion of Sips was due to induction of hila expression mediated by BarA/SirA but not by EnvZ (36). We do not know yet how the Trk system affects the regulation of SPI1 and why the expression and secretion of effector proteins of the SPI1-encoded TTSS were defective in the trka mutant of Salmonella. The defect did not occur because the trka mutant expressed less hila and invf, which encode direct regulators of SPI1 expression. In fact, we found that the expression of both hila and invf was elevated in the trka mutant (unpublished results). An expression profile analysis of the wild-type strain and trka mutant of Salmonella and an analysis of physiological changes caused by mutations in K transporters and external K should provide more insight into how potassium transporters and external K regulate the growth and pathogenicity of Salmonella. ACKNOWLEDGMENTS We thank Hiroshi Nikaido for insightful discussions and C. S. Shashikant for critical comments on the manuscript. This work was supported by USDA grant CALR to S.L. REFERENCES 1. Ahmer, B. M., J. van Reeuwijk, P. R. Watson, T. S. Wallis, and F. Heffron Salmonella SirA is a global regulator of genes mediating enteropathogenesis. Mol. Microbiol. 31: Asha, H., and J. Gowrishankar Regulation of kdp operon expression in Escherichia coli: evidence against turgor as signal for transcriptional control. J. Bacteriol. 175: Ausubel, F., R. Brent, R. Kingston, D. Moore, J. Smith, and K. Struhl Current protocols in molecular biology. John Wiley & Sons, New York, NY. 4. Bajaj, V., C. Hwang, and C. A. Lee hila is a novel ompr/toxr family member that activates the expression of Salmonella typhimurium invasion genes. Mol. Microbiol. 18: Bajaj, V., R. L. Lucas, C. Hwang, and C. A. Lee Co-ordinate regulation of Salmonella typhimurium invasion genes by environmental and regulatory factors is mediated by control of hila expression. Mol. Microbiol. 22: Berggren, R. E., A. Wunderlich, E. Ziegler, M. Schleicher, R. C. Duke, D. Looney, and F. C. Fang HIV gp120-specific cell-mediated immune responses in mice after oral immunization with recombinant Salmonella. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 10: Bossemeyer, D., A. Borchard, D. C. Dosch, G. C. Helmer, W. Epstein, I. R. Booth, and E. P. Bakker K -transport protein TrkA of Escherichia coli is a peripheral membrane protein that requires other trk gene products for attachment to the cytoplasmic membrane. J. Biol. Chem. 264: Bossemeyer, D., A. Schlosser, and E. P. Bakker Specific cesium transport via the Escherichia coli Kup (TrkD) K uptake system. J. Bacteriol. 171: Chen, Y. C., Y. C. Chuang, C. C. Chang, C. L. Jeang, and M. C. Chang AK uptake protein, TrkA, is required for serum, protamine, and polymyxin B resistance in Vibrio vulnificus. Infect. Immun. 72: Darwin, K. H., and V. L. Miller InvF is required for expression of genes encoding proteins secreted by the SPI1 type III secretion apparatus in Salmonella typhimurium. J. Bacteriol. 181: Darwin, K. H., and V. L. Miller The putative invasion protein chaperone SicA acts together with InvF to activate the expression of Salmonella typhimurium virulence genes. Mol. Microbiol. 35: Datsenko, K. A., and B. L. Wanner One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97: Eichelberg, K., and J. E. Galan Differential regulation of Salmonella typhimurium type III secreted proteins by pathogenicity island 1 (SPI-1)- encoded transcriptional activators InvF and HilA. Infect. Immun. 67: Ellermeier, J. R., and J. M. Slauch Adaptation to the host environment: regulation of the SPI1 type III secretion system in Salmonella enterica serovar Typhimurium. Curr. Opin. Microbiol. 10: Epstein, W The roles and regulation of potassium in bacteria. Prog. Nucleic Acid Res. Mol. Biol. 75: Fordtran, J. S., and T. W. Locklear Ionic constituents and osmolality of gastric and small-intestinal fluids after eating. Am. J. Dig. Dis. 11: Frymier, J. S., T. D. Reed, S. A. Fletcher, and L. N. Csonka Characterization of transcriptional regulation of the kdp operon of Salmonella typhimurium. J. Bacteriol. 179: Galan, J. E., and R. Curtiss III Expression of Salmonella typhimurium genes required for invasion is regulated by changes in DNA supercoiling. Infect. Immun. 58: Huang, Y., M. Suyemoto, C. D. Garner, K. M. Cicconi, and C. Altier Formate acts as a diffusible signal to induce Salmonella invasion. J. Bacteriol. 190: Jepson, M. A., B. Kenny, and A. D. Leard Role of sipa in the early stages of Salmonella typhimurium entry into epithelial cells. Cell. Microbiol. 3: Kaniga, K., D. Trollinger, and J. E. Galan Identification of two targets of the type III protein secretion system encoded by the inv and spa loci of Salmonella typhimurium that have homology to the Shigella IpaD and IpaA proteins. J. Bacteriol. 177: Kem, D. C., and D. Trachewsky Potassium metabolism, p In R. Whang (ed.), Potassium: its biologic significance. CRC Press, Inc., Boca Raton, FL. 23. Komoriya, K., N. Shibano, T. Higano, N. Azuma, S. Yamaguchi, and S. I. Aizawa Flagellar proteins and type III-exported virulence factors are the predominant proteins secreted into the culture media of Salmonella typhimurium. Mol. Microbiol. 34: Kumar, K. A., C. R. Garcia, V. R. Chandran, N. Van Rooijen, Y. Zhou, E. Winzeler, and V. Nussenzweig Exposure of Plasmodium sporozoites to the intracellular concentration of potassium enhances infectivity and reduces cell passage activity. Mol. Biochem. Parasitol. 156: Laimins, L. A., D. B. Rhoads, and W. Epstein Osmotic control of kdp operon expression in Escherichia coli. Proc. Natl. Acad. Sci. USA 78: Leclerc, G. J., C. Tartera, and E. S. Metcalf Environmental regulation of Salmonella typhi invasion-defective mutants. Infect. Immun. 66: Lee, C. A., and S. Falkow The ability of Salmonella to enter mammalian cells is affected by bacterial growth state. Proc. Natl. Acad. Sci. USA 87: Lee, C. A., B. D. Jones, and S. Falkow Identification of a Salmonella typhimurium invasion locus by selection for hyperinvasive mutants. Proc. Natl. Acad. Sci. USA 89: Lostroh, C. P., and C. A. Lee The HilA box and sequences outside it determine the magnitude of HilA-dependent activation of P prgh from Salmonella pathogenicity island 1. J. Bacteriol. 183: Lu, S., P. B. Killoran, F. C. Fang, and L. W. Riley The global regulator ArcA controls resistance to reactive nitrogen and oxygen intermediates in Salmonella enterica serovar Enteritidis. Infect. Immun. 70: Lu, S., P. B. Killoran, and L. W. Riley Association of Salmonella enterica serovar Enteritidis yafd with resistance to chicken egg albumen. Infect. Immun. 71: Lu, S., A. R. Manges, Y. Xu, F. C. Fang, and L. W. Riley Analysis of virulence of clinical isolates of Salmonella enteritidis in vivo and in vitro. Infect. Immun. 67: Lundberg, U., U. Vinatzer, D. Berdnik, A. von Gabain, and M. Baccarini Growth phase-regulated induction of Salmonella-induced macrophage apoptosis correlates with transient expression of SPI-1 genes. J. Bacteriol. 181: Malli, R., and W. Epstein Expression of the Kdp ATPase is consistent with regulation by turgor pressure. J. Bacteriol. 180: Maloy, S. R., V. J. Stewart, and R. K. Taylor Genetic analysis of pathogenic bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 36. Mizusaki, H., A. Takaya, T. Yamamoto, and S. I. Aizawa Signal pathway in salt-activated expression of the Salmonella pathogenicity island 1 type III secretion system in Salmonella enterica serovar Typhimurium. J. Bacteriol. 190: Parra-Lopez, C., R. Lin, A. Aspedon, and E. A. Groisman A Salmonella protein that is required for resistance to antimicrobial peptides and transport of potassium. EMBO J. 13: Prouty, A. M., I. E. Brodsky, J. Manos, R. Belas, S. Falkow, and J. S. Gunn Transcriptional regulation of Salmonella enterica serovar Typhimurium genes by bile. FEMS Immunol. Med. Microbiol. 41: Prouty, A. M., and J. S. Gunn Salmonella enterica serovar Typhimurium invasion is repressed in the presence of bile. Infect. Immun. 68: Raffatellu, M., R. P. Wilson, D. Chessa, H. Andrews-Polymenis, Q. T. Tran, S. Lawhon, S. Khare, L. G. Adams, and A. J. Baumler SipA, SopA, SopB, SopD, and SopE2 contribute to Salmonella enterica serotype Typhimurium invasion of epithelial cells. Infect. Immun. 73:

9 VOL. 77, 2009 ROLE OF POTASSIUM IN SALMONELLA PATHOGENESIS Reed, L. J., and H. Muench A simple method of estimating fifty per cent endpoints. Am. J. Hyg. 27: Sambrook, J., and D. W. Russell Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 43. Trchounian, A., and H. Kobayashi K uptake by fermenting Escherichia coli cells: ph dependent mode of the TrkA system operating. Biosci. Rep. 20: Trchounian, A., and H. Kobayashi Kup is the major K uptake system in Escherichia coli upon hyper-osmotic stress at a low ph. FEBS Lett. 447: Uzzau, S., N. Figueroa-Bossi, S. Rubino, and L. Bossi Epitope tagging of chromosomal genes in Salmonella. Proc. Natl. Acad. Sci. USA 98: Van Immerseel, F., J. De Buck, I. De Smet, F. Pasmans, F. Haesebrouck, and R. Ducatelle Interactions of butyric acid- and acetic acid-treated Salmonella with chicken primary cecal epithelial cells in vitro. Avian Dis. 48: Wagner, D., J. Maser, B. Lai, Z. Cai, C. E. Barry III, K. Honer Zu Bentrup, D. G. Russell, and L. E. Bermudez Elemental analysis of Mycobacterium avium-, Mycobacterium tuberculosis-, and Mycobacterium smegmatis-containing phagosomes indicates pathogen-induced microenvironments within the host cell s endosomal system. J. Immunol. 174: Zakharyan, E., and A. Trchounian K influx by Kup in Escherichia coli is accompanied by a decrease in H efflux. FEMS Microbiol. Lett. 204: Editor: A. J. Bäumler