The wonderful world of RNA informatics
|
|
- Camron Heath
- 5 years ago
- Views:
Transcription
1 December 9, 2012
2 Course Goals Familiarize you with the challenges involved in RNA informatics. Introduce commonly used tools, and provide an intuition for how they work. Give you the background and confidence to find, understand, and apply methods in your own work.
3 Introduction 1. Introduction to RNA Non-coding RNA and disease Bacterial ncrnas RNA structure, basepairing Drawing RNA structure 2. RNA structure prediction: Single sequence: Nussinov, Zuker & McCaskill Comparative analysis: alignment folding & Sankoff Comparison of comparative analysis algorithms 3. Homology-search methods Sequence-based methods Profile-based methods Gene-finding Family specific methods 4. RNA Family Practical 5. Extra material for the course can be found here:
4 RNA: why is this stuff interesting? RNA world was an essential step to modern protein-dna based life (using current reasonable models). Which came first, DNA or protein? RNA has catalytic potential (like protein), carries hereditary information (like DNA). Many RNAs involved in essential cellular process. I.e. translation, splicing and regulation of protein expression. 2 3 of the ribosome is RNA. Ribosomal function is preserved even after amino-acid residues are deleted from the active site! Current estimates indicate that the number of ncrna genes is comparable to the number of protein coding genes.
5 RNA and human disease (I) Prader-Willi syndrome: mapped to the C/D box snorna SNORD116 (HBII-85) / w ww.exp ertreviews.org / p q BP1 BP2 BP3 Cen HERC2 GCP5 CYFIP1 NIPA2 NIPA1 HERC2 MKRN3 MAGEL2 NDN C15ORF12 SNURF-SNRPN HBII-436/13 HBII-438A HBII-85 IPW exons HBII-52 HBII-438B UBE3A ATP10C GABRB3 GABRA5 GABRG3 P (OCA2) HERC2 exp ert reviews in m ole c ular m e dicin e Ideogram of chromosome 15, showing genes located in the typical deletion region of Prader-Willi syndrome Expert Reviews in Molecular Medicine C 2005 Cambridge University Press IC snornas Tel Type I deletion Type II deletion Maternally expressed genes (Angelman syndrome genes) Paternally expressed genes (Prader-Willi syndrome candidate genes and snornas) Genes expressed on both chromosomes Genes with paternal biased expression Gene expression status not confirmed Figure 1. Ideogram of chromosome 15, showing genes located in the typical deletion region of Prader Willi syndrome. The locations of genes in this region, 15q11-q13, and their imprinting statuses are shown. The gene order is based on the UCSC Genome Bioinformatics website ( Approximately 40% of subjects with the typical deletion have the type I deletion, and approximately 60% have the type II deletion. Abbreviations: Cen, centromere; Tel, telomere; BP, breakpoint; IC, imprinting centre; snorna, small nucleolar RNA. Ideogram of chromosome 15, showing genes located in the typical deletion region of Prader Willi syndrome 0 1 Sequence conservation G A U G A U G A C U Y C C W Y A H AW C U U R C A U U C G G A C AAA A A A Aa G C UG A GU G A U 5 3 G C G C A U U G C G A G U G A R A A C U C YMU C A A G C U R C U C Sahoo et al. (2008) Prader-Willi phenotype caused by paternal deficiency for the HBII-85 C/D box small nucleolar RNA cluster. Nat Genet. A CC D YY G UC
6 5 3 RNA and human disease (II) mir-96 and deafness U A G M G C G A C G S A U R U A U U A U U A G C G C C G A U C G U A A G Y C G A U C G A U U A U C U U A U U A G C C G U A U G S U U G C UC U G C C U C CU 0 1 Sequence conservation Lewis et al. (2009) An ENU-induced mutation of mir-96 associated with progressive hearing loss in mice. Nat Genet.
7 Bacterial RNA srnas Vogel. (2008) A rough guide to the non-coding RNA world of Salmonella.
8 Bacterial RNA srnas Vogel. (2008) A rough guide to the non-coding RNA world of Salmonella.
9 Riboswitches - expression platforms Nudler & Mironov (2004) The riboswitch control of bacterial metabolism. Trends Biochem Sci.
10 Riboswitches - distribution Barrick & Breaker (2007) The distributions, mechanisms, and structures of metabolite-binding riboswitches. Genome Biol.
11 Bacterial RNA tmrna Source: Wikipedia user Czwieb.
12 Bacterial RNA tmrna Source: Wikipedia user Czwieb.
13 Nucleic acid chemistry R 2 R 1 IUPAC ambiguity chars: R 1 R 1 R 1 RNA DNA R 1: OH H R : H 2 CH 3
14 RNA: structure A Primary Structure Ψ Ψ 5 GCGGAUUUAGCUCAGDDGGGAGAGCGCCAGACUGAAYA.CUGGAGGUCCUGUGT.CGAUCCACAGAAUUCGCACCA 3 B Secondary Structure 75 3 A C C 5 G C A Acceptor C G Stem G C 70 G U T ΨC D Loop 5A U 15 U A Loop D G 60 A U U D A A 65 C U C G U C G G A C A G G A G A C A G 10 C C U 25 G U G 50 G T C C GAG GUC. CG 20 Ψ G A U A G C C Ψ. Variable Anticodon U A Loop G. Loop A A Y 35 T ΨC Loop D Loop C Tertiary Structure Anticodon Loop 5 Acceptor Stem 3
15 RNA: base-pairing Central dogma of structural biology: Sequence determines structure determines function. Canonical (Watson-Crick) base-pairs C G, A U. Non-canonical (Wobble) base-pair G U Note: other non-canonical base-pairs do occur, but these are rare and generally re-defined as tertiary interactions. Images lifted from: pair
16 RNA: base-pairing Yang et al. (2003) Tools for the automatic identification and classification of RNA base pairs, NAR.
17 RNA: base-pairing Yang et al. (2003) Tools for the automatic identification and classification of RNA base pairs, NAR.
18 RNA: base-pairing bpc C:G U:A U:G G:A C:A U:C A:A C:C G:G U:U Total WC 49.8% 14.4% 0.01% 1.2% 0.1% 0.5% % Wb 0.06% 0.06% 7.1% - 0.2% - 0.3% 0.5% 0.2% 0.9% 9.6% Other 0.8% 5.8% 1.5% 9.4% 2.3% 0.6% 2.6% 0.5% 0.7% 0.3% 24.3% Total 50.7% 20.3% 8.7% 10.6% 2.6% 1.0% 2.9% 1.0% 0.9% 1.3% 100.0% Just 71.3% of rrna contacts are canonical or G:U wobble! Lee & Gutell (2004) Diversity of base-pair conformations and their occurrence in rrna structure and RNA structural motifs J Mol Biol.
19 RNA stacking Laurberg et al. (2008) Structural basis for translation termination on the 70S ribosome Nature. Image lifted from:
20 Alanine trna Holley, Apgar, Everett, Madison, Marquisee, Merrill, Penswick & Zamir (1965) Structure of a ribonucleic acid. Science.
21 Tyrosine trna Madison, Everett & Kung (1966) Nucleotide Sequence of a Yeast Tyrosine Transfer RNA. Science.
22 Exercise 1 Split into groups of at most 3 and fold one of the following sequences by hand (use nothing but a pencil, ruler and compass): >A1 AAAAAAGGCGACAGAGUAAUCUGUCGCCUUUUUUCUUUGCUUGC >A2 AAGAAAAACGGGUCGCCAGAAGGUGACCCGUUUUUUUUAUUCUUUUA >A3 AAAAAAGCCCGCACCUGACAGUGCGGGCUUUUUUUUUC >A4 AAAGCCCGUGAGUAUUCACGGGCUUUUUUAUUAUUUAAU >B1 UGGGAGGGACGGCCCUCCUAUCCACCAGCAUAUCAGCCGCGGGGACGACCCUG >B2 GCCCGGGGACGGCCCCGGGCCGUUCGCUUCAACGGGGACGACCCC >B3 CCUCGGGGACGACCUCGAGGCCUCCUGAUACGCAGGGACGACCCUG >B4 GAAGCGGGACGACCCGUUUUCCUUCUUUCAUUGCGCGGGGACGACCCUG >C1 CCAGCCGCUGACGACGGGGCUGGACUUGCUGGGAGCGCCGCCUUUCGGCGCUUCCGUACCCAUGUUGCUUCAAGGAGGAUAUGGCUAUGGCAA >C2 GCCGAUGCCAAUUGGGUCGGCAUGGUCAGGGAGCGCCACGCUUCUUGGCGCUUCCUCGUAUCUAUGUUGCUCUACGGAGGAUGUAGCUAUGAGAA >C3 AGAGCCGCCUGUAAGGGGCUCGCAGUCGAGGAGCUCCGUUCUCUUCGGCGCUCCUCAUCGUCCAUGUUGCUCAAGGAGGAUAUGGCUAUGAGAA >C4 UCGGUCGCCGCAUAAGGGGCCGAUGUGUCAGGGAGCGCCAUGCUUCUUGGCGUUCCCUCGUAUCUAUGUUGCUCCAAGGAGGAUGUAGUUAUGAGAA
23 RNA: structure RNA secondary structure graphs satisfy the following restraints upon the corresponding adjacency matrix A n n. G G G A A A C C C G G G A A A C C 1 0 C 1 Sugar-phosphate backbone: a i,i+1 = 1. Base-pairs are unique: for any i there is at most one k (k i ± 1) satisfying a i,k = 1. Minimal hairpin loop size: for any a i,k = 1 (k i ± 1), i and k satisfy k i > 3 No pseudo-knot criterion: for any a i,j = a k,l = 1 (i < j, k < l) and i < k < j then k < l < j.
24 RNA: representations
25 From a matrix to an image G G G A A A C C C G G G A A A C C 1 0 C 1 GGGAAACCC (((...)))
26 RNA: number of structures A N is the number of possible sequences of length N. A N = 4 N S N is the number of possible secondary structures of length N. S 0 = S 1 = 1 N S N+1 = S N + S j 1 S N j+1 j=1 S N 1.8 N Hofacker et al. (1998) Combinatorics of RNA Secondary Structures, Discrete Applied Mathematics.
27 RNA: representations Tinoco Plot : File: trna_25748 Helix length: 4 The Tinoco plot Type: RNA G C G G A U U U A G C U C A G U U G G G A G A G C G C C A G A C U G A A U A U C U G G A G G U C C U G U G U U C G A U C C A C A G A A U U C G C A C C A A C C A C G C U U A A G A C A C C U A G C U U G U G U C C U G G A G G U C U A U A A G U C A G A C C G C G A G A G G G U U G A C U C G A U U U A G G C G G C G G A U U U A G C U C A G U U G G G A G A G C G C C A G A C U G A A U A U C U G G A G G U C C U G U G U U C G A U C C A C A G A A U U C G C A C C A A:U G:C G:U G C G G A U U U A G C U C A G U U G G G A G A G C G C C A G A C U G A A U A U C U G G A G G U C C U G U G U U C G A U C C A C A G A A U U C G C A C C A
28 Exercise 2 Split into groups of at most 3 and build a dot-plot for one of the following sequences: >A1 AAAAAAGGCGACAGAGUAAUCUGUCGCCUUUUUUCUUUGCUUGC >A2 AAGAAAAACGGGUCGCCAGAAGGUGACCCGUUUUUUUUAUUCUUUUA >A3 AAAAAAGCCCGCACCUGACAGUGCGGGCUUUUUUUUUC >A4 AAAGCCCGUGAGUAUUCACGGGCUUUUUUAUUAUUUAAU >B1 UGGGAGGGACGGCCCUCCUAUCCACCAGCAUAUCAGCCGCGGGGACGACCCUG >B2 GCCCGGGGACGGCCCCGGGCCGUUCGCUUCAACGGGGACGACCCC >B3 CCUCGGGGACGACCUCGAGGCCUCCUGAUACGCAGGGACGACCCUG >B4 GAAGCGGGACGACCCGUUUUCCUUCUUUCAUUGCGCGGGGACGACCCUG >C1 CCAGCCGCUGACGACGGGGCUGGACUUGCUGGGAGCGCCGCCUUUCGGCGCUUCCGUACCCAUGUUGCUUCAAGGAGGAUAUGGCUAUGGCAA >C2 GCCGAUGCCAAUUGGGUCGGCAUGGUCAGGGAGCGCCACGCUUCUUGGCGCUUCCUCGUAUCUAUGUUGCUCUACGGAGGAUGUAGCUAUGAGAA >C3 AGAGCCGCCUGUAAGGGGCUCGCAGUCGAGGAGCUCCGUUCUCUUCGGCGCUCCUCAUCGUCCAUGUUGCUCAAGGAGGAUAUGGCUAUGAGAA >C4 UCGGUCGCCGCAUAAGGGGCCGAUGUGUCAGGGAGCGCCAUGCUUCUUGGCGUUCCCUCGUAUCUAUGUUGCUCCAAGGAGGAUGUAGUUAUGAGAA
29 The end of section one! CC-licensed image from Flickr user cliff1066: North Church, Portsmouth, NH
In Genomes, Two Types of Genes
In Genomes, Two Types of Genes Protein-coding: [Start codon] [codon 1] [codon 2] [ ] [Stop codon] + DNA codons translated to amino acids to form a protein Non-coding RNAs (NcRNAs) No consistent patterns
More informationCombinatorial approaches to RNA folding Part I: Basics
Combinatorial approaches to RNA folding Part I: Basics Matthew Macauley Department of Mathematical Sciences Clemson University http://www.math.clemson.edu/~macaule/ Math 4500, Spring 2015 M. Macauley (Clemson)
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationChapters 12&13 Notes: DNA, RNA & Protein Synthesis
Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Name Period Words to Know: nucleotides, DNA, complementary base pairing, replication, genes, proteins, mrna, rrna, trna, transcription, translation, codon,
More information98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006
98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006 8.3.1 Simple energy minimization Maximizing the number of base pairs as described above does not lead to good structure predictions.
More informationNewly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
More informationSNORNAS HOMOLOGY SEARCH
S HOMOLOGY SEARCH Stephanie Kehr Bioinformatics University of Leipzig Herbstseminar, 2009 MOTIVATION one of most abundand group of ncrna in eucaryotic cells suprisingly diverse regulating functions SNORNAS
More informationDNA/RNA Structure Prediction
C E N T R E F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U Master Course DNA/Protein Structurefunction Analysis and Prediction Lecture 12 DNA/RNA Structure Prediction Epigenectics Epigenomics:
More informationFlow of Genetic Information
presents Flow of Genetic Information A Montagud E Navarro P Fernández de Córdoba JF Urchueguía Elements Nucleic acid DNA RNA building block structure & organization genome building block types Amino acid
More informationPredicting RNA Secondary Structure
7.91 / 7.36 / BE.490 Lecture #6 Mar. 11, 2004 Predicting RNA Secondary Structure Chris Burge Review of Markov Models & DNA Evolution CpG Island HMM The Viterbi Algorithm Real World HMMs Markov Models for
More informationReading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationUNIT 5. Protein Synthesis 11/22/16
UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA
More informationFrom gene to protein. Premedical biology
From gene to protein Premedical biology Central dogma of Biology, Molecular Biology, Genetics transcription replication reverse transcription translation DNA RNA Protein RNA chemically similar to DNA,
More information(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
More informationIntroduction to Molecular and Cell Biology
Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What
More informationGCD3033:Cell Biology. Transcription
Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors
More information2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology
2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the
More informationVideos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.
Translation Translation Videos Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.be/itsb2sqr-r0 Translation Translation The
More information9/11/18. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes
Molecular and Cellular Biology Animal Cell ((eukaryotic cell) -----> compare with prokaryotic cell) ENDOPLASMIC RETICULUM (ER) Rough ER Smooth ER Flagellum Nuclear envelope Nucleolus NUCLEUS Chromatin
More informationMultiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
More informationTypes of RNA. 1. Messenger RNA(mRNA): 1. Represents only 5% of the total RNA in the cell.
RNAs L.Os. Know the different types of RNA & their relative concentration Know the structure of each RNA Understand their functions Know their locations in the cell Understand the differences between prokaryotic
More informationIntroduction to molecular biology. Mitesh Shrestha
Introduction to molecular biology Mitesh Shrestha Molecular biology: definition Molecular biology is the study of molecular underpinnings of the process of replication, transcription and translation of
More informationGrand Plan. RNA very basic structure 3D structure Secondary structure / predictions The RNA world
Grand Plan RNA very basic structure 3D structure Secondary structure / predictions The RNA world very quick Andrew Torda, April 2017 Andrew Torda 10/04/2017 [ 1 ] Roles of molecules RNA DNA proteins genetic
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri RNA Structure Prediction Secondary
More informationRNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17
RNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17 Dr. Stefan Simm, 01.11.2016 simm@bio.uni-frankfurt.de RNA secondary structures a. hairpin loop b. stem c. bulge loop d. interior loop e. multi
More informationBCB 444/544 Fall 07 Dobbs 1
BCB 444/544 Required Reading (before lecture) Lecture 25 Mon Oct 15 - Lecture 23 Protein Tertiary Structure Prediction Chp 15 - pp 214-230 More RNA Structure Wed Oct 17 & Thurs Oct 18 - Lecture 24 & Lab
More informationBME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
More informationRNA Basics. RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U. Bases can only pair with one other base. wobble pairing. 23 Hydrogen Bonds more stable
RNA STRUCTURE RNA Basics RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U wobble pairing Bases can only pair with one other base. 23 Hydrogen Bonds more stable RNA Basics transfer RNA (trna) messenger
More informationStudy Guide: Fall Final Exam H O N O R S B I O L O G Y : U N I T S 1-5
Study Guide: Fall Final Exam H O N O R S B I O L O G Y : U N I T S 1-5 Directions: The list below identifies topics, terms, and concepts that will be addressed on your Fall Final Exam. This list should
More informationAlgorithms in Computational Biology (236522) spring 2008 Lecture #1
Algorithms in Computational Biology (236522) spring 2008 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: 15:30-16:30/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office hours:??
More informationPROTEIN SYNTHESIS INTRO
MR. POMERANTZ Page 1 of 6 Protein synthesis Intro. Use the text book to help properly answer the following questions 1. RNA differs from DNA in that RNA a. is single-stranded. c. contains the nitrogen
More information1. In most cases, genes code for and it is that
Name Chapter 10 Reading Guide From DNA to Protein: Gene Expression Concept 10.1 Genetics Shows That Genes Code for Proteins 1. In most cases, genes code for and it is that determine. 2. Describe what Garrod
More informationRelated Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever.
CSE 527 Computational Biology http://www.cs.washington.edu/527 Lecture 1: Overview & Bio Review Autumn 2004 Larry Ruzzo Related Courses He who asks is a fool for five minutes, but he who does not ask remains
More informationCOMP 598 Advanced Computational Biology Methods & Research. Introduction. Jérôme Waldispühl School of Computer Science McGill University
COMP 598 Advanced Computational Biology Methods & Research Introduction Jérôme Waldispühl School of Computer Science McGill University General informations (1) Office hours: by appointment Office: TR3018
More informationHairpin Database: Why and How?
Hairpin Database: Why and How? Clark Jeffries Research Professor Renaissance Computing Institute and School of Pharmacy University of North Carolina at Chapel Hill, United States Why should a database
More informationEarly History up to Schedule. Proteins DNA & RNA Schwann and Schleiden Cell Theory Charles Darwin publishes Origin of Species
Schedule Bioinformatics and Computational Biology: History and Biological Background (JH) 0.0 he Parsimony criterion GKN.0 Stochastic Models of Sequence Evolution GKN 7.0 he Likelihood criterion GKN 0.0
More informationLab III: Computational Biology and RNA Structure Prediction. Biochemistry 208 David Mathews Department of Biochemistry & Biophysics
Lab III: Computational Biology and RNA Structure Prediction Biochemistry 208 David Mathews Department of Biochemistry & Biophysics Contact Info: David_Mathews@urmc.rochester.edu Phone: x51734 Office: 3-8816
More informationSequence analysis and comparison
The aim with sequence identification: Sequence analysis and comparison Marjolein Thunnissen Lund September 2012 Is there any known protein sequence that is homologous to mine? Are there any other species
More informationFull file at CHAPTER 2 Genetics
CHAPTER 2 Genetics MULTIPLE CHOICE 1. Chromosomes are a. small linear bodies. b. contained in cells. c. replicated during cell division. 2. A cross between true-breeding plants bearing yellow seeds produces
More informationLecture 12. DNA/RNA Structure Prediction. Epigenectics Epigenomics: Gene Expression
C N F O N G A V B O N F O M A C S V U Master Course DNA/Protein Structurefunction Analysis and Prediction Lecture 12 DNA/NA Structure Prediction pigenectics pigenomics: Gene xpression ranscription factors
More informationDetecting non-coding RNA in Genomic Sequences
Detecting non-coding RNA in Genomic Sequences I. Overview of ncrnas II. What s specific about RNA detection? III. Looking for known RNAs IV. Looking for unknown RNAs Daniel Gautheret INSERM ERM 206 & Université
More informationTranslation Part 2 of Protein Synthesis
Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation
More informationChapter 17. From Gene to Protein. Biology Kevin Dees
Chapter 17 From Gene to Protein DNA The information molecule Sequences of bases is a code DNA organized in to chromosomes Chromosomes are organized into genes What do the genes actually say??? Reflecting
More informationMATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME
MATHEMATICAL MODELING AND THE HUMAN GENOME Hilary S. Booth Australian National University, Australia Keywords: Human genome, DNA, bioinformatics, sequence analysis, evolution. Contents 1. Introduction:
More informationA different perspective. Genes, bioinformatics and dynamics. Metaphysics of science. The gene. Peter R Wills
Genes, bioinformatics and dynamics A different perspective Peter R Wills Department of Physics University of Auckland Supported by the Alexander von Humboldt Foundation Metaphysics of science The Greeks
More informationRNA & PROTEIN SYNTHESIS. Making Proteins Using Directions From DNA
RNA & PROTEIN SYNTHESIS Making Proteins Using Directions From DNA RNA & Protein Synthesis v Nitrogenous bases in DNA contain information that directs protein synthesis v DNA remains in nucleus v in order
More informationOrganic Chemistry Option II: Chemical Biology
Organic Chemistry Option II: Chemical Biology Recommended books: Dr Stuart Conway Department of Chemistry, Chemistry Research Laboratory, University of Oxford email: stuart.conway@chem.ox.ac.uk Teaching
More informationRNA secondary structure prediction. Farhat Habib
RNA secondary structure prediction Farhat Habib RNA RNA is similar to DNA chemically. It is usually only a single strand. T(hyamine) is replaced by U(racil) Some forms of RNA can form secondary structures
More informationDescribing RNA Structure by Libraries of Clustered Nucleotide Doublets
doi:10.1016/j.jmb.2005.06.024 J. Mol. Biol. (2005) 351, 26 38 Describing RNA Structure by Libraries of Clustered Nucleotide Doublets Michael T. Sykes* and Michael Levitt Department of Structural Biology,
More informationGenome 559 Wi RNA Function, Search, Discovery
Genome 559 Wi 2009 RN Function, Search, Discovery The Message Cells make lots of RN noncoding RN Functionally important, functionally diverse Structurally complex New tools required alignment, discovery,
More informationUnit 3 - Molecular Biology & Genetics - Review Packet
Name Date Hour Unit 3 - Molecular Biology & Genetics - Review Packet True / False Questions - Indicate True or False for the following statements. 1. Eye color, hair color and the shape of your ears can
More informationProcesamiento Post-transcripcional en eucariotas. Biología Molecular 2009
Procesamiento Post-transcripcional en eucariotas Biología Molecular 2009 Figure 6-21 Molecular Biology of the Cell ( Garland Science 2008) Figure 6-22a Molecular Biology of the Cell ( Garland Science 2008)
More information+ regulation. ribosomes
central dogma + regulation rpl DNA tsx rrna trna mrna ribosomes tsl ribosomal proteins structural proteins transporters enzymes srna regulators RNAp DNAp tsx initiation control by transcription factors
More informationSensing Metabolic Signals with Nascent RNA Transcripts: The T Box and S Box Riboswitches as Paradigms
Sensing Metabolic Signals with Nascent RNA Transcripts: The T Box and S Box Riboswitches as Paradigms T.M. HENKIN AND F.J. GRUNDY Department of Microbiology and The RNA Group, The Ohio State University,
More informationRGP finder: prediction of Genomic Islands
Training courses on MicroScope platform RGP finder: prediction of Genomic Islands Dynamics of bacterial genomes Gene gain Horizontal gene transfer Gene loss Deletion of one or several genes Duplication
More informationRevisiting the Central Dogma The role of Small RNA in Bacteria
Graduate Student Seminar Revisiting the Central Dogma The role of Small RNA in Bacteria The Chinese University of Hong Kong Supervisor : Prof. Margaret Ip Faculty of Medicine Student : Helen Ma (PhD student)
More informationChapter 16 Lecture. Concepts Of Genetics. Tenth Edition. Regulation of Gene Expression in Prokaryotes
Chapter 16 Lecture Concepts Of Genetics Tenth Edition Regulation of Gene Expression in Prokaryotes Chapter Contents 16.1 Prokaryotes Regulate Gene Expression in Response to Environmental Conditions 16.2
More informationRNA and Protein Structure Prediction
RNA and Protein Structure Prediction Bioinformatics: Issues and Algorithms CSE 308-408 Spring 2007 Lecture 18-1- Outline Multi-Dimensional Nature of Life RNA Secondary Structure Prediction Protein Structure
More informationChapter 9 DNA recognition by eukaryotic transcription factors
Chapter 9 DNA recognition by eukaryotic transcription factors TRANSCRIPTION 101 Eukaryotic RNA polymerases RNA polymerase RNA polymerase I RNA polymerase II RNA polymerase III RNA polymerase IV Function
More informationOrganization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=
More informationUsing SetPSO to determine RNA secondary structure
Using SetPSO to determine RNA secondary structure by Charles Marais Neethling Submitted in partial fulfilment of the requirements for the degree of Master of Science (Computer Science) in the Faculty of
More informationFrom Gene to Protein
From Gene to Protein Gene Expression Process by which DNA directs the synthesis of a protein 2 stages transcription translation All organisms One gene one protein 1. Transcription of DNA Gene Composed
More informationCellular Neuroanatomy I The Prototypical Neuron: Soma. Reading: BCP Chapter 2
Cellular Neuroanatomy I The Prototypical Neuron: Soma Reading: BCP Chapter 2 Functional Unit of the Nervous System The functional unit of the nervous system is the neuron. Neurons are cells specialized
More informationBio 1B Lecture Outline (please print and bring along) Fall, 2007
Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution
More informationComparative genomics: Overview & Tools + MUMmer algorithm
Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first
More informationBioinformatics Chapter 1. Introduction
Bioinformatics Chapter 1. Introduction Outline! Biological Data in Digital Symbol Sequences! Genomes Diversity, Size, and Structure! Proteins and Proteomes! On the Information Content of Biological Sequences!
More informationMotivating the need for optimal sequence alignments...
1 Motivating the need for optimal sequence alignments... 2 3 Note that this actually combines two objectives of optimal sequence alignments: (i) use the score of the alignment o infer homology; (ii) use
More informationSugars, such as glucose or fructose are the basic building blocks of more complex carbohydrates. Which of the following
Name: Score: / Quiz 2 on Lectures 3 &4 Part 1 Sugars, such as glucose or fructose are the basic building blocks of more complex carbohydrates. Which of the following foods is not a significant source of
More informationNovel Algorithms for Structural Alignment of Noncoding
Washington University in St. Louis Washington University Open Scholarship All Theses and Dissertations (ETDs) January 2010 Novel Algorithms for Structural Alignment of Noncoding RNAs Diana Kolbe Washington
More informationChapter 12. Genes: Expression and Regulation
Chapter 12 Genes: Expression and Regulation 1 DNA Transcription or RNA Synthesis produces three types of RNA trna carries amino acids during protein synthesis rrna component of ribosomes mrna directs protein
More informationIntroduction to Evolutionary Concepts
Introduction to Evolutionary Concepts and VMD/MultiSeq - Part I Zaida (Zan) Luthey-Schulten Dept. Chemistry, Beckman Institute, Biophysics, Institute of Genomics Biology, & Physics NIH Workshop 2009 VMD/MultiSeq
More informationASSESSING TRANSLATIONAL EFFICIACY THROUGH POLY(A)- TAIL PROFILING AND IN VIVO RNA SECONDARY STRUCTURE DETERMINATION
ASSESSING TRANSLATIONAL EFFICIACY THROUGH POLY(A)- TAIL PROFILING AND IN VIVO RNA SECONDARY STRUCTURE DETERMINATION Journal Club, April 15th 2014 Karl Frontzek, Institute of Neuropathology POLY(A)-TAIL
More informationThe Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11
The Eukaryotic Genome and Its Expression Lecture Series 11 The Eukaryotic Genome and Its Expression A. The Eukaryotic Genome B. Repetitive Sequences (rem: teleomeres) C. The Structures of Protein-Coding
More informationComputational Cell Biology Lecture 4
Computational Cell Biology Lecture 4 Case Study: Basic Modeling in Gene Expression Yang Cao Department of Computer Science DNA Structure and Base Pair Gene Expression Gene is just a small part of DNA.
More information9/2/17. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes
Molecular and Cellular Biology Animal Cell ((eukaryotic cell) -----> compare with prokaryotic cell) ENDOPLASMIC RETICULUM (ER) Rough ER Smooth ER Flagellum Nuclear envelope Nucleolus NUCLEUS Chromatin
More informationBerg Tymoczko Stryer Biochemistry Sixth Edition Chapter 1:
Berg Tymoczko Stryer Biochemistry Sixth Edition Chapter 1: Biochemistry: An Evolving Science Tips on note taking... Remember copies of my lectures are available on my webpage If you forget to print them
More informationInitiation of translation in eukaryotic cells:connecting the head and tail
Initiation of translation in eukaryotic cells:connecting the head and tail GCCRCCAUGG 1: Multiple initiation factors with distinct biochemical roles (linking, tethering, recruiting, and scanning) 2: 5
More informationIntroduction to the Ribosome Overview of protein synthesis on the ribosome Prof. Anders Liljas
Introduction to the Ribosome Molecular Biophysics Lund University 1 A B C D E F G H I J Genome Protein aa1 aa2 aa3 aa4 aa5 aa6 aa7 aa10 aa9 aa8 aa11 aa12 aa13 a a 14 How is a polypeptide synthesized? 2
More informationRecitaLon CB Lecture #10 RNA Secondary Structure
RecitaLon 3-19 CB Lecture #10 RNA Secondary Structure 1 Announcements 2 Exam 1 grades and answer key will be posted Friday a=ernoon We will try to make exams available for pickup Friday a=ernoon (probably
More informationThe wonderful world of NUCLEIC ACID NMR!
Lecture 12 M230 Feigon Sequential resonance assignments in DNA (and RNA): homonuclear method 2 structure determination Reading resources Evans Chap 9 The wonderful world of NUCLEIC ACID NMR! Catalytically
More informationCSCE555 Bioinformatics. Protein Function Annotation
CSCE555 Bioinformatics Protein Function Annotation Why we need to do function annotation? Fig from: Network-based prediction of protein function. Molecular Systems Biology 3:88. 2007 What s function? The
More informationPart III - Bioinformatics Study of Aminoacyl trna Synthetases. VMD Multiseq Tutorial Web tools. Perth, Australia 2004 Computational Biology Workshop
Part III - Bioinformatics Study of Aminoacyl trna Synthetases VMD Multiseq Tutorial Web tools Perth, Australia 2004 Computational Biology Workshop Multiple Sequence Alignments The aminoacyl-trna synthetases,
More informationGenetics 304 Lecture 6
Genetics 304 Lecture 6 00/01/27 Assigned Readings Busby, S. and R.H. Ebright (1994). Promoter structure, promoter recognition, and transcription activation in prokaryotes. Cell 79:743-746. Reed, W.L. and
More informationWhat is the central dogma of biology?
Bellringer What is the central dogma of biology? A. RNA DNA Protein B. DNA Protein Gene C. DNA Gene RNA D. DNA RNA Protein Review of DNA processes Replication (7.1) Transcription(7.2) Translation(7.3)
More informationChapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
More informationGenome Annotation. Bioinformatics and Computational Biology. Genome sequencing Assembly. Gene prediction. Protein targeting.
Genome Annotation Bioinformatics and Computational Biology Genome Annotation Frank Oliver Glöckner 1 Genome Analysis Roadmap Genome sequencing Assembly Gene prediction Protein targeting trna prediction
More informationDe novo prediction of structural noncoding RNAs
1/ 38 De novo prediction of structural noncoding RNAs Stefan Washietl 18.417 - Fall 2011 2/ 38 Outline Motivation: Biological importance of (noncoding) RNAs Algorithms to predict structural noncoding RNAs
More informationDANNY BARASH ABSTRACT
JOURNAL OF COMPUTATIONAL BIOLOGY Volume 11, Number 6, 2004 Mary Ann Liebert, Inc. Pp. 1169 1174 Spectral Decomposition for the Search and Analysis of RNA Secondary Structure DANNY BARASH ABSTRACT Scales
More informationTaxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
More informationBio 119 Bacterial Genomics 6/26/10
BACTERIAL GENOMICS Reading in BOM-12: Sec. 11.1 Genetic Map of the E. coli Chromosome p. 279 Sec. 13.2 Prokaryotic Genomes: Sizes and ORF Contents p. 344 Sec. 13.3 Prokaryotic Genomes: Bioinformatic Analysis
More informationTime allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2017-2018 GENETICS BIO-5009A Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section
More informationSection 7. Junaid Malek, M.D.
Section 7 Junaid Malek, M.D. RNA Processing and Nomenclature For the purposes of this class, please do not refer to anything as mrna that has not been completely processed (spliced, capped, tailed) RNAs
More informationQuantum Chemical Studies Of Nucleic Acids Can We Construct A Bridge To The Rna Structural Biology And Bioinformatics Communities?
Bowling Green State University ScholarWorks@BGSU Chemistry Faculty Publications Chemistry 12-2010 Quantum Chemical Studies Of Nucleic Acids Can We Construct A Bridge To The Rna Structural Biology And Bioinformatics
More information10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison
10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:
More informationSearching genomes for non-coding RNA using FastR
Searching genomes for non-coding RNA using FastR Shaojie Zhang Brian Haas Eleazar Eskin Vineet Bafna Keywords: non-coding RNA, database search, filtration, riboswitch, bacterial genome. Address for correspondence:
More informationThe Riboswitch is functionally separated into the ligand binding APTAMER and the decision-making EXPRESSION PLATFORM
The Riboswitch is functionally separated into the ligand binding APTAMER and the decision-making EXPRESSION PLATFORM Purine riboswitch TPP riboswitch SAM riboswitch glms ribozyme In-line probing is used
More informationRapid Dynamic Programming Algorithms for RNA Secondary Structure
ADVANCES IN APPLIED MATHEMATICS 7,455-464 I f Rapid Dynamic Programming Algorithms for RNA Secondary Structure MICHAEL S. WATERMAN* Depurtments of Muthemutics und of Biologicul Sciences, Universitk of
More informationLesson Overview. Ribosomes and Protein Synthesis 13.2
13.2 The Genetic Code The first step in decoding genetic messages is to transcribe a nucleotide base sequence from DNA to mrna. This transcribed information contains a code for making proteins. The Genetic
More informationProtein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation.
Protein Synthesis Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Protein Synthesis: Protein synthesis uses the information in genes to make proteins. 2 Steps
More informationUNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking
More information