Supporting information for

Transcription

1 Supporting information for Rewiring multi-domain protein switches: transforming a fluorescent Zn 2+ -sensor into a light-responsive Zn 2+ binding protein Stijn J.A. Aper and Maarten Merkx Laboratory of Chemical Biology and Institute for Complex Molecular Systems (ICMS), Department of Biomedical Engineering, Eindhoven University of Technology, P.O. Box 513, 5600 MB Eindhoven, The Netherlands. Supporting figures Page Figure S1 Normalized fluorescence emission spectra of VividZn-1 in light- and dark-state at different free Zn 2+ levels S2 Figure S2 Emission ratio 527/513 nm of VividZn-1 to -8 as a function of free Zn 2+ concentration in light- and dark-state S3 Figure S3 SDS-PAGE analysis of VividZn proteins S4 Figure S4 Absorbance spectra for the dark-state recovery of the Vivid proteins in VividZn-6-I74V S5 Figure S5 Figure S6 Figure S7 Figure S8 Normalized emission ratio Citrine/Cerulean of VividZn-2 in HeLa cells, measured in resting state, Zn 2+ -depleted and Zn 2+ -saturated state Normalized emission ratio Citrine/Cerulean of VividZn-7 in HeLa cells, measured in resting state, Zn 2+ -depleted and Zn 2+ -saturated state Emission ratio mcherry/morange measured for HeLa cells transfected with both VividZn-6 and redcalwy- 3/-4, in dark- and light-state Nucleotide and amino acid sequence of VividZn-2 in pet28a-vividzn-2, with the adjustments made to generate the genes of the other VividZn switches highlighted S6 S7 S8 S9-11 Figure S9 Nucleotide and amino acid sequence of VividZn-7 in pcmv-vividzn-7 S12-13 Supporting tables Page Table S1 Overview of the expression plasmids of the VividZn switches and the corresponding properties S14 Table S2 Primers used during the different cloning steps to generate expression plasmids for the VividZn switches S15 S1

2 Supporting figures Figure S1. Normalized fluorescence emission spectra of VividZn-1 in the light-state (orange curves) and dark-state (black curves), in the presence of 6.5 fm free Zn 2+ (solid curves) or 2.1 nm free Zn 2+ (dashed curves). Cerulean was excited at 430 nm. Measurements were performed using 150 nm protein in 150 mm HEPES (ph 7.1), 100 mm NaCl, 10% (v/v) glycerol, 5 µm DTT, 1 mm TCEP, and 1 mg/ml BSA, at 28 C. S2

3 Figure S2. (A-J) Emission ratio (527/513 nm) of VividZn-1 (A), VividZn-1-C71S (B), VividZn-2 (C), VividZn-2-C71S (D), VividZn-3 (E), VividZn-4 (F), VividZn-5 (G), VividZn-6 (H), VividZn-7 (I) and VividZn-8 (J) in light-state (orange circle) and dark-state (black triangle) in the presence of a range of Zn 2+ concentrations buffered using 1 mm EDTA, 1 mm HEDTA, 1 mm DHPTA, 5 mm EGTA, or 1 mm EGTA. Cerulean was excited at 430 nm. Measurements were performed using 150 nm protein in 150 mm HEPES (ph 7.1), 100 mm NaCl, 10% (v/v) glycerol, 5 µm DTT, 1 mm TCEP, and 1 mg/ml BSA, at 28 C. The data shown here is the raw data that is presented normalized in figures 2E-F, 4C-D and 5C-H. The depicted data is the average of two measurements, and the solid lines represent data fits assuming single binding events (equation 2). S3

4 Figure S3. SDS-PAGE analysis of VividZn proteins. L = kda protein ladder (Thermo Fisher Scientific). Calculated molecular weights: (1) VividZn kda; (1C71S) VividZn-1-C71S kda; (2) VividZn kda; (2C71S) VividZn-2-C71S kda; (3) VividZn kda; (4) VividZn kda; (5) VividZn kda; (6) VividZn kda; (7) VividZn kda; (8) VividZn kda. S4

5 Figure S4. (A) Absorbance spectra obtained for the dark-state recovery of the Vivid proteins in VividZn-6-I74V (0-60 min, 6 min increments) after light exposure. The arrow indicates how absorption evolves over time, with a half-life of 10.5 ± 0.6 minutes. Measurements were performed using 1 µm protein in 150 mm HEPES (ph 7.1), 100 mm NaCl, 10% (v/v) glycerol, 5 µm DTT, 1 mm TCEP, and 1 mm EDTA, at 20 C. (B) Absorbance at 453 nm over time for the dark-state recovery of the Vivid proteins in VividZn-6-I74V. Data shown is the average of two measurements, and was fitted assuming first order reaction kinetics using equation 1. S5

6 Figure S5. Normalized emission ratio Citrine/Cerulean (Cerulean excitation: 405 nm, Cerulean emission: nm, Citrine emission: nm) of light-state (10 minutes illuminated using ambient light source) VividZn-2, measured in resting state, and upon addition of 50 µm TPEN at time point 1 and 100 µm ZnCl2 and 5 µm pyrithione at time point 2. Data shown is the average of the measurements for three cells, after normalization of the emission ratio at t = 0. Error bars represent SD. Cells were imaged using a confocal microscope during continuous flow of live cell imaging buffer (20 mm HEPES (ph 7.4), 140 mm NaCl, 2.5 mm KCl, 1.8 mm CaCl2, and 1.0 mm MgCl2), at 37 C. S6

7 Figure S6. Normalized emission ratio Citrine/Cerulean (Cerulean excitation: 405 nm, Cerulean emission: nm, Citrine emission: nm) of light-state (10 minutes illuminated using ambient light source) VividZn-7, measured in resting state, and upon addition of 50 µm TPEN at time point 1 and 100 µm ZnCl2 and 5 µm pyrithione at time point 2. Data shown is the average of the measurements for three cells, after normalization of the emission ratio at t = 0. Error bars represent SD. Cells were imaged using a confocal microscope during continuous flow of live cell imaging buffer (20 mm HEPES (ph 7.4), 140 mm NaCl, 2.5 mm KCl, 1.8 mm CaCl2, and 1.0 mm MgCl2), at 37 C. S7

8 Figure S7. (A) Citrine emission (left; excitation at 505 nm) and morange emission (right; excitation at 542 nm) of HeLa cells expressing VividZn-6 and redcalwy-4. Scale bar = 10 µm. (B) Emission ratio mcherry/morange of redcalwy-4 (Kd = 234 ± 5 pm), that was cotransfected in HeLa cells with VividZn-6 (Kd, light = 304 ± 55 pm, Kd, dark = 5.5 ± 1.4 pm), measured before, during (blue block) and after illumination with a blue LED light. At time point 1 5 µm ZnCl2 and 1 µm pyrithione were added, followed by 50 µm TPEN at time point 2. Data is shown for the cell that is marked with the dashed white rectangle in (A). (C) Emission ratio mcherry/morange of redcalwy-3 (Kd = 18.0 ± 2.0 pm), that was co-transfected in HeLa cells with VividZn-6 (Kd, light = 304 ± 55 pm, Kd, dark = 5.5 ± 1.4 pm), measured before, during (blue block) and after illumination with a blue LED light. At time point 1 50 µm TPEN was added, followed by 5 µm ZnCl2 and 1 µm pyrithione at time point 2. Cells were imaged using a confocal microscope during continuous flow of live cell imaging buffer (20 mm HEPES (ph 7.4), 140 mm NaCl, 2.5 mm KCl, 1.8 mm CaCl2, and 1.0 mm MgCl2), at 37 C. S8

9 atgggcagcagccatcatcatcatcatcacagcagcggcctggtcccacgtggatctcac M G S S H H H H H H S S G L V P R G S H cggatggtttctaaaggcgaggaactgtttacgggtgtggttccgatcctggtggagctg R M V S K G E E L F T G V V P I L V E L gatggtgatgtgaacggtcataaattcagcgtgagcggtgaaggcgaaggcgacgcaact D G D V N G H K F S V S G E G E G D A T tacggcaagctgaccctgaagttcatctgcaccactggcaaactgccggttccgtggccg Y G K L T L K F I C T T G K L P V P W P accctggtcaccaccctgacctggggtgtccagtgtttcgcgcgttatcctgaccatatg T L V T T L T W G V Q C F A R Y P D H M aaacagcacgatttctttaaatctgcgatgccagaaggttacgttcaggaacgtactatt K Q H D F F K S A M P E G Y V Q E R T I ttctttaaggatgatggcaattacaaaactcgcgcagaagttaaattcgagggcgatacc F F K D D G N Y K T R A E V K F E G D T ctggtcaaccgtatcgaactgaaaggtatcgacttcaaggaagatggtaatatcctgggc L V N R I E L K G I D F K E D G N I L G cacaaactggaatacaacgcgatctccgataacgtttacatcaccgctgataagcagaag H K L E Y N A I S D N V Y I T A D K Q K aatggtatcaaagcgaacttcaaaattcgccacaacatcgaagatggttctgtgcagctg N G I K A N F K I R H N I E D G S V Q L gcagatcactaccaacagaacaccccgatcggtgatggtccggtcctgctgccggacaac A D H Y Q Q N T P I G D G P V L L P D N cattatctgagcactcaatctgccctgtccaaagacccaaacgagaaacgcgaccacatg H Y L S T Q S A L S K D P N E K R D H M gtactgctggaattcctgactgccgctggcattaccctgggtggaacctctggtggccat V L L E F L T A A G I T L G G T S G G H actctgtacgctcccggaggatatgatattatgggttatctgattcaaatcatgaaccgc T L Y A P G G Y D I M G Y L I Q I M N R ccaaaccctcaagttgaactggggcccgttgatactagctgtgccctgatcctgtgcgat P N P Q V E L G P V D T S C A L I L C D ctgaagcagaaggacacaccgattgtttatgcatctgaggccttcctgtacatgactggg L K Q K D T P I V Y A S E A F L Y M T G tattcgaatgcggaagtcctgggccgcaattgtcgcttcctgcaatcccctgatggcatg Y S N A E V L G R N C R F L Q S P D G M gtgaagccgaagtctacccgtaaatacgttgacagtaatacgatcaacaccatgcgcaag V K P K S T R K Y V D S N T I N T M R K gccatcgatcgtaatgcagaagtacaggtggaagtggttaacttcaagaaaaatggccaa A I D R N A E V Q V E V V N F K K N G Q cgctttgtgaactttctgacgatgattccagttcgcgatgaaacgggtgagtatcgctac R F V N F L T M I P V R D E T G E Y R Y agtatggggtttcaatgtgagacagaaggtgctagcatgccaaagcacgagttctctgtg S M G F Q C E T E G A S M P K H E F S V gacatgacctgtggtggctgtgctgaagctgtctctcgcgtcctgaataagctgggtggc D M T C G G C A E A V S R V L N K L G G gttaagtatgacattgatctgccgaacaagaaggtctgcattgaatctgagcacagcatg V K Y D I D L P N K K V C I E S E H S M gacactctgctggcaaccctgaagaaaacaggaaagactgtttcctaccttggccttgag D T L L A T L K K T G K T V S Y L G L E ctcattcgtgggggatccggcggtagcggcggatccggcggctctggcggatccggtggt L I R G G S G G S G G S G G S G G S G G tcaggtggatccggcggcagtggtggatccgggggcagcggcggatccggcggttctggt S G G S G G S G G S G G S G G S G G S G ggatccggtggctcgggcggatccggtggttcaggtggatccgggggcagcgaaaacctg G S G G S G G S G G S G G S G G S E N L tatttccagtccggtgggtctggaggtccgcggatgcagggcacatgcagtaccactctg Y F Q S G G S G G P R M Q G T C S T T L attgccattgccggcatgacctgtgcatcctgtgtccattccattgaaggcatgatctcc I A I A G M T C A S C V H S I E G M I S S9

10 caactggaaggcgtgcagcaaatttcggtgtctctggccgaagggactgcaacagttctg Q L E G V Q Q I S V S L A E G T A T V L tataatccggctgtaattagcccagaagaactgcgtgctgctattgaagacatgggtttt Y N P A V I S P E E L R A A I E D M G F gaggcttcagtcgtttcgacaggtaatccgttgttctttcacacactgtatgctcctggt E A S V V S T G N P L F F H T L Y A P G ggttacgacattatgggctacctgatccagattatgaatcgtccgaatccacaagtggag G Y D I M G Y L I Q I M N R P N P Q V E ctgggtccggtggacacctcatgtgctctcattctgtgtgaccttaaacaaaaagatact L G P V D T S C A L I L C D L K Q K D T cctatcgtatacgcgagcgaggcgtttctgtatatgaccggctactcaaacgctgaggtt P I V Y A S E A F L Y M T G Y S N A E V ctgggtcgtaactgccgttttcttcagtctccggacggtatggttaaaccaaaatctaca L G R N C R F L Q S P D G M V K P K S T cgtaagtatgtggattccaacaccattaatactatgcgtaaagctattgaccgcaacgcg R K Y V D S N T I N T M R K A I D R N A gaggtgcaagttgaggttgtcaattttaagaagaacggccagcgcttcgtcaatttcctg E V Q V E V V N F K K N G Q R F V N F L actatgatccctgtgcgtgacgagacaggcgaataccgttattctatgggatttcagtgc T M I P V R D E T G E Y R Y S M G F Q C gaaacggagtctacgggcgctacgactagtatggtgagcaagggtgaagaattattcacc E T E S T G A T T S M V S K G E E L F T ggcgtggtgccgatcctggtagaactggacggtgatgttaacggtcacaaatttagcgta G V V P I L V E L D G D V N G H K F S V tctggtgagggtgaaggcgacgcgacttacggcaaactgactctgaaattcatctgcact S G E G E G D A T Y G K L T L K F I C T accggtaaactgccggtgccatggccgaccctggtgaccaccttcggctacggtctgatg T G K L P V P W P T L V T T F G Y G L M tgtttcgcccgttatccggaccacatgaagcaacatgatttctttaagtccgcgatgccg C F A R Y P D H M K Q H D F F K S A M P gaaggttacgtgcaggaacgtaccattttcttcaaggatgatggtaattataagactcgc E G Y V Q E R T I F F K D D G N Y K T R gccgaagtaaagtttgaaggcgataccctggttaatcgtattgaactgaagggcatcgac A E V K F E G D T L V N R I E L K G I D ttcaaagaagatggtaacatcctgggtcataaactggaatacaattataactctcacaac F K E D G N I L G H K L E Y N Y N S H N gtgtacattatggcagataaacagaagaacggtatcaaagtaaacttcaaaatccgccac V Y I M A D K Q K N G I K V N F K I R H aatatcgaagatggcagcgtccaactggctgatcactatcaacagaacaccccgatcggc N I E D G S V Q L A D H Y Q Q N T P I G gatggcccggtgctgctgcctgacaatcactacctttcttaccagagtgcgttaagtaag D G P V L L P D N H Y L S Y Q S A L S K gatcctaatgaaaagcgtgaccatatggttttattagagtttttgacggctgcgggtatc D P N E K R D H M V L L E F L T A A G I acgttaggcatggatgagttatataaaggctggagccaccctcagttcgaaaaataaagc T L G M D E L Y K G W S H P Q F E K - ggccgc Figure S8. Nucleotide and amino acid sequence of VividZn-2 in pet28a-vividzn-2, in which the adjustments made to generate the genes of the other VividZn switches are highlighted. The N-terminal His-tag and C-terminal Strep-tag are depicted in orange and purple respectively. The thrombin cleavage site is shown in gold. The Vivid domains are presented in dark blue. The Atox1 and WD4 domains are depicted in dark red and green respectively. Cerulean and Citrine are colored light blue and yellow respectively. All peptide linkers are shown in black. The amino acids that were added to the WD4-Vivid linker to create pet28a-vividzn-2 starting from pet28a-vividzn-1 are depicted in bold. In the Vivid proteins the Cys71 and Ile74 residues mutated to Ser and Val respectively in some of the VividZn switch variants are S10

11 shown in bold and underlined. In addition, the cysteines that were mutated to serine in either WD4 or Atox1 to generate pet28a-vividzn-7 or -8 are presented in bold and underlined. In the long Gly-Gly-Ser linker in between Atox1 and WD4 the part of the sequence that is systematically removed to generate pet28a-vividzn-3 to -6 starting from pet28a-vividzn-2 is italicized. The used BamHI restriction sites in this linker are shown underlined. At the C-terminus the NotI restriction site originating from the pet28a vector is underlined. S11

12 cgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctggtttagtga accgtcagatccgctagcgccgccaccatgggaggaacctctggtggccatactctgtac M G G T S G G H T L Y gctcccggaggatatgatattatgggttatctgattcaaatcatgaaccgcccaaaccct A P G G Y D I M G Y L I Q I M N R P N P caagttgaactggggcccgttgatactagctgtgccctgatcctgtgcgatctgaagcag Q V E L G P V D T S C A L I L C D L K Q aaggacacaccgattgtttatgcatctgaggccttcctgtacatgactgggtattcgaat K D T P I V Y A S E A F L Y M T G Y S N gcggaagtcctgggccgcaattgtcgcttcctgcaatcccctgatggcatggtgaagccg A E V L G R N C R F L Q S P D G M V K P aagtctacccgtaaatacgttgacagtaatacgatcaacaccatgcgcaaggccatcgat K S T R K Y V D S N T I N T M R K A I D cgtaatgcagaagtacaggtggaagtggttaacttcaagaaaaatggccaacgctttgtg R N A E V Q V E V V N F K K N G Q R F V aactttctgacgatgattccagttcgcgatgaaacgggtgagtatcgctacagtatgggg N F L T M I P V R D E T G E Y R Y S M G tttcaatgtgagacagaaggtgctagcatgccaaagcacgagttctctgtggacatgacc F Q C E T E G A S M P K H E F S V D M T tgtggtggctgtgctgaagctgtctctcgcgtcctgaataagctgggtggcgttaagtat C G G C A E A V S R V L N K L G G V K Y gacattgatctgccgaacaagaaggtctgcattgaatctgagcacagcatggacactctg D I D L P N K K V C I E S E H S M D T L ctggcaaccctgaagaaaacaggaaagactgtttcctaccttggccttgagctcattcgt L A T L K K T G K T V S Y L G L E L I R gggggatccggcggtagcggcggatccggcggctctggcggatccggtggttcaggtgga G G S G G S G G S G G S G G S G G S G G tccggcggcagtggtggatccgggggcagcggcggatccggcggttctggtggatccggt S G G S G G S G G S G G S G G S G G S G ggctcgggcggatccggtggttcaggtggatccgggggcagcgaaaacctgtatttccag G S G G S G G S G G S G G S E N L Y F Q tccggtgggtctggaggtccgcggatgcagggcacatgcagtaccactctgattgccatt S G G S G G P R M Q G T C S T T L I A I gccggcatgacctgtgcatcctctgtccattccattgaaggcatgatctcccaactggaa A G M T C A S S V H S I E G M I S Q L E ggcgtgcagcaaatttcggtgtctctggccgaagggactgcaacagttctgtataatccg G V Q Q I S V S L A E G T A T V L Y N P gctgtaattagcccagaagaactgcgtgctgctattgaagacatgggttttgaggcttca A V I S P E E L R A A I E D M G F E A S gtcgtttcgacaggtaatccgttgttctttcacacactgtatgctcctggtggttacgac V V S T G N P L F F H T L Y A P G G Y D attatgggctacctgatccagattatgaatcgtccgaatccacaagtggagctgggtccg I M G Y L I Q I M N R P N P Q V E L G P gtggacacctcatgtgctctcattctgtgtgaccttaaacaaaaagatactcctatcgta V D T S C A L I L C D L K Q K D T P I V tacgcgagcgaggcgtttctgtatatgaccggctactcaaacgctgaggttctgggtcgt Y A S E A F L Y M T G Y S N A E V L G R aactgccgttttcttcagtctccggacggtatggttaaaccaaaatctacacgtaagtat N C R F L Q S P D G M V K P K S T R K Y gtggattccaacaccattaatactatgcgtaaagctattgaccgcaacgcggaggtgcaa V D S N T I N T M R K A I D R N A E V Q gttgaggttgtcaattttaagaagaacggccagcgcttcgtcaatttcctgactatgatc V E V V N F K K N G Q R F V N F L T M I cctgtgcgtgacgagacaggcgaataccgttattctatgggatttcagtgcgaaacggag P V R D E T G E Y R Y S M G F Q C E T E tctacgggcgctacgactagtatggtgagcaagggtgaagaattattcaccggcgtggtg S T G A T T S M V S K G E E L F T G V V ccgatcctggtagaactggacggtgatgttaacggtcacaaatttagcgtatctggtgag P I L V E L D G D V N G H K F S V S G E ggtgaaggcgacgcgacttacggcaaactgactctgaaattcatctgcactaccggtaaa G E G D A T Y G K L T L K F I C T T G K S12

13 ctgccggtgccatggccgaccctggtgaccaccttcggctacggtctgatgtgtttcgcc L P V P W P T L V T T F G Y G L M C F A cgttatccggaccacatgaagcaacatgatttctttaagtccgcgatgccggaaggttac R Y P D H M K Q H D F F K S A M P E G Y gtgcaggaacgtaccattttcttcaaggatgatggtaattataagactcgcgccgaagta V Q E R T I F F K D D G N Y K T R A E V aagtttgaaggcgataccctggttaatcgtattgaactgaagggcatcgacttcaaagaa K F E G D T L V N R I E L K G I D F K E gatggtaacatcctgggtcataaactggaatacaattataactctcacaacgtgtacatt D G N I L G H K L E Y N Y N S H N V Y I atggcagataaacagaagaacggtatcaaagtaaacttcaaaatccgccacaatatcgaa M A D K Q K N G I K V N F K I R H N I E gatggcagcgtccaactggctgatcactatcaacagaacaccccgatcggcgatggcccg D G S V Q L A D H Y Q Q N T P I G D G P gtgctgctgcctgacaatcactacctttcttaccagagtgcgttaagtaaagatcctaat V L L P D N H Y L S Y Q S A L S K D P N gaaaagcgtgaccatatggttttattagagtttttgacggctgcgggtatcacgttaggc E K R D H M V L L E F L T A A G I T L G atggatgagttatataaataaggccgcgactctagatcataatcagccataccacatttg M D E L Y K - tagaggttttacttgctttaaaaaacctcccacacctccccctgaacctgaaacataaaa tgaatgcaattgttgttgttaacttgtttattgcagcttataatggttacaaataaagca atagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgt ccaaactcatcaatgtatcttaag Figure S9. Nucleotide and amino acid sequence of VividZn-7 in pcmv-vividzn-7. The Vivid domains are presented in dark blue. The Atox1 and WD4 domains are depicted in dark red and green respectively. Citrine is colored yellow. All peptide linkers are shown in black. The cysteine that was mutated to serine in WD4 is presented in bold and underlined. The pcmv promoter region is depicted in orange and the SV40 poly(a) terminator region is shown in purple. S13

14 Supporting tables Table S1. Overview of the expression plasmids of the VividZn switches and the corresponding properties. Vector name Protein Promoter WD4-Vivid # GGSGGS Cys-to-Ser Other mutations / modifi- linker repeats Atox1/WD4? cations? pet28a-vividzn-1 VividZn-1 T7 STG 10 No No pet28a-vividzn-1-c71s VividZn-1-C71S T7 STG 10 No Vivid1-C71S, Vivid2-C71S pet28a-vividzn-1a VividZn-1a T7 VSTG 10 No No pet28a-vividzn-1b VividZn-1b T7 VSTGF 10 No No pet28a-vividzn-1c VividZn-1c T7 VSTGFF 10 No No pet28a-vividzn-1d VividZn-1d T7 VSTGLFF 10 No No pet28a-vividzn-2 VividZn-2 T7 VSTGNPLFF 10 No No pet28a-vividzn-2-c71s VividZn-2-C71S T7 VSTGNPLFF 10 No Vivid1-C71S, Vivid2-C71S pet28a-vividzn-3 VividZn-3 T7 VSTGNPLFF 7 No No pet28a-vividzn-4 VividZn-4 T7 VSTGNPLFF 5 No No pet28a-vividzn-4-i74v VividZn-4-I74V T7 VSTGNPLFF 5 No Vivid1-I74V, Vivid2-I74V pet28a-vividzn-5 VividZn-5 T7 VSTGNPLFF 3 No No pet28a-vividzn-6 VividZn-6 T7 VSTGNPLFF 2 No No pet28a-vividzn-6-i74v VividZn-6-I74V T7 VSTGNPLFF 2 No Vivid1-I74V, Vivid2-I74V pet28a-vividzn-7 VividZn-7 T7 VSTGNPLFF 10 Yes, WD4 No pet28a-vividzn-8 VividZn-8 T7 VSTGNPLFF 10 Yes, Atox1 No pcmv-vividzn-6 VividZn-6 CMV VSTGNPLFF 2 No No pcmv-vividzn-7 VividZn-7 CMV VSTGNPLFF 10 Yes, WD4 No pcmv-vividzn-6-nocer VividZn-6-noCer CMV VSTGNPLFF 2 No Cerulean removed pcmv-vividzn-7-nocer VividZn-7-noCer CMV VSTGNPLFF 10 Yes, WD4 Cerulean removed S14

15 Table S2. Primers used during the different cloning steps to generate expression plasmids for the VividZn switches. FW = forward, RV = reverse. Primer # Primer name Sequence 1 VSTG FW 5 - TTCAGTCGTTTCGACCGGTCACACACTGTATGCTC -3 2 VSTG RV 5 - CGGTCGAAACGACTGAAGCCTCAAAACCCATGTCTTC -3 3 VSTGF FW 5 - CGTTTCGACCGGTTTTCACACACTGTATGCTCCTGGTGGTTACG -3 4 VSTGF RV 5 - GAAAACCGGTCGAAACGACTGAAGCCTCAAAACCCATGTCTTC -3 5 VSTGFF FW 5 - GTTTCGACCGGTTTCTTTCACACACTGTATGCTCCTGGTGGTTACG -3 6 VSTGFF RV 5 - GAAAGAAACCGGTCGAAACGACTGAAGCCTCAAAACCCATGTCTTC -3 7 VSTGLFF FW 5 - GTTTCGACAGGTTTGTTCTTTCACACACTGTATGCTCCTGGTGGTTACG -3 8 VSTGLFF RV 5 - AAAGAACAAACCTGTCGAAACGACTGAAGCCTCAAAACCCATGTCTTC -3 9 VSTGNPLFF FW 5 - CGACAGGTAATCCGTTGTTCTTTCACACACTGTATGCTCCTGG VSTGNPLFF RV 5 - AACAACGGATTACCTGTCGAAACGACTGAAGCCTC Vivid1 C71S FW 5 - GCCCGTTGATACTAGCAGTGCCCTGATCCTGTGC Vivid2 C71S FW 5 - TCCGGTGGACACCTCAAGTGCTCTCATTCTGTGTG Vivid1 I74V FW 5 - GATACTAGCTGTGCCCTGGTCCTGTGCGATCTG Vivid2 I74V FW 5 - CACCTCATGTGCTCTCGTTCTGTGTGACC Cys-to-Ser Atox1 FW 5 - CATGACCTGTGGTGGCAGTGCTGAAGCTGTCTC Cys-to-Ser Atox1 RV 5 - GAGACAGCTTCAGCACTGCCACCACAGGTCATG Cys-to-Ser WD4 FW 5 - CATGACCTGTGCATCCTCTGTCCATTCCATTGAAG Cys-to-Ser WD4 RV 5 - CTTCAATGGAATGGACAGAGGATGCACAGGTCATG pcmv-ins FW 5 - CATGGGCCATATGGTGAGCAAGGGCGAGGAACTGTTTACGGGTGTG pcmv-ins RV 5 - GAGTCGCGGCCTTATTTATATAACTCATCCATGCCTAACGTGATACCCG pcmv-vect FW 5 - CATGGATGAGTTATATAAATAAGGCCGCGACTCTAGATCATAATCAGC pcmv-vect RV 5 - CCTTGCTCACCATATGGCCCATG pcmv-nocer FW 5 - CCATGGGAGGAACCTCTGGTGGCCATACTCTGTAC pcmv-nocer RV 5 - GAGGTTCCTCCCATGGTGGCGGCGCTAGC -3 S15